Preparation method of bovine herpes virus type 1 mRNA vaccine and application thereof
Patent Information
- Application Number
- CN202611186158.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-08-06
- Publication Date
- 2026-10-30
Smart Images
Figure CN122998331A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of vaccine technology, specifically relating to a method for preparing a bovine herpesvirus type 1 (BoHV-1) mRNA vaccine and its application. Background Technology
[0002] mRNA vaccines are a novel type of nucleic acid vaccine technology. They deliver mRNA encoding a target antigen, enabling host cells to express the antigen protein in vivo, thereby inducing a specific immune response. Compared to traditional vaccines, mRNA vaccines offer advantages such as shorter design cycles, relatively standardized production processes, no need to culture live viruses, modular replacement of antigen sequences, and ease of co-encoding immunomodulatory molecules. The successful development and application of mRNA vaccines fully demonstrate the advantages of mRNA vaccine platforms in rapid development and efficient immune responses.
[0003] Lipid nanoparticles (LNPs) are currently a relatively mature carrier system for mRNA delivery. They are typically composed of ionizable cationic lipids, helper phospholipids, cholesterol, and polyethylene glycol-modified lipids, effectively encapsulating mRNA, protecting it from nuclease degradation, and promoting its release and translational expression after entering cells. Therefore, LNP-based mRNA vaccines provide a new technological pathway for the development of animal virus vaccines such as BoHV-1.
[0004] However, delivering antigen mRNA alone sometimes fails to achieve the desired immune enhancement effect, especially when it is necessary to simultaneously induce high levels of neutralizing antibodies, Th1-type cellular immunity, CTL responses, and germinal center B cell and follicular helper T cell responses. Further optimization of vaccine composition and delivery strategies is still needed. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide a method for preparing a bovine herpesvirus type 1 mRNA vaccine and its application, thereby constructing a novel mRNA vaccine and providing a new platform for the research and development of novel vaccines.
[0006] To achieve its technical objectives, this application adopts the following technical solution:
[0007] This invention provides a method for preparing a bovine herpesvirus type 1 (BoHV-1) mRNA vaccine, comprising: dissolving gD mRNA encoding the gD antigen of bovine herpesvirus type 1 (BoHV-1) in water as an aqueous phase; dissolving a lipid mixture containing ionizable cationic lipids, cofactor phospholipids, cholesterol, and polyethylene glycol-modified lipids in 95% ethanol as an alcohol phase; mixing the aqueous phase and the alcohol phase by microfluidic mixing to obtain lipid nanoparticles, followed by ultrafiltration purification and replacement of the outer phase with Tris-HCl buffer to obtain the mRNA vaccine.
[0008] Preferably, the molar ratio of the ionizable cationic lipid, cofactor phospholipid, cholesterol, and polyethylene glycol ester is 50:10:38.5:1.5.
[0009] More preferably, the polyethylene glycol ester is DMG-PEG2000.
[0010] Preferably, the ultrafiltration purification and Tris-HCl buffer replacement of the outer phase specifically include: using a 30 kDa filter membrane, performing ultrafiltration purification at 10°C and 4500 rpm, concentrating to one-tenth of the original volume, adding Tris-HCl buffer to the original volume, and repeating the operation 3 times.
[0011] Preferably, the method further includes dissolving gD mRNA and gD antigen peptide together in water to form an aqueous phase.
[0012] More preferably, the weight ratio of the gD mRNA to the polypeptide is 5:1, and the amino acid sequence of the gD antigen polypeptide is shown in SEQ ID NO. 8~13.
[0013] The present invention also provides a bovine herpesvirus type 1 mRNA vaccine, which is obtained by the above preparation method.
[0014] The present invention also provides a vaccine adjuvant, which is obtained by replacing gD mRNA in the above preparation method with IL-12 mRNA.
[0015] The present invention also provides another vaccine composition comprising the above-described mRNA vaccine and the above-described vaccine adjuvant.
[0016] Preferably, the weight ratio of the mRNA vaccine to the vaccine adjuvant is 5:1.
[0017] The beneficial effects of this invention are as follows:
[0018] 1. This invention constructs a BoHV-1-gD mRNA vaccine LNP based on a lipid nanoparticle delivery system. gDThis vaccine can effectively encapsulate and deliver gD mRNA using the LNP delivery platform, enabling it to efficiently express the gD antigen in in vitro cells and induce a significant adaptive immune response in mice.
[0019] 2. The LNP prepared by this invention gD The vaccine exhibits favorable physicochemical properties and structure. This demonstrates that the preparation method described in this invention is stable and reliable, and the resulting LNP... gD Vaccines are suitable for subsequent in vivo immune studies and vaccine development.
[0020] 3. This invention introduces the IL-12 mRNA adjuvant LNP. IL-12 Further enhanced LNP gD The immunogenicity of vaccines. IL-12, as an immunomodulatory factor, interacts with LNP. gD When used in combination, it can significantly improve the levels of humoral and cellular immunity induced by the vaccine, providing a new direction for the development of vaccine adjuvants.
[0021] 4. This invention further constructs an LNP by co-delivering gD-derived immunodominant epitope peptides with gD mRNA. gD &Pep Vaccines. This strategy can further supplement and enhance the immunostimulatory effect of specific MHC I / MHC II class restriction epitopes on the basis of full-length antigen mRNA expression.
[0022] 5. The vaccine system described in this invention has good biosafety and promising application prospects.
[0023] 6. This invention provides a modular and scalable mRNA vaccine design strategy, achieving synergistic design of antigen expression, immune adjuvant regulation, and precise epitope enhancement. It provides a technical reference for mRNA vaccines for viral diseases, epitope-enhanced vaccines, and combined delivery vaccine platforms. Attached Figure Description
[0024] Figure 1 There are three types of LNPs (LNPs) gD LNP IL-12 LNP gD&Pep Particle size detection results diagram;
[0025] Figure 2 There are three types of LNPs (LNPs) gD LNP IL-12 LNP gD&Pep )Zeta potential detection results graph;
[0026] Figure 3 There are three types of LNPs (LNPs) gD LNP IL-12 LNPgD&Pep (Image showing polydispersity index test results)
[0027] Figure 4 To display the three types of LNPs (LNPs) gD LNP IL-12 LNP gD&Pep Representative transmission electron microscope (TEM) images of spherical morphology;
[0028] Figure 5 For transfection of LNP gD The results of Western blot analysis of gD protein expression in 293T cells. The marker used was the Beyotime color prestained protein molecular weight standard (10-180kD) P0068.
[0029] Figure 6 The expression results of recombinant gD protein are shown in the figure. The marker used is the Beyotime color pre-stained protein molecular weight standard (10-180kD) P0068.
[0030] Figure 7 For recombinant gD protein and LNP gD Effects on IgG antibody and neutralizing antibody levels This indicates that P < 0.01. This indicates that P < 0.0001;
[0031] Figure 8 For recombinant gD protein and LNP gD For CD4 + IFN-γ in T cell population + TNF-α + and IL-2 + The influence of cell frequency, This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This indicates that P < 0.0001;
[0032] Figure 9 For recombinant gD protein and LNP gD For CD8 + IFN-γ in T cell population + TNF-α + and IL-2 + The influence of cell frequency, This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This indicates that P < 0.0001;
[0033] Figure 10 For recombinant gD protein and LNP gD Effects on GC B and Tfh cell frequencies This indicates that P < 0.01. This indicates that P < 0.0001;
[0034] Figure 11 LNP IL-12 Effects on IgG antibody and neutralizing antibody levels This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.0001;
[0035] Figure 12 Quantitative detection of LNPs using ELISpot IL-12 Effects on speckled cells that secrete IL-4 and IFN-γ This indicates that P < 0.001. This indicates that P < 0.0001;
[0036] Figure 13 LNP IL-12 For CD4 + IFN-γ in T cell population + TNF-α + and IL-2 + The influence of cell frequency, This indicates that P < 0.05. This indicates that P < 0.001. This indicates that P < 0.0001;
[0037] Figure 14 LNP IL-12 For CD8 + IFN-γ in T cell population + TNF-α + and IL-2 + The influence of cell frequency, This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This indicates that P < 0.0001;
[0038] Figure 15 LNP IL-12 Effects on GC B and Tfh cell frequencies This indicates that P < 0.05. This indicates that P < 0.001. This indicates that P < 0.0001;
[0039] Figure 16 The effect of co-delivery of peptides on IgG antibody and neutralizing antibody levels. This indicates that P < 0.05. This indicates that P < 0.001. This indicates that P < 0.0001;
[0040] Figure 17 The effects of combined peptide delivery on speckled cells secreting IL-4 and IFN-γ. This indicates that P < 0.0001;
[0041] Figure 18 For the co-delivery of peptides to CD4 + IFN-γ in T cell population + TNF-α + and IL-2 + The influence of cell frequency, This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This indicates that P < 0.0001;
[0042] Figure 19 For peptide co-delivery against CD8 + IFN-γ in T cell population + TNF-α + and IL-2 + The influence of cell frequency, This indicates that P < 0.05. This indicates that P < 0.0001;
[0043] Figure 20 The effect of combined peptide delivery on the frequency of GC B and Tfh cells. This indicates that P < 0.01. This indicates that P < 0.001. This indicates that P < 0.0001;
[0044] Figure 21 There are three types of LNPs (LNPs) gD LNP IL-12 LNP gD&Pep The effect of ) on the results of mouse serum biochemical analysis;
[0045] Figure 22 There are three types of LNPs (LNPs) gDLNP IL-12 LNP gD&Pep Effects on the morphology of major organs in mice;
[0046] Figure 23 Representative sections of the heart, liver, spleen, lung, and kidney tissues stained with hematoxylin and eosin (H&E). Detailed Implementation
[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the following embodiments. The specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.
[0048] Example 1: LNP gD LNP IL-12 LNP gD&pep Preparation and characterization
[0049] LNP consists of an alcohol phase and an aqueous phase. It contains ionizable lipids, cofactor phospholipids, cholesterol, and polyethylene glycol-modified lipids (DMG-PEG2000) in a molar ratio of 50:10:38.5:1.5, and is soluble in 95% ethanol, serving as the alcohol phase. For LNP... gD The gD mRNA encoding the bovine herpesvirus type 1 (BoHV-1) gD antigen (sequence shown in SEQ ID NO. 6) was dissolved in water for injection as the aqueous phase; for LNP IL-12 IL-12 mRNA was dissolved in water for injection as the aqueous phase; for LNP gD&pep gD mRNA and peptide were dissolved in injection water at a weight ratio of 5:1 (mRNA:peptide) to form the aqueous phase. Citric acid was added to the aqueous phase to adjust the environment, and then the mixture was filtered through a 0.22 μm sterile filter. The aqueous and alcohol phases were mixed using a microfluidic device at a volume ratio of 3:1 (aqueous phase:alcohol phase) to prepare LNPs. The polysaccharide-LNPs were purified by ultrafiltration using a 30 kDa membrane at 10°C and 4500 rpm. After concentrating to one-tenth of the original volume, Tris-HCl buffer (pH 7.4) was added to the original volume, and this process was repeated three times. The purified LNPs were characterized by dynamic light scattering, including particle size, Zeta potential, and polydispersity index (PDI). The results showed that the LNPs in each group had a uniform particle size distribution. Figure 1 ), near-neutral Zeta potential ( Figure 2 ) and maintain a similar level of PDI ( Figure 3 To further verify its structural integrity, the morphology and structural integrity of each group of LNPs were observed using cryo-transmission electron microscopy (Cryo-TEM). All groups exhibited a typical spherical morphology with a smooth surface. Figure 4The LNP-related indicators in each group remained at normal levels, allowing for further research. Furthermore, 293T cells were transfected with LNP, and Western blot was used to verify whether the encapsulated mRNAs in each group could be efficiently expressed in vitro. Empty LNPs (containing no mRNA) served as a blank control. The results showed that the mRNAs in each group could be efficiently expressed in vitro. Figure 5 ).
[0050] The DNA sequence of the 5' untranslated region (5'UTR) is shown in SEQ ID NO.1:
[0051] GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCGCTAGCCTCGAG.
[0052] The DNA sequence of the 3' untranslated region (3'UTR) is shown in SEQ ID NO.2:
[0053] GATATCTGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTG.
[0054] Polyadenylate (poly A) has the sequence shown in SEQ ID NO.3 and contains 104 bases A:
[0055] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.
[0056] The DNA sequence of the T7 promoter is shown in SEQ ID NO.4:
[0057] TAATACGACTCACTATAGG.
[0058] The amino acid sequence of BoHV-1 gD is shown in SEQ ID NO.5:
[0059] MQGPTLAVLGALLAVAVSLPTPAPRVTVYVDPPAYPMPRYNYTERWHTTGPIPSPFADGREQPVEVRYATSAAACDMLALIADPQVGRTLWEAVRRHARAYNATVIWYKIESGCARPLYYMEYTECEPRKHFGYCRYRTPPFWDSFLAGFAYPTDDELGLIMAAPARLVEGQYRRALYIDGTVAYTDFMVSLPAGDCWFSKLGAARGYTFGACFPARDYEQKKVLRLTYLTQYYPQEAHKAIVDYWFMRHGGVVPSYFEESKGYEPPPAADGGSPAPPGDDEAREDEGETEDGAAGREGNGGPPGPEGDGESQTPEANGGAEGEPKPGPSPDADRPEGWPSLEAITHPPPAPATPAAPDAVPVSVGIGIAAAAIACVAAAAAGAYFVYTRRRGAGPLPRKPKKLPAFGNVNYSALPG
[0060] The BoHV-1 gD mRNA sequence is shown in SEQ ID NO.6:
[0061]
[0062] The BoHV-1 gD DNA sequence is shown in SEQ ID NO.7:
[0063]
[0064] Example 2: Prokaryotic expression and purification of gD protein
[0065] The gene encoding BoHV-1-gD (sequence shown in SEQ ID NO.7) was cloned into the pET-28a(+) vector to construct a recombinant expression plasmid containing a 6×His tag at the N-terminus. The constructed recombinant plasmid was then electroporated into *E. coli* BL21(DE3) competent cells (TransGen, CD601-02). A single positively transformed colony was picked and inoculated into LB broth containing kanamycin, and cultured at 37 °C with shaking until the bacterial culture reached OD. 600 The concentration was increased to 0.6-0.8. Isopropyl-β-D-thiogalactopyranoside (IPTG; Yeasen, 10902ES08) was added to achieve a final concentration of 0.5 mM. After overnight incubation at 18 °C, the bacterial cells were collected by centrifugation and resuspended in lysis buffer containing lysozyme and protease inhibitors. The cells were then sonicated on ice. The supernatant was collected by centrifugation and purified by affinity chromatography using a nickel column (Ni-NTA) (ThermoFisher, 88226). After thorough washing with buffer containing 50 mM imidazole, a gradient elution was performed sequentially with elution buffers containing 100, 200, 300, and 500 mM imidazole to separate and purify the His-tagged target protein. The eluent was dialyzed into a suitable storage buffer, and the purity was then determined by Western blot. The results showed a specific band at the expected molecular weight of 45 kDa, indicating that the recombinant gD protein had been successfully prepared. Figure 6 ).
[0066] Example 3: LNP gD It can induce strong humoral and cellular immune responses in mice.
[0067] To evaluate LNP gD The in vivo immunogenicity was determined using empty LNP, gD protein prepared in Example 2 (adsorbed with aluminum adjuvant), and LNP, respectively. gD BALB / c mice were immunized. A booster immunization was administered 2 weeks after the initial immunization, and samples were collected 2 weeks later for immunological analysis. Antigen-specific IgG titers were detected using an enzyme-linked immunosorbent assay (ELISA), and the results showed that LNP... gD The antibody titers of both the LNP group and the Gd-protein group were significantly higher than those of the empty vector LNP group (P < 0.0001), and the LNP group... gD The group was significantly higher than the gD-protein group (P < 0.01). Figure 7This indicates that the mRNA vaccine induced a stronger antigen-specific antibody response. Subsequently, the neutralizing antibody droplet was measured by serially diluting the inactivated serum sample twofold and mixing it with an equal volume of 100 TCID50. 50 BoHV-1 virus solution was mixed and neutralized at 37°C for 1 hour. The mixture was then transferred to a 96-well plate (three replicates) containing an MDBK cell monolayer and incubated at 37°C and 5% CO2 for 72 hours. Cytopathic effect (CPE) was observed under a microscope, and the reciprocal of the highest serum dilution that completely inhibited CPE was determined as the neutralizing antibody titer. Changes in neutralizing antibody titers showed a trend similar to IgG, with LNP... gD The induced neutralizing antibody titers were significantly higher than those in the gD-protein group (P < 0.01). Figure 7 ).
[0068] To analyze cellular immune responses, flow cytometry was used to detect trends in cytokine changes in the spleen. First, Zombie Green... TM Spleen cells were stained for viability using a cell viability assay kit (423111), followed by Fc receptor blocking with anti-mouse CD16 / 32 antibody. Then, under light-protected conditions at room temperature, the cell surface was stained with a mixture of CD3-BV510 (100234), CD4-BV650 (100469), and CD8a-APC (100712) antibodies and incubated for 20 min. After washing, the cells were subjected to Cyto-Fast... TM Fix / Perm solution (100 µL per well, incubated at room temperature in the dark for 20 min) (750000133) to fix and break the membrane, then use 1× Cyto-Fast TM Perm wash buffer (750000135) (100 µL and 200 µL per well, centrifuged at 400×g for 5 min each) were used to wash twice. Subsequently, intracellular cytokines were stained in 1×Perm wash buffer using a mixed antibody of IFN-γ-PE / Cyanine7 (505826), TNF-α-BV 421 (506328), and IL-2-BV 605 (503829), and incubated at room temperature in the dark for 20 min (kit, antibody, and wash buffer were all from BioLegend). After staining, cells were washed twice and resuspended in cell staining buffer, and further analysis was performed using FlowJo software (v10.8). The results showed that CD4+... + ( Figure 8 ) and CD8 + ( Figure 9 LNPs in T cell population gDThe cell frequencies secreting interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), and interleukin-2 (IL-2) in the LNP group were significantly higher than those in the gD-protein group and the empty vector LNP group, suggesting that LNP secretion is more likely to be associated with these cells. gD The induced cellular immune response exhibits Th1-type and cytotoxic T lymphocyte (CTL)-related characteristics.
[0069] To further evaluate humoral immune responses, flow cytometry was used to detect germinal center (GC) B cells and follicular helper T cells (Tfh) in the spleen. Mice were sacrificed on day 14 after booster immunization, and spleens and inguinal lymph nodes were collected. The tissues were ground and prepared into single-cell suspensions using a 40 μm cell filter. BD Horizon was used for analysis. TM The staining was performed using immobilized reactive dye 780 (APC-A750, BD Biosciences, 565388), followed by staining with TruStain FCX. TM Plus (anti-mouse CD16 / 32) was pre-incubated to block Fc receptors, then stained with fluorescently bound antibodies: CD45-Alexa Fluor 700 (157210), CD4-FITC (100509), CD185-BV 605 (145513), PD-1-BV 421 (135221), B220-PerCP-Cy 5.5 (103236), CD95(Fas)-PE (152608), and GL-7-APC (144618) (all antibodies were from BioLegend), and further analyzed using FlowJo software (v10.8). The results showed that LNP... gD The frequencies of these two cell types in the LNP group were significantly higher than those in the gD-protein group and the empty LNP group (P < 0.01, P < 0.0001), indicating that LNP... gD It promotes the GC reaction and contributes to the generation of high-affinity antibodies. Figure 10 (Combined with IgG and neutralizing antibody titers, this indicates that it can LNP) gD It triggers a strong humoral immune response.
[0070] Example 4: IL-12 adjuvant can enhance LNP gD Immunogenicity of vaccines
[0071] To verify the effect of IL-12 on LNP gD The auxiliary role of vaccine immunogenicity was demonstrated by the LNP prepared in Example 1. IL -12 With LNP gD Combined immunization of mice. Three mouse immunization models were established: empty vector LNP, LNP... gD ,
[0072] LNP gD &LNP IL-12 (LNP) gD LNP IL-12 (Weight ratio 5:1). A booster immunization was administered 2 weeks after the primary immunization, and samples were collected 2 weeks after the booster for immunological analysis. Humoral immune response was first assessed, and antigen-specific IgG titers were detected using an enzyme-linked immunosorbent assay (ELISA). Results showed that LNP... gD Groups and LNPs gD &LNP IL-12 The IgG titers in the LNP group were significantly higher than those in the empty vector LNP group (P < 0.0001). Furthermore, the LNP... gD &LNP IL-12 The antibody titer in the group was also significantly higher than that in LNP. gD Group (P < 0.05). Neutralizing antibodies showed a similar trend: LNP gD &LNP IL-12 The neutralizing antibody titer in the group was significantly higher than that in LNP. gD The results showed that IL-12 adjuvant significantly enhanced vaccine-induced humoral immune responses and antibody function in the control group and the empty LNP group (P < 0.01, P < 0.0001). Figure 11 ).
[0073] Cellular immune responses were then assessed using the ELISpot method. (Compared with LNP) gD Compared to the group and the unloaded LNP group, the LNP gD &LNP IL -12 The levels of IL-4 and IFN-γ responses in the group were significantly increased (P < 0.0001), indicating that IL-12 adjuvant simultaneously enhanced both Th1 and Th2 immune responses. Figure 12 ). Flow cytometry was further used to detect T cell function. In CD4⁺ ( Figure 13 ) and CD8⁺T ( Figure 14 In the cell population, LNP gD &LNP IL-12 The frequency of cells producing IFN-γ, TNF-α, and IL-2 in the group was higher than that in the LNP group. gD The above results indicate that IL-12, as an adjuvant, can enhance the pluripotency of CD4⁺ and CD8⁺ T cells.
[0074] In addition, with LNP gD Compared to the group, LNP gD &LNP IL-12The frequencies of GC B cells and Tfh cells were significantly increased in the combined immunization group (P < 0.05, P < 0.0001), suggesting that IL-12 can effectively enhance humoral immune responses by promoting Tfh cell-mediated germinal center responses. Figure 15 The results of this study indicate that LNP IL-12 Added to LNP as an adjuvant gD In vaccines, IL-12 can significantly enhance humoral and cellular immune responses, suggesting its potential as a highly effective mRNA vaccine adjuvant.
[0075] Example 5: Co-delivery of peptides further enhances LNP gD &LNP IL-12 Immunogenicity of vaccines
[0076] Synthetic peptide antigens can precisely target immunodominant epitopes. Integrating these antigens into LNP delivery systems can rapidly and accurately activate and regulate the immune responses of B cells and T cells. We identified MHC class I and II restriction epitopes derived from gD protein and co-encapsulated six peptides (sequence information shown in Table 1) with gD mRNA at a weight ratio of 1:5 in LNPs to construct LNPs. gD LNP vaccine co-encapsulated with peptide gD&Pep To evaluate its enhancement of LNP gD The ability of vaccines to induce humoral and cellular immune responses.
[0077] Table 1. Relevant information for each polypeptide
[0078]
[0079] To evaluate the immunogenicity of the peptide co-delivery strategy, mice were randomly divided into three groups: empty vector LNP group, LNP group, and LNP group. gD &LNP IL-12 (LNP) gD LNP IL-12 Group (weight ratio 5:1), LNP gD&Pep &LNP IL-12 Group. The immunization schedule is the same as before (primary immunization on day 0, booster immunization on day 14, and testing on day 28). Compared to LNP gD &LNP IL-12 Group, LNP gD&Pep &LNP IL-12 The levels of IgG (P < 0.001) and neutralizing antibody titers (P < 0.05) in the group were significantly increased. Figure 16 This demonstrates the enhancing effect of peptide co-delivery strategies on humoral immune responses.
[0080] Cellular immune responses were further detected using ELISA and flow cytometry. LNP gD&Pep &LNP IL-12 Group
[0081] The levels of IL-4 and IFN-γ secretion were significantly higher than those of LNP. gD &LNP IL-12 Group (P < 0.0001), suggesting that the peptide co-delivery strategy can simultaneously enhance Th1 and Th2 immune responses. Figure 17 ). In CD4⁺ ( Figure 18 ) and CD8⁺T ( Figure 19 In the cell subset, compared to LNP gD &LNP IL-12 Group, LNP gD&Pep &LNP IL-12 The frequencies of cells secreting IFN-γ, TNF-α, and IL-2 in the group all showed a further significant increase, with the increase in IFN-γ being the most significant (P < 0.001, P < 0.0001). This indicates that the peptide co-delivery strategy can further enhance the cytotoxic T lymphocyte (CTL) response and improve the effector function of CD4⁺ T cells. Furthermore, LNP... gD&Pep &LNP IL-12 The frequencies of GC B cells and Tfh in the group were significantly higher than those in the LNP group. gD &LNP IL-12 The group (P < 0.0001) indicates that this strategy is particularly effective in promoting germinal center response and antibody maturation. Figure 20 ).
[0082] Example 6: In vivo safety assessment of LNP vaccine system
[0083] To evaluate the biosafety of the LNP delivery system and its different combination strategies, serum biochemical parameters and histopathological changes in major organs of immunized mice were further examined. The experimental animals were divided into four groups: a simulated control group, an LNP-equipped control group, and a control group. gD Group, LNP gD &LNP IL-12 Groups and LNPs gD&Pep &LNP IL-12 Group. Serum biochemical analysis results showed that the levels of total cholesterol (TC), alanine aminotransferase (ALT), aspartate aminotransferase (AST), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total bile acids (TBA) in mice in each group were all within the normal physiological range. Figure 21The above results indicate that, at the predetermined experimental doses, neither the mRNA vaccine alone nor its combination with IL-12 and peptides induced significant systemic toxicity. Gross anatomical examination revealed no abnormalities in the heart, liver, spleen, lungs, or kidneys of any group of mice, and there were no significant differences between groups. Figure 22 Histopathological analysis showed no significant pathological changes in any of the major organs after H&E staining. Figure 23 The above results indicate that LNP gD &LNP IL-12 Groups and LNPs gD&Pep &LNP IL-12 The groups showed enhanced immune responses, but no histopathological abnormalities related to inflammatory response or organ toxicity were detected, suggesting that the LNP vaccine system has good in vivo safety.
[0084] Obviously, the above embodiments of the present invention are merely examples to illustrate the present invention more clearly, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all implementation methods here. Any obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. A method for preparing a bovine herpesvirus type 1 mRNA vaccine, comprising: gD mRNA encoding bovine herpesvirus type 1 gD antigen was dissolved in water as the aqueous phase; a lipid mixture containing ionizable cationic lipids, helper phospholipids, cholesterol, and polyethylene glycol-modified lipids was dissolved in 95% ethanol as the alcohol phase; the aqueous phase and the alcohol phase were mixed by microfluidic mixing to obtain lipid nanoparticles, which were then purified by ultrafiltration and the outer phase was replaced by Tris-HCl buffer to obtain the mRNA vaccine.
2. The preparation method according to claim 1, characterized in that, The molar ratio of the ionizable cationic lipid, cofactor phospholipid, cholesterol, and polyethylene glycol ester is 50:10:38.5:1.
5.
3. The preparation method according to claim 2, characterized in that, The polyethylene glycol ester is DMG-PEG2000.
4. The preparation method according to claim 1, characterized in that, The ultrafiltration purification and Tris-HCl buffer replacement of the outer phase specifically include: using a 30 kDa filter membrane, performing ultrafiltration purification at 10°C and 4500 rpm, concentrating to one-tenth of the original volume, and then adding Tris-HCl buffer to the original volume, repeating the operation 3 times.
5. The preparation method according to claim 1, characterized in that, It also includes dissolving gD mRNA and gD antigen peptide together in water as an aqueous phase.
6. The preparation method according to claim 5, characterized in that, The weight ratio of the gD mRNA to the gD antigen polypeptide is 5:1, and the amino acid sequence of the gD antigen polypeptide is shown in SEQ ID NO. 8~13.
7. A bovine herpesvirus type 1 mRNA vaccine, obtained by the preparation method according to any one of claims 1 to 6.
8. A vaccine adjuvant obtained by replacing the gD mRNA in the preparation method of claim 1 with IL-12 mRNA.
9. A vaccine composition comprising the mRNA vaccine of claim 7 and the vaccine adjuvant of claim 8.
10. The vaccine composition according to claim 9, characterized in that, The weight ratio of the mRNA vaccine to the vaccine adjuvant is 5:1.