Use of a composition in the manufacture of a product for the prevention or treatment of colorectal cancer

Abstract

The application provides application of a composition in preparation of a product for preventing and treating colorectal cancer, and belongs to the technical field of prevention and treatment of colorectal cancer. The application provides application of a composition prepared from the following raw materials: dry toad skin, Herba Scutellariae, Rhizoma Gastrodiae, Fructus Camptododii, American ginseng, Herba Agrimoniae and Ganoderma lucidum in preparation of a product for preventing and treating colorectal cancer. The composition provided by the application can inhibit the progress of colorectal cancer from multiple pharmacodynamic links, has an inhibiting effect on the proliferation of colorectal cancer cells, can reduce the colony formation ability, migration ability and invasion ability of colorectal cancer cells, and can induce the cell cycle of colorectal cancer to show a G2 / M phase arrest trend. In addition, the composition provided by the application has obvious in-vivo tumor inhibition effect and good preliminary safety, and can improve symptoms such as body fatigue, colorectal cancer pain and poor appetite.

Description

Technical Field

[0001] This invention belongs to the field of colorectal cancer prevention and treatment technology, specifically relating to the application of a composition in the preparation of products for the prevention and treatment of colorectal cancer. Background Technology

[0002] Colorectal cancer is a highly prevalent malignant tumor of the digestive system worldwide, ranking among the top in incidence and mortality rates of all malignant tumors. Influenced by factors such as dietary structure, lifestyle habits, and population aging, the incidence and mortality burden of colorectal cancer continues to increase, and the age of onset is trending younger.

[0003] Currently, clinical treatments for colorectal cancer include surgical resection, radiotherapy, chemotherapy, targeted therapy, and immunotherapy. While these treatments have continuously improved patient prognosis, advanced colorectal cancer still faces challenges such as high tumor recurrence rates, high rates of distant metastasis, significant adverse reactions to chemotherapy, insufficient long-term tolerance, and decreased quality of life. Currently, for patients with advanced colorectal cancer, radiotherapy and chemotherapy have severe toxic side effects, and the probability of tumor metastasis and recurrence remains high after surgery and treatment, seriously affecting clinical treatment outcomes and patient survival. Furthermore, there is a lack of safe and effective dedicated traditional Chinese medicine adjuvant therapy drugs, making it difficult to meet the clinical needs of patients with advanced colorectal cancer. Therefore, developing safe, effective, long-term-use drugs with adjuvant therapy potential is of great significance. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide an application of the composition in the preparation of products for the prevention and treatment of colorectal cancer. The composition provided by the present invention has significant efficacy in the treatment of colorectal cancer and can be used for the treatment or adjuvant treatment of colorectal cancer. Moreover, the composition of the present invention exerts its effects by regulating the PI3K / Akt signaling pathway, promoting apoptosis, inducing cell cycle arrest, and inhibiting tumor proliferation.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an application of a composition in the preparation of a product for the prevention and treatment of colorectal cancer. The composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts agrimony, and 6-24 parts Ganoderma lucidum.

[0006] The present invention also provides an application of the composition in the preparation of any of the following products: (1) inhibiting the proliferation of colorectal cancer cells; (2) inhibiting the migration of colorectal cancer cells; (3) inhibiting the invasion of colorectal cancer cells; (4) promoting apoptosis of colorectal cancer cells; (5) inducing G2 / M phase arrest of colorectal cancer cells; (6) regulating the PI3K / Akt signaling pathway; (7) reducing Ki67 expression in colorectal cancer tissue; (8) improving symptoms of fatigue, cancer pain and / or poor appetite in patients with colorectal cancer; the composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts Agrimonia pilosa and 6-24 parts Ganoderma lucidum.

[0007] Preferably, the colorectal cancer cells include SW620 cells, SW480 cells, HCT116 cells, HT-29 cells, and / or LoVo cells.

[0008] Preferably, the preparation method of the composition includes the following steps: mixing the raw materials in the composition to obtain a mixture, mixing the mixture with water, and boiling to obtain the composition.

[0009] Preferably, the mass ratio of the mixture to water is 1:8~12.

[0010] Preferably, the decoction is performed 2 to 3 times, and each decoction lasts for 1 hour.

[0011] Preferably, the composition exerts its anti-colorectal cancer effect through the PI3K / Akt pathway.

[0012] The beneficial effects of this invention are: The composition provided by this invention can inhibit the progression of colorectal cancer through multiple pharmacodynamic mechanisms. It inhibits the proliferation of colorectal cancer cells, reduces their clonogenic ability, migration ability, and invasive ability, and induces a redistribution of the cell cycle from the G0 / G1 phase to the S and G2 / M phases, exhibiting a G2 / M phase arrest trend. This indicates that the composition of this invention does not only exhibit a single cytotoxic effect on colorectal cancer cells, but can simultaneously affect the proliferation, invasion and metastasis-related behaviors of colorectal cancer cells and cell cycle progression. In addition, the composition provided by this invention has significant in vivo tumor-suppressing effects and good preliminary safety, and can improve symptoms such as physical fatigue, colorectal cancer pain, and poor appetite. Attached Figure Description

[0013] Figure 1 The results show the effects of the composition (QWCS) obtained in Example 1 on different tumor cells. From left to right, the results are as follows: HCT116 cell blank group observation results, QWCS treatment group (48 μg / mL) observation results, and IC50 of different cell types.50 Statistical results, among which This means p < 0.001.

[0014] Figure 2 The results show the effect of the composition (QWCS) obtained in Example 1 on the proliferation of different colorectal cancer cells, where A represents the results of human colorectal cancer cells SW620, B represents the results of human colorectal cancer cells SW480, C represents the results of human colorectal cancer cells HCT116, D represents the results of human colorectal cancer cells HT-29, E represents the results of human colorectal cancer cells LoVo, and F represents the IC50 of human colorectal cancer cells HCT116. 50 Statistical results show that G represents the IC50 value for human colorectal cancer cells SW480. 50 Value statistics results, among which This means p < 0.001.

[0015] Figure 3 The effect of the composition (QWCS) obtained in Example 1 on colony formation ability is shown in Figure A, where A represents the results for HCT116 cells and B represents the results for SW480 cells. This indicates that p < 0.05. This indicates that p < 0.01. This means p < 0.001.

[0016] Figure 4 The results of the wound healing assay, which examined the effect of the composition (QWCS) obtained in Example 1 on the migration ability of HCT116 and SW480 cells, are shown in Figure A (HCT116 cells) and Figure B (SW480 cells). This indicates that p < 0.05. This indicates that p < 0.01. This means p < 0.001.

[0017] Figure 5 The Transwell assay was used to detect the effect of the composition obtained in Example 1 (QWCS) on the invasion and migration abilities of HCT116 and SW480 cells. In the figure, A represents the number of invasive HCT116 cells, B represents the number of migrating HCT116 cells, C represents the number of invasive SW480 cells, and D represents the number of migrating SW480 cells. This indicates that p < 0.05. This indicates that p < 0.01. This means p < 0.001.

[0018] Figure 6 The effect of the composition (QWCS) obtained in Example 1 on the cell cycle distribution of HCT116 and SW480 cells is shown in Figure A, where A represents the results for HCT116 cells and B represents the results for SW480 cells. This means p < 0.001.

[0019] Figure 7 The results of network pharmacology and molecular docking analysis of the composition (QWCS) obtained in Example 1 are shown, where A is the Venn diagram, B is the PPI network result, C and D are the KEGG enrichment results, and E is the molecular docking result.

[0020] Figure 8 The results show the effects of the composition (QWCS) obtained in Example 1 on the proteome of HCT116 cells, where A is a volcano plot of differentially expressed proteins (DEPs); B is a cluster analysis of DEPs; C is principal component analysis (PCA); D is a GO enrichment analysis of DEPs between the QWCS group and the control group; and E is a KEGG enrichment analysis of DEPs between the QWCS group and the control group.

[0021] Figure 9 The results show the effects of the composition (QWCS) obtained in Example 1 on the transcriptome of HCT116 cells, where A represents statistical differences; B represents the volcano plot of differentially expressed genes (DEGs); C represents principal component analysis (PCA); D represents the cluster analysis of differentially expressed genes; E represents the correlation analysis between samples; F represents the Venn diagram analysis of differentially expressed genes; G represents the GO enrichment analysis of differentially expressed genes between the QWCS group and the control group; and H represents the KEGG enrichment analysis of differentially expressed genes between the QWCS group and the control group.

[0022] Figure 10 The effects of the composition (QWCS) obtained in Example 1 on the expression of P-PI3K / PI3K, P-Akt / Akt, HSP90, and apoptosis-related proteins in HCT116 and SW480 cells are shown in Figure A, where A represents the results for HCT116 cells and B represents the results for SW480 cells. This indicates that p < 0.05. This indicates that p < 0.01. This means p < 0.001.

[0023] Figure 11 The effect of the composition (QWCS) obtained in Example 1 on the mRNA expression levels of target genes in each group of HCT116 and SW480 cells is shown in Figure A, where A represents the results for HCT116 cells and B represents the results for SW480 cells. This indicates that p < 0.05. This indicates that p < 0.01. This means p < 0.001.

[0024] Figure 12The effects of the composition (QWCS) obtained in Example 1 on body weight, tumor volume, and tumor mass in nude mice are shown in Figure 1. A represents the anatomical results of tumors in some mice from each group; B represents the body weight of the nude mice; C represents the tumor volume; and D represents the tumor mass. This means p < 0.001.

[0025] Figure 13 The effect of the composition (QWCS) obtained in Example 1 on the pathological morphology of tumor tissue and Ki67 protein expression in nude mice.

[0026] Figure 14 The effect of the composition (QWCS) obtained in Example 1 on normal human colonic epithelial cells NCM460. Detailed Implementation

[0027] This invention provides an application of a composition in the preparation of any of the following products: (1) prevention and treatment of colorectal cancer; (2) inhibition of colorectal cancer cell proliferation; (3) inhibition of colorectal cancer cell migration; (4) inhibition of colorectal cancer cell invasion; (5) promotion of colorectal cancer cell apoptosis; (6) induction of G2 / M phase arrest in colorectal cancer cells; (7) regulation of the PI3K / Akt signaling pathway; (8) reduction of Ki67 expression in colorectal cancer tissue; (9) improvement of symptoms such as fatigue, cancer pain and / or poor appetite in patients with colorectal cancer; the composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts Agrimonia pilosa and 6-24 parts Ganoderma lucidum.

[0028] In the application described in this invention, the dried toad skin is the dried skin of the Chinese giant toad (Bufo gargarizans); the gecko is the dried whole body of the gecko (Gecko esculenta) or gecko spp. (Gecko spp.); the golden buckwheat is the dried rhizome of the golden buckwheat plant (Polygonaceae); the camptotheca fruit is the fruit of the camptotheca plant (Davidia involucrata); the American ginseng is the dried root of the American ginseng plant (Araliaceae); the agrimony is the dried aerial part of the agrimony plant (Rosaceae); and the Ganoderma lucidum is the dried fruiting body of the fungus Ganoderma lucidum (Ganoderma sinense) or Ganoderma purpurea (Ganoderma lucidum). In the application described in this invention, the dried toad skin and gecko dissipate masses and nodules, break up blood stasis and relieve pain; the golden buckwheat and camptotheca fruit attack tumors, detoxify and dissipate nodules, break up blood stasis; and the American ginseng, agrimony, and Ganoderma lucidum nourish qi and yin, calm the mind, nourish the five internal organs, and harmonize toxicity.

[0029] In this invention, the dried toad skin is preferably 3-7 parts by weight, more preferably 4-6 parts, and most preferably 5 parts; the gecko is preferably 3-7 parts by weight, more preferably 4-6 parts, and most preferably 5 parts; the buckwheat is preferably 35-45 parts by weight, more preferably 38-42 parts, and most preferably 40 parts; the camptotheca fruit is preferably 25-35 parts by weight, more preferably 28-32 parts, and most preferably 30 parts; the American ginseng is preferably 6-14 parts by weight, more preferably 8-12 parts, and most preferably 10 parts; the agrimony is preferably 15-25 parts by weight, more preferably 18-22 parts, and most preferably 20 parts; and the Ganoderma lucidum is preferably 10-20 parts by weight, more preferably 12-18 parts, and most preferably 15 parts.

[0030] In this invention, the preferred colorectal cancer cells include SW620 cells, SW480 cells, HCT116 cells, HT-29 cells, and / or LoVo cells. The composition provided by this invention shows inhibitory effects on the proliferation of five types of human colorectal cancer cells: SW620, SW480, HCT116, HT-29, and LoVo. HCT116 and SW480 cells are particularly sensitive to the composition of this invention, with an IC50 concentration of [missing value]. 50 The concentrations were 45.85 μg / mL and 161.0 μg / mL, respectively. Subsequent functional experiments were conducted using this IC. 50 The results were based on setting low, medium, and high concentration gradients, with HCT116 cells at approximately 0.5, 1, and 2 times the IC50. 50 The concentrations were set to 23, 46, and 92 μg / mL, with SW480 cells reacting at approximately 0.5, 1, and 2 times the IC50 concentration. 50 The concentrations were set to 80.5, 161, and 322 μg / mL to establish a continuous chain of evidence for changes in molecular patterns related to cell proliferation inhibition, migration and invasion inhibition, cell cycle arrest, and apoptosis.

[0031] The composition provided by this invention can inhibit the progression of colorectal cancer through multiple pharmacodynamic mechanisms. The composition can reduce the colony-forming ability, migration ability, and invasion ability of HCT116 and SW480 cells, with the regulatory effect being concentration-dependent. It also induces a redistribution of the cell cycle from the G0 / G1 phase to the S and G2 / M phases, exhibiting a G2 / M phase arrest trend, suggesting that it does not only exhibit a single cytotoxic effect but can simultaneously affect proliferation, invasion and metastasis-related behaviors, and cell cycle progression.

[0032] The composition provided by this invention exhibits significant in vivo tumor-suppressing effects and preliminary good safety profile. In a subcutaneous xenograft tumor model of HCT116 cells in nude mice, after continuous administration of the low, medium, and high dose groups (277, 554, and 1108 mg / kg) of the composition for 14 days, tumor volume and weight were significantly reduced compared to the model and the positive control drug 5-FU, with no significant difference in body weight among the nude mice. HE staining showed an increase in the necrotic area of ​​the tumor tissue, sparse cell arrangement, and reduced mitotic figures after administration; Ki67 immunohistochemistry showed a decrease in tumor proliferation.

[0033] The mechanism of action data of the compositions provided in this invention are complete. Network pharmacology screening identified 308 common targets of the compositions of this invention and colorectal cancer, with core targets including AKT1, TP53, CASP3, IL-6, and JUN. GO and KEGG enrichment suggests that pathways such as PI3K / Akt, MAPK, cell cycle, and p53 are involved. Molecular docking showed that quercetin, luteolin, and kaempferol have good binding affinity to AKT1, with binding energies of -8.256, -8.215, and -7.828 kcal / mol, respectively.

[0034] Molecular validation results support the anti-colorectal cancer effect of the composition of this invention through the PI3K / Akt pathway. Proteomics showed that after treatment of HCT116 cells with the composition of this invention, differentially expressed proteins included 48 upregulated proteins and 358 downregulated proteins, enriched in pathways such as cell cycle, PI3K / Akt signaling pathway, p53 signaling pathway, and ECM-receptor interaction; transcriptomics showed 6225 differentially expressed genes, of which 2224 were significantly upregulated and 4001 were significantly downregulated, significantly enriched in pathways such as PI3K / Akt, MAPK, and cell cycle. Western blot and RT-qPCR further demonstrated that the composition of this invention can downregulate the expression of PI3K, Akt, HSP90, and Bcl-2, and upregulate the expression of Bax and Caspase-3. In addition, the composition of this invention has a comprehensive regulatory effect on the PI3K / Akt pathway, apoptosis-related genes and proteins, and cell cycle-related processes. Over the past three years, the composition of this invention has been used in the diagnosis and treatment of stage IV colorectal cancer patients. After a 12-month follow-up, the patient survival rate reached 69.4%, and symptoms such as physical fatigue, cancer pain, and poor appetite were improved.

[0035] In this invention, the preferred method for preparing the composition includes the following steps: mixing the raw materials in the composition to obtain a mixture, mixing the mixture with water, and decocting to obtain the composition. In this invention, the mass ratio of the mixture to water is preferably 1:8 to 12, more preferably 1:10; the number of decoctions is preferably 2 to 3, and the decoction time for each decoction is preferably 1 hour. This invention uses water extraction to obtain an effective substance with in vitro and in vivo anti-colorectal cancer activity.

[0036] The composition provided by this invention features multi-component, multi-target, and multi-pathway comprehensive regulation, and has the potential to improve symptoms, enhance quality of life, and reduce treatment-related adverse reactions in the treatment and adjuvant therapy of colorectal cancer. The composition provided by this invention exhibits significant pharmacological efficacy against colorectal cancer, inhibiting the proliferation, migration, and invasion of colorectal cancer cells and the growth of xenografts in nude mice. It can be used for the treatment or adjuvant therapy of colorectal cancer, and its effects are clearly demonstrated through regulating the PI3K / Akt signaling pathway, promoting apoptosis, inducing cell cycle arrest, and inhibiting tumor proliferation.

[0037] In this invention, the product preferably includes a drug, the drug preferably includes an oral preparation, and the dosage form of the oral preparation preferably includes powder, granules, tablets, suspensions or capsules.

[0038] The compositions of this invention are preferably used to prepare drugs for the prevention and / or treatment of colorectal cancer, particularly for inhibiting the proliferation, colony formation, migration, and invasion of colorectal cancer cells, inducing G2 / M phase cell cycle arrest, promoting tumor cell apoptosis, reducing Ki67 expression, and inhibiting the growth of colorectal cancer xenografts. The preferred mechanisms of action of the compositions of this invention include regulating the PI3K / Akt signaling pathway, MAPK signaling pathway, cell cycle pathway, p53 signaling pathway, and the expression of apoptosis-related molecules. The compositions of this invention can be used as therapeutic drugs, adjuvant drugs, or drugs to improve colorectal cancer-related symptoms. In animal experiments, low, medium, and high doses of the compositions of this invention, at 277, 554, and 1108 mg / kg, respectively, showed in vivo antitumor activity after 14 days of gavage administration.

[0039] Clinically, conventional treatments for colorectal cancer include surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy. For patients with intermediate or advanced stages, recurrence, distant metastasis, adverse reactions, and poor tolerability remain significant issues affecting treatment efficacy and quality of life. The application provided by this invention offers advantages such as low toxicity, oral administration, adjuvant therapy, and multi-target regulation.

[0040] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Unless otherwise specified, the following embodiments are all conventional methods.

[0042] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0043] The human colorectal cancer cell lines SW620, SW480, HCT116, HT-29, and LoVo used in the following examples were purchased from Procell Biotech, Wuhan, China. SW620 and SW480 cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum (FBS), HCT116 and HT-29 cells were cultured in McCoy's 5A medium containing 10% FBS, and LoVo cells were cultured in Ham's F-12K medium containing 10% FBS. When the cells reached 90% confluence, the original culture medium was discarded, and trypsin was added to digest the cells and pipette them into a single-cell suspension. The cell suspension was transferred to centrifuge tubes, centrifuged at 1200 rpm for 3 minutes, the supernatant was discarded, and culture medium was added. The cells were passaged 1:3 and cultured in a 37°C incubator containing 5% CO2.

[0044] Example 1 A composition for preventing and treating colorectal cancer is made from the following raw materials in parts by weight: 6 parts dried toad skin, 7 parts gecko, 42 parts buckwheat, 30 parts camptotheca fruit, 12 parts American ginseng, 20 parts agrimony and 18 parts Ganoderma lucidum.

[0045] The preparation method is as follows: Mix the raw materials according to the above weight parts, and then mix them with water at a weight ratio of 1 (mixture): 11 (water), decoct for 1 hour, and collect the decoction; add the same weight of water as the first addition to the residue, decoct for 1 hour, and collect the decoction; add the same weight of water as the first addition to the residue again, decoct for 1 hour, and collect the decoction; combine the decoctions obtained from the three collections, concentrate and dry to obtain a powdered composition, denoted as QWCS.

[0046] Example 2 A composition for preventing and treating colorectal cancer is made from the following raw materials in parts by weight: 1 part dried toad skin, 1 part gecko, 30 parts buckwheat, 20 parts camptotheca fruit, 6 parts American ginseng, 10 parts agrimony and 6 parts Ganoderma lucidum.

[0047] The preparation method is as follows: Mix the raw materials according to the above weight parts, and then mix them with water at a weight ratio of 1 (mixture): 8 (water), decoct for 1 hour, and collect the decoction; add the same weight of water as the first addition to the dregs, decoct for 1 hour, and collect the decoction; combine the two collected decoctions, concentrate and dry to obtain a powdered composition, denoted as QWCS.

[0048] Example 3 A composition for preventing and treating colorectal cancer is made from the following raw materials in parts by weight: 9 parts dried toad skin, 9 parts gecko, 50 parts buckwheat, 40 parts camptotheca fruit, 16 parts American ginseng, 30 parts agrimony and 24 parts Ganoderma lucidum.

[0049] The preparation method is as follows: Mix the raw materials according to the above weight parts, and then mix them with water at a weight ratio of 1 (mixture): 12 (water), decoct for 1 hour, and collect the decoction; add the same weight of water as the first addition to the residue, decoct for 1 hour, and collect the decoction; add the same weight of water as the first addition to the residue again, decoct for 1 hour, and collect the decoction; combine the decoctions obtained from the three collections, concentrate and dry to obtain a powdered composition, denoted as QWCS.

[0050] Example 4 Effects of the composition (QWCS) obtained in Example 1 on different tumor cells HCT116, S180, HepG2, K562 and MCF-7 cells were cultured in the corresponding culture media, and cell viability was detected by MTT assay after 24 hours of treatment with QWCS at concentrations of 0, 10, 20, 40, 80 and 100 μg / mL.

[0051] The results are as follows Figure 1 As shown, S180, HepG2, K562, and MCF-7 cells IC 50 The concentrations were 79.06, 100.95, 157.30, and 62.28 μg / mL, respectively, with HCT116 colorectal cancer cells being more sensitive to QWSC.

[0052] Example 5 Effect of the composition obtained in Example 1 (QWCS) on the proliferation of colorectal cancer cells Human colorectal cancer cells SW620, SW480, HCT116, HT-29, and LoVo were cultured in their respective culture media. Cell viability after treatment with QWCS at concentrations of 0, 10, 20, 40, 80, 160, 320, and 640 μg / mL for 48 hours was determined using the MTT assay. The specific method is as follows: SW620, SW480, HCT116, HT-29, and LoVo cells in logarithmic growth phase were cultured at 5 × 10⁶ cells per well. 4Cells were seeded at a density of [number] cells per well in 96-well plates. After complete cell adhesion, culture medium containing different concentrations of QWCS (0, 10, 20, 40, 80, 160, 320, 640 μg / mL) was added to each well, and a control group was set up. Cells were cultured at 37°C in a 5% CO2 incubator for 48 hours. Subsequently, the culture medium was removed, MTT reagent was added, and the cells were incubated at 37°C for 3–4 hours. After discarding the reagent, DMSO was added to each well. After vortexing and mixing, the absorbance (OD) value of each well was measured at 570 nm using a microplate reader.

[0053] The results are as follows Figure 2 As shown, QWCS can dose-dependently inhibit the proliferation of five types of colorectal cancer cells, among which HCT116 and SW480 cells are more sensitive, with an IC50 value of [missing value]. 50 The concentrations were 45.85 μg / mL and 161.0 μg / mL, respectively. Therefore, subsequent experiments used 23, 46, and 92 μg / mL as low, medium, and high concentrations for HCT116 cells, and 80.5, 161, and 322 μg / mL as low, medium, and high concentrations for SW480 cells, respectively.

[0054] Example 6 Effect of the composition obtained in Example 1 (QWCS) on colony-forming ability SW480 or HCT116 cells in logarithmic growth phase were seeded at a density of 500 cells per well in 6-well plates and cultured continuously for approximately 10 days. When visible cell colonies formed, the cells were treated with the drug for 24 hours. Low (QWCS-L), medium (QWCS-M), and high (QWCS-H) concentrations of HCT116 cells were defined as 23, 46, and 92 μg / mL, respectively; low (QWCS-L), medium (QWCS-M), and high (QWCS-H) concentrations of SW480 cells were defined as 80.5, 161, and 322 μg / mL, respectively. Cells were fixed with 4% paraformaldehyde for 30 minutes, stained with crystal violet for 10 minutes, rinsed with PBS, air-dried, photographed, and counted.

[0055] The results are as follows Figure 3 As shown, compared with the control group, the QWCS treatment group significantly inhibited the colony formation ability of HCT116 and SW480 cells, indicating that it can reduce the proliferation ability of colorectal cancer cells.

[0056] Example 7 Effect of the composition obtained in Example 1 (QWCS) on migration and invasion capabilities The migration ability of HCT116 and SW480 cells after 24 and 48 hours of QWCS treatment was assessed using a wound healing assay. Specifically, cells in the logarithmic growth phase were divided into groups of 1 × 10⁶ cells per well. 6Cells were seeded at a density of [number] cells / well in 6-well plates and cultured in a cell culture incubator at 37°C and 5% CO2. When cell confluence reached 80%–90%, scratches were performed using a 200 µL pipette tip. After washing with PBS, culture medium containing the appropriate drug concentration was added, and the cells were cultured further. Images were acquired at 0, 24, and 48 hours after drug treatment. Cell scratch healing rate = (0-hour scratch width - 24 / 48-hour scratch width) / 0-hour scratch width × 100%.

[0057] The number of invasive and migrating cells was detected using a Transwell assay. The specific method was as follows: cell suspension was collected, 100 μL of cell suspension and 100 μL of drug solution were added to the upper chamber, and 500 μL of culture medium containing 20% ​​fetal bovine serum was added to the lower chamber. After incubation for 48 hours, the culture medium was removed, and unmigrated cells were wiped from the membrane surface. The cells were then fixed, stained, observed under a microscope, and photographed.

[0058] The results are as follows Figure 4 and Figure 5 As shown, compared with the control group, the QWCS treatment group showed a significant decrease in cell migration rate and a significant reduction in the number of invasive and migrating cells, with the high-dose group showing the most significant effect.

[0059] Example 8 Effect of the composition obtained in Example 1 (QWCS) on the cell cycle HCT116 and SW480 cells were treated with QWCS for 24 hours, then collected by centrifugation, washed twice with PBS, fixed with pre-chilled 70% ethanol, and stored overnight at 4°C. After adding PI solution, the cells were incubated at 37°C in the dark for 30 minutes. Red fluorescence signals were detected by flow cytometry at an excitation wavelength of 488 nm, and the data were analyzed using FlowJo software.

[0060] The results are as follows Figure 6 As shown, the proportion of G0 / G1 phase decreased in HCT116 and SW480 cells, while the proportions of S phase and G2 / M phase increased significantly, indicating that QWCS can induce G2 / M phase cell cycle arrest in colorectal cancer cells.

[0061] Example 9 Network pharmacology and molecular docking Chemical components of each traditional Chinese medicine in the composition (QWCS) obtained in Example 1 were obtained from the TCMSP database (https: / / tcmspw.com / tcmsp.php). Preliminary screening was conducted based on oral bioavailability (OB) ≥30% and drug similarity (DL) ≥0.18 to identify the chemical components and their predicted targets. Using "colorectal cancer" as the keyword, disease targets related to colorectal cancer were searched in the TTD (http: / / bidd.nus.edu.sg / group / ttd / ttd), OMIM (http: / / www.omim.org / ), PharmGkb (http: / / www.pharmgkb.org / ), GeneCards (http: / / www.genecards.org / ), and DrugBank (https: / / www.drugbank.org / ) databases. After integrating and deduplicating these five databases, colorectal cancer-related genes were obtained. We used the String database (https: / / cn(string-db.org / ) and Cytoscape 3.7.1 software to construct a protein-protein interaction (PPI) network and an "active ingredient-disease target" network to screen for core targets. Molecular docking between active ingredients and core targets was performed using AutoDockTools software, and visualization analysis was achieved using PyMOL 2.5.5 software.

[0062] Based on the TCMSP database, active ingredients and targets of QWCS were screened, and colorectal cancer disease targets from TTD, OMIM, PharmGKB, GeneCards, and DrugBank were integrated. The results are as follows: Figure 7 As shown, 308 potential common targets were identified. The PPI network identified core targets such as AKT1, TP53, CASP3, IL-6, and JUN. KEGG enrichment showed significant enrichment of PI3K / Akt, MAPK, and cancer-related pathways. The molecular docking binding energies of quercetin, luteolin, and kaempferol with AKT1 were -8.256, -8.215, and -7.828 kcal / mol, respectively.

[0063] Example 10 Proteomics and Transcriptomics Analysis After treating HCT116 cells with the composition (QWCS) obtained in Example 1 for 24 hours, proteomics and transcriptomics were performed.

[0064] Proteomics analysis: Proteomics analysis was used to investigate proteomic changes. Cell samples were collected 24 hours after drug administration: each sample in the QWCS group contained 1×10⁻⁶ cells. 7 10 cells (each sample in the control group contained 1×10 cells) 7 (3 cells per group, 3 samples per group). Protein extraction, enzymatic digestion, peptide labeling, peptide separation, phosphorylated peptide enrichment, and mass spectrometry (MS) detection were all performed at Shanghai Meiji Biopharmaceutical Technology Co., Ltd.

[0065] Transcriptomics analysis: Total RNA was extracted from cells using Trizol reagent. The concentration and purity of isolated RNA were determined using a Nanodrop 2000 spectrophotometer. RNA integrity was verified by agarose gel electrophoresis, and RNA integrity index (RIN) was measured using an Agilent 5300 instrument. Quality-controlled RNA samples were used by Shanghai Meiji Biopharmaceutical Technology Co., Ltd. for library construction and sequencing on the Illumina Novaseq 6000 platform. Principal component analysis (PCA) was performed using the gmodels package in R software; differential RNA expression analysis between two groups was performed using DESeq2, and comparisons between two samples were performed using EdgeR, with a selection threshold of |log2FC| ≥ 1 and FDR < 0.05. Based on the Gene Ontology (GO) database, genes were classified according to their biological processes (BP), cellular components (CC), and molecular functions (MF), and differentially expressed genes (DEGs) were annotated using GO. Based on the Kyoto Gene (GO) and Genome Encyclopedia (KEGG) databases, genes were classified according to the pathways they participated in or the functions they performed, and DEGs were annotated using KEGG. GO and KEGG enrichment analyses were performed using GoToools and KOBAS software, respectively, with P ≤ 0.05 as the significant enrichment criterion.

[0066] The results are as follows Figure 8 and Figure 9 As shown, proteomics identified 48 upregulated proteins and 358 downregulated proteins, enriched in pathways involving mitosis, cell cycle regulation, PI3K / Akt, p53, and ECM-receptor interactions. Transcriptomics identified 6225 differentially expressed genes, of which 2224 were upregulated and 4001 were downregulated, enriched in pathways involving PI3K / Akt, MAPK, cell cycle, chemical carcinogenesis-DNA adducts, and complement and coagulation cascades.

[0067] Example 11 Western blot and RT-qPCR validation of the composition (QWCS) obtained in Example 1.

[0068] Western blot: Cells were washed twice with ice-cold PBS, followed by lysis and centrifugation. The supernatant was collected for protein extraction, and the protein concentration was determined. After electrophoresis, wet transfer, and blocking, the membrane was incubated overnight at 4°C with primary antibodies PI3K (T40115), P-PI3K (TA3242), Akt (4691), P-Akt (4060), HSP90 (YM8026), Bax (YM8157), Bcl-2 (YM8319), and Caspase-3 (YM8058), followed by incubation with secondary antibodies at room temperature for 1 hour. Protein bands were visualized using the ECL method, and the gray values ​​of the bands were analyzed using ImageJ software to calculate the relative expression level of the target protein.

[0069] Western blot results ( Figure 10 The results showed that, compared with the control group, with the increase of QWCS concentration, the expression levels of P-PI3K / PI3K, P-Akt / Akt, and HSP90 in HCT116 and SW480 cells were significantly reduced, while the expression levels of Caspase-3 and Bax / Bcl-2 were significantly increased.

[0070] RT-qPCR: After treatment with the appropriate drugs for 24 hours, total RNA was extracted from cells using the SteadyPure Rapid RNA Extraction Kit. After determining the total RNA concentration, the RNA was reverse transcribed into cDNA according to the kit instructions. PCR amplification was performed using the cDNA as a template, following a two-step reaction program: 95℃ pre-denaturation for 5 minutes; followed by 40 cycles (each cycle consisting of 95℃ for 10 seconds and 60℃ for 30 seconds). β-actin was used as an internal control gene, and 2... -ΔΔCtThe relative expression level of the target gene was calculated using a method. All primers were designed and synthesized by Hunan Aikerui Biotechnology Co., Ltd., and the primer information is as follows: H-PIK3CB-F: GGGAAAGCTCATCGTAGCTG (SEQ ID NO.1), H-PIK3CB-R: GGGCTAACTTCATCTTCCTTCC (SEQ ID NO.2), H-AKT1-F: AGCGACGTGGCTATTGTGAA (SEQ ID NO.3), H-AKT1-R: CACGTTGGTCCACATCCTG (SEQ ID NO.4), H-HSP90AA1-F: TGCCTCTGGTGATGAGATGG (SEQ ID NO.5), H-HSP90AA1-R: TGGTCCTTGGTCTCACCTGT (SEQ ID NO.6), H-CASP3-F: GACTCTGGAATATCCCTGGACAACA (SEQ ID NO.7), H-CASP3-R: AGGTTTGCTGCATCGACATCTG (SEQ ID NO.8). NO.8), H-BCL2-F: GTCATGTGTGTGGAGAGCGT (SEQ ID NO.9), H-BCL2-R: AGGTGCCGGTTCAGGTACTC (SEQ ID NO.10), H-BAX-F: TCTGACGGCAACTTCAACTG (SEQ ID NO.11), H-BAX-R: GTCCAATGTCCAGCCCATGA (SEQ ID NO.12).

[0071] RT-qPCR results ( Figure 11 The results showed that the mRNA expression levels of PI3K, Akt, HSP90, and Bcl-2 were significantly downregulated, while the mRNA expression levels of Bax and Caspase-3 were significantly upregulated.

[0072] Example 12 HCT116 nude mouse subcutaneous xenograft tumor model Male Balb / c-nu mice (5-6 weeks old, 20 ± 2 g) were purchased from Spiford (Beijing) Biotechnology Co., Ltd. Mice were housed at a temperature of 24-26℃ and a relative humidity of 50%-70%, with a 12-hour light-dark cycle. They had free access to food and water during the rearing period and underwent acclimatization for 7 days. The nude mouse subcutaneous xenograft model was established by injecting 200 μL of HCT116 cell suspension (culture medium:Matrix gel = 1:1) with a concentration of 5 × 10⁻⁶ cells. 6 10 cells / mL were injected into the axilla of nude mice. After the model was established, the tumor size and body weight of the mice were measured every 3 days. A tumor diameter ≥ 0.5 cm indicated successful model establishment.

[0073] Forty-eight mice were randomly divided into six groups: control group (n=8), model group (n=8), low-dose group of the composition (QWCS) obtained in Example 1 (QWCS-L 277 mg / kg, n=8), medium-dose group of the composition (QWCS) obtained in Example 1 (QWCS-M 554 mg / kg, n=8), high-dose group of the composition (QWCS) obtained in Example 1 (QWCS-H 1108 mg / kg, n=8), and positive control group (5-Fu 15 mg / kg, n=8). Mice were administered the medication daily from 9:00 AM to 10:00 AM. Each QWCS dose group was administered 0.2 mL of QWCS solution by gavage, the positive control group was injected intraperitoneally with 0.2 mL of 5-Fu, and the control and model groups were administered an equal volume of physiological saline by gavage. The administration continued for 14 days. Tumors were imaged, weighed, and then dissected for subsequent analysis. Tumor volume V = 0.5ab. 2 (a: tumor length, b: tumor width) The results are as follows Figure 12 and Figure 13 As shown, there was no significant difference in body weight among the groups of nude mice. Compared with the model group, the tumor volume and tumor weight were significantly reduced in the low, medium, and high dose QWCS groups and the 5-FU group. HE staining showed that after drug administration, the necrotic area of ​​the tumor tissue increased, the cell arrangement became sparse, and the number of mitotic figures decreased; Ki67 expression was reduced, suggesting that QWCS can significantly inhibit the growth and proliferation of colorectal cancer tumors.

[0074] Example 13 Effect of the composition obtained in Example 1 (QWCS) on normal human colonic epithelial cells NCM460 Normal human colonic epithelial cells NCM460 cells in the logarithmic growth phase were divided into 5 × 10⁶ cells per well. 4 Cells were seeded at a density of [number] cells per well in 96-well plates. After complete cell adhesion, culture medium containing different concentrations of QWCS (0, 10, 20, 40, 80, 160, 320, 640 μg / mL) was added to each well, and a control group was set up. Cells were cultured at 37°C in a 5% CO2 incubator for 48 hours. Subsequently, the culture medium was removed, MTT reagent was added, and the cells were incubated at 37°C for 3–4 hours. After discarding the reagent, DMSO was added to each well. After vortexing and mixing, the absorbance (OD) value of each well was measured at 570 nm using a microplate reader.

[0075] The results are as follows Figure 14 As shown, this demonstrates the effect of the composition (QWCS) obtained in Example 1 on the IC50 of normal cells. 50 The concentration was approximately 340 μg / mL, indicating that QWCS significantly inhibited the proliferation of HCT116 colorectal cancer cells in vitro (IC50). 50=48μg / mL), with relatively lower toxicity to normal colorectal cells and moderate in vitro tumor cell selectivity.

[0076] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of a composition in the preparation of products for the prevention and treatment of colorectal cancer, characterized in that, The composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts agrimony and 6-24 parts Ganoderma lucidum.

2. The use of a composition in the preparation of a product that inhibits the proliferation, migration, and / or invasion of colorectal cancer cells, characterized in that, The composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts agrimony and 6-24 parts Ganoderma lucidum.

3. The use of a composition in the preparation of a product that promotes apoptosis of colorectal cancer cells, characterized in that, The composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts agrimony and 6-24 parts Ganoderma lucidum.

4. The use of a composition in the preparation of a product that induces G2 / M phase arrest in colorectal cancer cells, regulates the PI3K / Akt signaling pathway, and / or reduces Ki67 expression in colorectal cancer tissue, characterized in that, The composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts agrimony and 6-24 parts Ganoderma lucidum.

5. The use of a composition in the preparation of a product for improving symptoms of fatigue, cancer pain, and / or poor appetite in patients with colorectal cancer, characterized in that, The composition is made from the following raw materials in parts by weight: 1-9 parts dried toad skin, 1-9 parts gecko, 30-50 parts buckwheat, 20-40 parts camptotheca fruit, 6-16 parts American ginseng, 10-30 parts agrimony and 6-24 parts Ganoderma lucidum.

6. The application according to any one of claims 2 to 4, characterized in that, The colorectal cancer cells include SW620 cells, SW480 cells, HCT116 cells, HT-29 cells, and / or LoVo cells.

7. The application according to any one of claims 1 to 5, characterized in that, The preparation method of the composition includes the following steps: mixing the raw materials in the composition to obtain a mixture, mixing the mixture with water, and boiling to obtain the composition.

8. The application according to claim 7, characterized in that, The mass ratio of the mixture to water is 1:8~12.

9. The application according to claim 7, characterized in that, The decoction is performed 2 to 3 times, with each decoction lasting 1 hour.

10. The application according to any one of claims 1 to 5, characterized in that, The composition exerts its anti-colorectal cancer effect through the PI3K / Akt pathway.

Images