Use of ndufb11 in the preparation of drugs for improving or treating myocardial injury

Abstract

The application belongs to the technical field of biological medicine. More particularly, it relates to application of Ndufb11 in preparation of drugs for improving or treating myocardial injury. It is found for the first time that the expression of Ndufb11 gene / protein is significantly down-regulated in an adriamycin-induced acute heart failure model and a myocardial cell injury model. Further researches of the application prove that promoting the expression of Ndufb11 gene can not only significantly inhibit abnormal increase of myocardial cell reactive oxygen species induced by adriamycin, effectively relieve oxidative stress injury, but also prevent mitochondrial membrane potential from decreasing and maintain the integrity of mitochondrial function. Based on this, the application provides application of a reagent for promoting the expression of Ndufb11 in preparation of drugs for treating drug-induced myocardial injury, treating heart failure and reducing cardiotoxicity caused by anthracycline chemotherapy drugs, provides a brand-new molecular target for developing a novel high-efficiency and low-toxicity myocardial protection drug, and has a wide application prospect and important clinical value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology. More specifically, it relates to the use of Ndufb11 in the preparation of drugs for improving or treating myocardial injury. Background Technology

[0002] Anthracycline chemotherapy drugs (such as doxorubicin, DOX) are widely used, highly effective, broad-spectrum antitumor drugs in clinical practice, showing significant efficacy against various malignant tumors. However, their severe dose-dependent cardiotoxicity greatly limits their clinical application. Doxorubicin-induced cardiotoxicity presents with diverse clinical manifestations, including electrocardiographic abnormalities, arrhythmias, myocarditis, cardiomyopathy, and even progression to irreversible congestive heart failure. Notably, doxorubicin-induced cardiotoxicity can manifest during treatment, shortly after treatment, or even weeks or months later, seriously threatening patients' quality of life and safety.

[0003] Existing research indicates that the mechanisms of doxorubicin cardiotoxicity are complex and not fully elucidated, primarily involving oxidative stress and excessive reactive oxygen species (ROS) production, mitochondrial structural and functional disorders, calcium overload, DNA damage, and pathological processes such as cardiomyocyte apoptosis and necrosis. Because DOX-induced cardiotoxicity highly mimics the pathological evolution of human heart failure, it has been widely used in heart failure mechanism research and the exploration of new therapeutic targets. Currently, drugs used clinically to prevent or treat this type of heart failure (such as levosimendan) often have limitations such as limited efficacy, narrow indications, or potential toxic side effects. Therefore, there is an urgent clinical need to find new therapeutic targets and develop safer intervention strategies.

[0004] Ndufb11 encodes a subunit of mitochondrial respiratory chain complex I, located in the inner mitochondrial membrane, and plays a crucial role in the assembly and structural stability of complex I. Current research largely focuses on the association between Ndufb11 abnormalities and mitochondrial diseases such as neurodegeneration, while its role in heart failure remains a research gap. Summary of the Invention

[0005] This invention aims to overcome the limitations of existing drugs used in the prevention or treatment of heart failure caused by anthracycline chemotherapy drugs (such as doxorubicin), and provides an application of the Ndufb11 gene or protein (or a reagent that promotes its expression) in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury and heart failure, providing a novel molecular target for the clinical development of safer and more effective myocardial protective intervention strategies.

[0006] The first objective of this invention is to provide the use of the Ndufb11 gene or protein in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

[0007] A second objective of this invention is to provide the use of the Ndufb11 gene or protein in the preparation of medicaments for the prevention or treatment of heart failure.

[0008] A third objective of this invention is to provide the use of reagents that promote Ndufb11 gene expression in the preparation of medicaments for the prevention or treatment of drug-induced myocardial injury.

[0009] A fourth objective of this invention is to provide an agent that promotes the expression of the Ndufb11 gene for use in the preparation of medicaments for the prevention or treatment of cardiotoxicity caused by anthracycline chemotherapy drugs.

[0010] A fifth objective of this invention is to provide the application of reagents that promote Ndufb11 gene expression in the preparation of drugs that enhance the antioxidant capacity of cardiomyocytes.

[0011] A sixth objective of this invention is to provide the use of reagents that promote Ndufb11 gene expression in the preparation of drugs that improve oxidative stress damage in cardiomyocytes.

[0012] A seventh objective of this invention is to provide the use of reagents that promote Ndufb11 gene expression in the preparation of medicaments for the prevention or treatment of mitochondrial dysfunction in cardiomyocytes.

[0013] The eighth object of the present invention is to provide a medicament for treating heart failure or improving drug-induced myocardial injury.

[0014] The above-mentioned objective of this invention is achieved through the following technical solution: This invention, through combined transcriptomics and proteomics analysis, discovered and confirmed that Ndufb11 expression was significantly downregulated in doxorubicin-induced acute heart failure and cardiomyocyte injury models. Further experiments demonstrated that promoting Ndufb11 gene expression can effectively alleviate oxidative stress damage in cardiomyocytes, prevent doxorubicin-induced mitochondrial membrane potential decline, and has therapeutic effects on drug-induced myocardial injury, heart failure, and reducing cardiotoxicity caused by anthracycline chemotherapy drugs. Therefore, this invention claims protection for the following applications: Application of the Ndufb11 gene or protein in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

[0015] Application of the Ndufb11 gene or protein as a target in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

[0016] Specifically, the aforementioned drug-induced myocardial injury is doxorubicin-induced myocardial toxicity injury.

[0017] Application of the Ndufb11 gene or protein in the preparation of drugs for the prevention or treatment of heart failure.

[0018] Application of the Ndufb11 gene or protein as a target in the preparation of drugs for the prevention or treatment of heart failure.

[0019] Application of reagents that promote Ndufb11 gene expression in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

[0020] Reagents that promote Ndufb11 gene expression are used in the preparation of drugs to prevent or treat cardiotoxicity caused by anthracycline chemotherapy drugs.

[0021] Application of reagents that promote Ndufb11 gene expression in the preparation of drugs that enhance the antioxidant capacity of cardiomyocytes.

[0022] Application of reagents that promote Ndufb11 gene expression in the preparation of drugs that improve oxidative stress damage in cardiomyocytes.

[0023] Specifically, the improvement of myocardial cell oxidative stress damage refers to reducing the level of reactive oxygen species in myocardial cells.

[0024] Application of reagents that promote Ndufb11 gene expression in the preparation of drugs for the prevention or treatment of mitochondrial dysfunction in cardiomyocytes.

[0025] Specifically, the treatment of mitochondrial dysfunction in cardiomyocytes involves restoring the mitochondrial membrane potential of cardiomyocytes and alleviating mitochondrial damage to cardiomyocytes.

[0026] Specifically, the reagents for promoting Ndufb11 gene expression include at least one of reagents for overexpressing the Ndufb11 gene and agonists that can promote Ndufb11 expression.

[0027] As an alternative implementation, the reagent for overexpressing the Ndufb11 gene is a vector for overexpressing the Ndufb11 gene.

[0028] Optionally, the method for constructing the vector overexpressing the Ndufb11 gene is as follows: cloning the cDNA sequence of the Ndufb11 gene into the overexpression vector.

[0029] Optionally, the overexpression vector is the pEGFP-C1 vector.

[0030] The present invention also provides a medicament for treating heart failure or improving drug-induced myocardial injury, the medicament comprising an agent for promoting Ndufb11 gene expression and a pharmaceutically acceptable pharmaceutical carrier thereof.

[0031] The present invention has the following beneficial effects: This invention is the first to discover and confirm, through combined transcriptomics and proteomics analysis, that Ndufb11 is significantly downregulated in doxorubicin (DOX)-induced acute heart failure and cardiomyocyte injury models, providing a novel potential molecular target for targeted therapy of heart failure.

[0032] This invention demonstrates through cell experiments that promoting Ndufb11 gene expression can significantly inhibit the abnormal increase in reactive oxygen species (ROS) levels induced by doxorubicin in cardiomyocytes, effectively alleviating oxidative stress damage. Furthermore, promoting Ndufb11 gene expression can effectively prevent the doxorubicin-induced decrease in mitochondrial membrane potential, maintaining the integrity of mitochondrial function; while knocking down Ndufb11 exacerbates the decrease in mitochondrial membrane potential. This indicates that Ndufb11 plays an irreplaceable role in maintaining mitochondrial homeostasis in cardiomyocytes.

[0033] This invention demonstrates that agents promoting Ndufb11 gene expression (such as overexpression agents and specific agonists) have therapeutic effects on drug-induced myocardial injury, heart failure, and reduction of cardiotoxicity caused by anthracycline chemotherapy drugs. This invention provides a novel molecular target for the development of new, highly effective, and low-toxicity cardioprotective drugs, with broad application prospects and significant clinical value. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the process for establishing an acute heart failure model in mice induced by doxorubicin.

[0035] Figure 2 Figure A shows the cardiac function test results of mice in different groups; Figure B shows the M-mode motion curves of echocardiography of mice in each group on days 3 and 7 of the experiment; Figure C shows the measurement results of left ventricular ejection fraction (EF), fractional shortening (FS), and cardiac output (CO) of mice in each group on days 3 and 7 (n=10-12); data are expressed as mean ± SEM. One-way ANOVA and post-hoc Dunnett test were used to compare the groups. P < 0.05 was considered statistically significant and marked accordingly.

[0036] Figure 3 The results show the pathological staining of cardiac tissue from different groups of mice; Figure A shows the H&E staining (20×), WGA staining (20×), Masson staining (20×), and Sirius Red staining (20×) of mouse cardiac tissue sections; Figure B shows the statistical graph of myocardial cross-sectional area based on WGA staining results; Figure C shows the statistical graph of myocardial collagen area based on Masson staining results; Figure D shows the statistical graph of myocardial fibrosis area based on Sirius Red staining results; data are expressed as mean ± SEM.

[0037] Figure 4The Western blotting results of Ndufb11 protein in the heart tissue of different groups of mice are shown in Figure A. Figure A shows the results of Western blotting electrophoresis. Figure B shows the statistical analysis of the gray integral values ​​of the target band. The vertical axis represents the mean ± SEM of the gray integral values. The band was first normalized using the Gapdh band as an internal reference, and then normalized again using the mean of the respective control group as the benchmark.

[0038] Figure 5 The study aimed to detect changes in the mRNA expression of Bnp and β-mhc in AC16 and H9C2 cells after DOX treatment using qPCR. Figure A shows the changes in the mRNA expression of Bnp and β-mhc in AC16 cells, and Figure B shows the changes in the mRNA expression of Bnp and β-mhc in H9C2 cells. Data are presented as mean ± SEM. Data were first normalized using Gapdh as an internal reference, and then normalized again using their respective control groups as a baseline.

[0039] Figure 6 Western blotting was used to detect the expression of Ndufb11 protein in AC16 and H9C2 cells after DOX-induced injury. Figure A shows the expression level of Ndufb11 protein in AC16 and H9C2 cells. Figure B shows the statistical analysis results of Ndufb11 protein expression. The gray integral value of the bands is the mean ± SEM. The expression was first normalized with β-actin as an internal reference, and then normalized with the respective control groups as the baseline.

[0040] Figure 7 The results show the effects of Ndufb11 overexpression on DOX-induced increases in ROS levels and mitochondrial membrane potential in cardiomyocytes; Figure A shows the immunofluorescence microscopy and quantitative statistical analysis of ROS staining in AC16 cells; Figure B shows the immunofluorescence microscopy and quantitative statistical analysis of JC-1 staining in AC16 cells; data are expressed as mean ± SEM; scale bar: 50 µm.

[0041] Figure 8To investigate the effects of Ndufb11 knockdown on DOX-induced increases in ROS levels and mitochondrial membrane potential in cardiomyocytes; Figure A shows the mRNA levels of Ndufb11 detected by qPCR after transfection of AC16 cells with control siRNA (sicontrol), siNdufb11#1, and siNdufb11#2, respectively; Figure B shows the mRNA levels of Ndufb11 detected by qPCR after 24 h of transfection of AC16 cells with control siRNA (sicontrol), siNdufb11#1, and siNdufb11#2, respectively, followed by treatment with 1 µM DOX for 24 h; Figure C shows the immunofluorescence microscopy and quantitative statistical analysis of ROS staining in AC16 cells; Figure D shows the immunofluorescence microscopy and quantitative statistical analysis of JC-1 staining in AC16 cells; Data are expressed as mean ± SEM; Scale bar: 50 µm. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0043] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0044] The cDNA sequence of the Ndufb11 gene (NCBI Gene ID: 54539) is shown in SEQ ID NO.1. SEQ ID NO.1: ATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGCAGCGGCGACGCGAGGGCTCCCGCCCGCCCGCGTCCGCTGGGAATCTAGCTTCCAGGACTGTGGTCGCCCCGTCCGCTGTGGCGGGAAAGCGGCCCCCAGAACCGACCACACCGTGGCAAGAGGACCCAGAACCCGAGGACGAAAACTTGTATGAGAAGAACCCAGACTCCCATGGTTATGAC AAGGACCCCGTTTTGGACGTCTGGAACATGCGACTTGTCTTCTTCTTTGGCGTCTCCATCATCCTGGTCCTTGGCAGCACCTTTGTGCCTATCTGCCTGACTACAGGATGAAAGAGTGGTCCCGCCGCGAAGCTGAGAGGCTTGTGAAATACCGAGAGGCCAATGGCCTTCCCATCATGGAATCCAACTGCTTCGACCCCAGCAAGATCCAGCTGCCAGAGGATGAGTGA.

[0045] Human cardiomyocytes (AC16) and rat cardiomyocytes (H9C2) were purchased from Suzhou Xinsaimei Biotechnology Co., Ltd.

[0046] Levosimendan (SIM) was purchased from Qilu Pharmaceutical Co., Ltd.

[0047] DMEM culture medium, brand name Gibco Life Sciences, catalog number C11995500BT.

[0048] Fetal bovine serum (FBS), branded by Inner Mongolia Daxi Biotechnology Co., Ltd., product number DX-1001.

[0049] Phosphate Buffered Saline (PBS), brand name Gibco Life Sciences, product number C10010500BT.

[0050] The RNA extraction kit is manufactured by Suzhou Xinsaimei Biotechnology Co., Ltd., and its product number is M5105.

[0051] The reverse transcription kit was manufactured by Nanjing Novizan Biotechnology Co., Ltd., and its catalog number is R323-01.

[0052] The real-time fluorescence quantitative PCR kit is manufactured by Nanjing Novizan Biotechnology Co., Ltd., and its product number is Q711-02 / 03.

[0053] RIPA lysis buffer, manufactured by Shanghai Beyotime Biotechnology Co., Ltd., product number P0013D; RIPA lysis buffer contains benzyl sulfonyl fluoride (PMSF).

[0054] Hieff Trans® universal transfection reagent, manufactured by Yisheng Biotechnology (Shanghai) Co., Ltd., product number 40808ES00.

[0055] The Bradford Protein Content Assay Kit is manufactured by Bio-Rad Life Sciences (Shanghai) Co., Ltd., and its catalog number is 5000205.

[0056] The ROS test kit is manufactured by MedChemExpress LLC and has the catalog number HY-D0079.

[0057] JC-1 staining kit, manufactured by MedChemExpress LLC, catalog number HY-15534.

[0058] The Hoechst33342 reagent kit is manufactured by Shanghai Aladdin Biochemical Technology Co., Ltd., and its product number is B113845.

[0059] The anti-Ndufb11 antibody used in the Western blotting assay was from Proteintech, catalog number 16720-1-AP. The secondary antibody was a Goat Anti-Rabbit IgG (H+L) HRP antibody from Affinity, catalog number S0001. The internal control assay used either Gapdh Monoclonal antibody from Proteintech, catalog number 60004-1-Ig, or Beta Actin Monoclonal antibody from Proteintech, catalog number 66009-1-Ig. Both corresponding secondary antibodies were HRP-conjugated Goat Anti-Mouse IgG (H+L) antibodies from Proteintech, catalog number SA00001-1.

[0060] 4×Laemmli buffer, brand name Bio-Rad, catalog number 1610747.

[0061] The animal modeling protocol has been approved by the Ethics Committee of Guangzhou Huateng Biomedical Technology Co., Ltd. (Guangzhou, China) (Approval No.: HTSW211022).

[0062] Example 1: Establishment and Validation of Doxorubicin-Induced Mouse Heart Failure Model I. Experimental Methods Doxorubicin (DOX) solution preparation: Weigh 21.25 mg of DOX powder, add 10 mL of sterile water to dissolve, and mix well.

[0063] Preparation of levosimendan (SIM) solution: Weigh 16.6 mg SIM powder, add 40 mL of sterile physiological saline, dissolve and mix well.

[0064] A schematic diagram of the doxorubicin-induced acute heart failure model in mice is shown below. Figure 1 As shown.

[0065] 1. Methods for establishing a mouse model of heart failure (1) Male SPF-grade C57 / BL6J mice aged 8-10 weeks and weighing 20-25 g were randomly divided into 3 groups of 12 mice each: a control group, a DOX-induced acute heart failure model group, and a levosimendan treatment group (SIM). The mice were weighed and recorded daily, and the required drug volume was calculated based on the weight of each mouse.

[0066] (2) Mice in the model group and SIM group were given a single injection of 12.75 mg / kg DOX on the morning of the first day of modeling; mice in the SIM group were also given 2.5 mg / kg SIM as treatment. The control group was given saline as a blank control.

[0067] (3) On days 2-6 of modeling, the control group and the model group were injected with saline once in the morning and once in the evening; SIM was injected with 2.5 mg / kg SIM once in the morning and once in the evening as treatment. On day 3 of modeling, cardiac ultrasound was performed on mice in each group.

[0068] (4) On the morning of the 7th day, mice in each group were injected with physiological saline, and then cardiac ultrasound was performed. After the examination, euthanasia was performed by cervical dislocation.

[0069] 2. Doppler ultrasound for detecting cardiac function in mice. On the third and seventh day after modeling, echocardiography was performed on mice in each group to determine whether the acute heart failure model was successfully established and whether SIM treatment alleviated heart failure symptoms.

[0070] (1) Before the ultrasound experiment, the heart area of ​​the mouse was treated with hair removal. During the operation, the mouse's limbs were fixed to the operating table with tape, the chest skin was gently opened, and hair removal cream was evenly applied to achieve the hair removal effect.

[0071] (2) For echocardiography, mice were lightly anesthetized by inhaling isoflurane (1.5%) and given continuous oxygen (400 mL / min). After sedation, the animals were fixed and their hearts were fully exposed. Ultrasound coupling agent was evenly applied to the shaved area, and high-frequency probes were used to acquire parasternal short-axis and long-axis left ventricular papillary muscle level images, and two-dimensional images of three cardiac cycles were recorded. The system's built-in analysis software was used to calculate offline indicators such as left ventricular short-axis shortening (FS), stroke volume (SV), ejection fraction (EF), and cardiac output (CO) to evaluate cardiac function.

[0072] 3. Preparation of mouse heart slices (1) Fresh mouse heart tissue was fixed in paraformaldehyde solution (4% concentration), left to stand at room temperature for 24 h until the tissue was fully fixed, and then transferred to PBS solution overnight.

[0073] (2) Dehydrate the heart tissue by first soaking it in 80% ethanol solution for 1 hour, then in 85% ethanol solution for 1 hour, then in 95% ethanol solution for 1 hour, then in xylene solution for 1 hour, and then change the solution and soak for another hour.

[0074] (3) The tissue was immersed in a paraffin solution at 70°C for 2 h, and this was repeated three times. The resulting paraffin block specimens were then prepared using an embedding machine. The prepared paraffin block specimens were stored overnight at -20°C. The next day, paraffin sections of mouse heart tissue with a thickness of 4 µm were prepared using a microtome.

[0075] (4) Place the tissue sections in a 60°C oven and bake for 10 min, then dewax with xylene and dehydrate with ethanol solvent gradient.

[0076] 4. Pathological staining analysis of mouse heart tissue (1) Hematoxylin and eosin staining (H&E staining) Prepared heart tissue sections were immersed in hematoxylin staining solution for 15 min, then rinsed with Milli-Q water for 5 min to remove excess stain. The sections were then placed in differentiation solution for differentiation, followed by rinsing with Milli-Q water for 5 min again; then, a blueing solution was added, followed by rinsing with Milli-Q water for 5 min. The sections were then subjected to the following steps: first, dehydration with gradient anhydrous ethanol solutions; then staining with 0.5% eosin solution for 5 min, followed by rinsing with Milli-Q water for 3 min to remove excess stain; the immersion in anhydrous ethanol solution was repeated three times for 5 min, followed by clearing with xylene twice for 5 min; finally, the sections were mounted with neutral resin and air-dried. Microscopic observation and image acquisition were then performed.

[0077] (2) Wheat germ agglutinin immunofluorescence staining (WGA staining) After air-drying the prepared heart tissue sections at room temperature, an immunohistochemical pen was used to draw circles around the tissue to prevent antibody loss. Then, WGA staining solution was diluted 1:200 and added to the circle to cover the tissue. The sections were incubated at 37°C in the dark for 30 min. After incubation, the sections were immersed in PBS and rinsed three times on a destaining shaker for 10 min each time. The sections were then dried, DAPI staining solution was added, and counterstaining was performed at room temperature in the dark for 2 min. The sections were then rinsed three more times with PBS (10 min each time). Finally, excess water was carefully removed from the sections, and they were mounted with anti-fluorescence quenching mounting medium. The sections were then observed and images were acquired under a microscope.

[0078] (3) Staining for tissue fibrosis (masson staining) The prepared heart tissue sections were immersed in potassium dichromate solution overnight. The next day, the sections were rinsed with Milli-Q water for 5 min, and then freshly prepared iron hematoxylin staining solution A and B in a 1:1 ratio were added to the sections and stained at room temperature for 10 min. The sections were then rinsed with Milli-Q water for 5 min to remove excess stain. Next, a blueing solution was added, followed by rinsing with Milli-Q water for 5 min. Ponceau S and Acid Fuchsin staining solution was added, and the sections were stained at room temperature for 8 min. The sections were then rinsed with Milli-Q water for 3 min to remove any excess stain. The sections were then immersed in aluminum phosphate aqueous differentiation solution for 5 min, and after removing excess liquid, aniline blue staining solution was added for counterstaining for 8 min. After staining, the sections were immersed in 1% glacial acetic acid solution for 10 s, and immediately observed under a microscope to determine the appropriate staining effect. After staining to the required standard, the slides were dehydrated and cleared; then soaked in anhydrous ethanol three times for 5 minutes each time; followed by soaking in xylene twice for 5 minutes each time; the slides were mounted with neutral resin and placed in a ventilated place to dry, and then observed and images were acquired under a microscope.

[0079] (4) Tissue collagen staining (Sirius red staining) The prepared tissue sections were stained with Sirius red stain for 30 min, rinsed twice with Milli-Q water, and then soaked in anhydrous ethanol solution for 5 min, repeated three times. Next, they were cleared by soaking in xylene for 5 min, repeated twice. After mounting with neutral resin, the sections were air-dried and observed under a microscope, and images were acquired.

[0080] II. Results of cardiac function testing in mice with doxorubicin-induced heart failure Cardiac function test results of mice under different treatments, as follows Figure 2 As shown, the results indicated that on day 3 of modeling, compared with the control group, the model group showed a significant decrease in left ventricular ejection fraction (EF), fractional shortening (FS), and cardiac output (CO); the SIM group showed some recovery compared to the model group. Echocardiography on day 7 of modeling also showed that the model group had significantly lower EF, FS, and CO compared to the control group, with a greater decrease than on day 3; the SIM group showed some relief compared to the model group. Echocardiography plays an important role in assessing cardiac function, especially EF, which is a crucial clinical indicator for diagnosing heart failure. In our results, the EF values ​​in the model group were significantly lower than those in the control group on both day 3 and day 7 of modeling, indicating that the model group mice developed significant heart failure.

[0081] The histopathological staining results of the heart tissue in mice with doxorubicin-induced heart failure are as follows: Figure 3 As shown: Hematoxylin-eosin (H&E) staining is the most commonly used staining method in histopathology, revealing tissue and cell morphology and determining whether tissues are morphologically normal. Hematoxylin is a basic dye that stains cellular components containing nucleic acids (such as DNA and RNA) blue / dark purple. Eosin is an acidic dye that stains cytoplasm, collagen fibers, muscle, and erythrocytes in varying shades of red. Hematoxylin-eosin staining results showed that the myocardial tissue of mice in the control group had normal morphology, with tightly and regularly arranged myocardial fibers, clear and intact muscle bundle structures, uniformly sized cell nuclei, and no obvious abnormalities in the interstitium. The myocardial tissue of mice in the model group showed obvious pathological changes, mainly manifested as loose and disordered arrangement of myocardial fibers and significantly widened interfascicular spaces. Compared with the model group, the pathological damage of the myocardial tissue of mice in the SIM group was significantly reduced, the arrangement of myocardial fibers was more regular, the intercellular spaces were smaller, and the tissue morphology was similar to that of the control group.

[0082] Wheat germ lectin staining (WGA staining) is a fluorescent staining technique based on wheat germ lectin. Staining with fluorescently labeled WGA allows for clear visualization of cell outlines under a fluorescence microscope, enabling the assessment of cardiomyocyte hypertrophy. Results showed that cardiomyocytes in the control group mice had regular morphology, clear boundaries, and smaller cross-sectional areas. In contrast, cardiomyocytes in the model group mice were significantly enlarged, with a marked increase in the area within the cell boundaries. Quantitative analysis results ( Figure 3 Figure B also shows that the cross-sectional area of ​​cardiomyocytes in the model group was significantly increased compared to the control group. After drug treatment, cardiomyocyte hypertrophy in the SIM group was significantly inhibited, and its cell cross-sectional area was significantly reduced compared to the model group. These results indicate that myocardial hypertrophy occurred in the model group, proving that DOX-induced acute heart failure caused myocardial damage.

[0083] Masson staining revealed that muscle fibers appeared red, while collagen fibers appeared green or blue, primarily used to distinguish between them. Masson staining results showed that the myocardial tissue in the control group was uniformly stained red. In the model group, a large amount of blue collagen fiber deposition was observed in the myocardial interstitium, indicating myocardial fibrosis. The collagen volume fraction was significantly increased compared to the control group. Figure 3 Figure C shows the statistical quantification results of the blue collagen deposition area as a percentage of the total area, used to quantify the degree of myocardial fibrosis. Compared with the control group, the model group mice showed a significantly increased area of ​​myocardial fibrosis, indicating significant myocardial fibrosis. Compared with the model group, the SIM group showed a significant reduction in the blue area of ​​myocardial tissue, indicating a significant decrease in collagen deposition, suggesting that SIM effectively inhibited myocardial fibrosis.

[0084] Sirius Red staining can be used for quantitative analysis of myocardial fibrosis area. Under a light microscope, collagen fibers appear red, while cardiomyocyte cytoplasm and muscle tissue are stained pale yellow or yellow. Compared with the control group, the model group showed significant myocardial fibrosis; manifested as a large number of increased, reticularly distributed red collagen fiber deposits in the myocardial interstitium. Its statistical quantitative results ( Figure 3 The D-plot shows that the collagen fiber area in the model group was significantly higher than that in the control group, indicating that the myocardium of the mice in the model group showed obvious fibrosis. The degree of collagen deposition in the myocardial tissue of the SIM group was significantly reduced compared with that of the model group, with a significant reduction in the red area; quantitative analysis results also showed that the collagen deposition area in the SIM group was significantly lower than that in the model group, indicating that SIM treatment effectively reduced myocardial collagen deposition and improved the degree of fibrosis.

[0085] The above cardiac tissue pathological staining results show that the myocardial fibers in DOX-induced acute heart failure mice are loosely and disordered; cardiomyocyte hypertrophy and fibrosis are present, indicating that the mouse heart failure model has been successfully established.

[0086] Example 2: Transcriptomic and proteomic analysis of cardiac tissue from mice with heart failure I. Transcriptomics Analysis and Proteomics Analysis Transcriptomic and proteomic analyses were performed on mice from the control, model, and SIM groups in Example 1.

[0087] Transcriptomics analysis was performed by Shanghai Kangcheng (Shupu) Biotechnology Co., Ltd. The experimental procedure included: extraction of total RNA from mouse hearts, agarose gel electrophoresis and Nanodrop quality control quantification, RNA sequencing library construction, library quality control quantification, Illumina NovaSeq 6000 sequencing, statistical differential analysis, and bioinformatics analysis.

[0088] Proteomics analysis was performed using a shotgun proteomics differential analysis method based on nano-HPLC-MS / MS.

[0089] II. Experimental Results Transcriptomics detected 516 differentially expressed genes, and proteomics detected 148 differentially expressed proteins. Through combined analysis, Ndufb11, a key differentially expressed gene, was identified, which was significantly downregulated in the DOX-induced heart failure model.

[0090] Western blotting was performed on the Ndufb11 protein in the heart tissues of mice in the control group, model group, and SIM group of Example 1. The results are as follows: Figure 4 As shown, the results indicate that the level of Ndufb11 in the model group mice was significantly lower than that in the control group, consistent with the proteomics and transcriptomics results, suggesting that this protein is involved in the pathological process of acute heart failure.

[0091] Example 3: Establishment and qPCR validation of a cardiomyocyte injury model To verify the reliability of the DOX-induced cardiomyocyte injury model, this embodiment detected the expression changes of heart failure phenotypic markers in human cardiomyocyte cell line AC16 and rat cardiomyocyte cell line H9C2, respectively.

[0092] I. Establishment of AC16 and H9C2 cell models of myocardial injury Cardiomyocytes were cultured in DMEM medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. Once the cells reached good growth status and suitable density, they were passaged or plated. Normal passage culture was performed in 10 cm culture dishes, qPCR and Western blotting experiments were conducted in 6-well plates, and immunofluorescence staining was performed in 24-well plates. Experiments were carried out after 24 hours of cell adhesion.

[0093] 1. Establishment of a myocardial injury model A cardiomyocyte injury model was established by inducing cardiomyocytes with 1 µmol / L DOX for 24 h. Cells were randomly divided into a control group, a model group, a SIM group (treatment group), and a corresponding SIM control group (SIM-control). SIM was first dissolved in DMSO to prepare a 195 mmol / L stock solution. Subsequent cell drug administration involved diluting the stock solution to the required concentration using DMEM medium containing 10% fetal bovine serum. To control the solvent effect, each group contained 0.025% (v / v) DMSO during the modeling process.

[0094] Control group: Cells were cultured in DMEM medium (containing 10% fetal bovine serum) containing 0.025% (v / v) DMSO for 24 h; Model group: Cells were treated with DMEM containing 1 µmol / L DOX (containing 10% fetal bovine serum and 0.025% (v / v) DMSO) for 24 h; SIM group: Cells were pretreated with DMEM (containing 10% fetal bovine serum) containing 50 µM SIM and 1 µmol / L DOX for 1 h, the original culture medium was discarded, the cells were washed twice with PBS, and then treated with DMEM (containing 10% fetal bovine serum and 0.025% (v / v) DMSO) containing 1 µmol / L DOX for 24 h. SIM control group: Cells were pretreated in DMEM containing 50 µM SIM (containing 10% fetal bovine serum) for 1 h, and then cultured in DMEM containing 0.025% (v / v) DMSO (containing 10% fetal bovine serum) for 24 h.

[0095] 2. Validation of the myocardial injury model The changes in the expression levels of heart failure biomarkers after 24 h of induction of cardiomyocytes with 1 µmol / L DOX were detected using real-time quantitative PCR (qPCR). The specific experiments are as follows: (1) Cell RNA extraction: Cardiomyocytes were induced with 1 µmol / L DOX for 24 h. The old culture medium in the 6-well plate was discarded, and the cells were washed twice with PBS, 2 mL each time. Total RNA was extracted from the cells using an RNA extraction kit (NewCeMed, M5105). The RNA concentration was measured using an ultra-microspectrophotometer, and the purity was assessed by the A260 / A280 ratio.

[0096] (2) Reverse transcription of cDNA: RNA was transcribed into cDNA using a reverse transcription kit (Novizan, R323-01). The specific steps were performed according to the kit instructions. The obtained cDNA can be used for qPCR or stored at -80 ℃.

[0097] (3) qPCR: The reaction system was prepared according to the instructions of the real-time quantitative PCR kit (Novizan, Q711-02 / 03) to detect the expression of Bnp and β-MHC genes by qPCR. The qPCR reaction conditions were: 95°C pre-denaturation for 30 seconds, followed by 39 cycles (95°C denaturation for 10 seconds, 60°C extension for 30 seconds). Gapdh was used as an internal control, and 2 -ΔΔCt The relative expression level of the target gene was calculated using a method. Primer sequences are shown in Table 1.

[0098] Table 1 Primer Sequences

[0099] II. Experimental Results qPCR results as follows Figure 5 As shown, the results indicated that in AC16 cells, the mRNA levels of brain peptide (BNP) and β-myosin (β-MHC) in the model group were significantly upregulated compared to the control group, and both indicators showed a decreasing trend after SIM treatment. Similarly, the same trend was observed in H9C2 cells. These results demonstrate that treatment with 1 µmol / L DOX for 24 h can stably induce increased expression of myocardial injury markers in both cardiomyocyte cell lines, confirming the successful establishment of the cardiomyocyte injury model.

[0100] Example 4: Changes in Ndufb11 expression during cardiomyocyte injury To clarify the role of Ndufb11 in cardiomyocyte injury, this embodiment uses Western blotting (WB) technology to detect the protein level of Ndufb11 in two types of cardiomyocytes (AC16 and H9C2) under different treatments in Example 1.

[0101] I. Western blotting detection After treatment of each cell group (control group, model group, SIM group, SIM-control group) in Example 1, the culture medium was discarded, and the cells were washed three times with pre-cooled PBS at 4°C. RIPA lysis buffer containing 1 mM PMSF was added, and the cells were lysed on ice for 30 min. The cells were then centrifuged at 13,000 × g for 5 min at 4°C, and the supernatant was collected. Protein concentration was determined using a Bradford protein assay kit. Before electrophoresis, the protein concentration of each sample was adjusted to 3–4 µg / µL (buffer was commercially available 4× Laemmli buffer (Bio-Rad, 1610747), added to the protein solution to a final concentration of 1×). The sample solution was heated in a metal bath at 95°C for 5 min and centrifuged at 15,000 g at room temperature for 5 min. 30 µg of total protein was loaded per lane for AC16 cells, and 50 µg per lane for H9C2 cells, for Western blotting. β-actin was used as the internal control protein.

[0102] II. Experimental Results Western blotting results are as follows Figure 6 As shown in the figure, Ndufb11 in both types of cardiomyocytes was significantly downregulated after DOX administration compared with the control group, confirming that Ndufb11 is indeed involved in the DOX-induced myocardial injury process, which is consistent with the proteomics results.

[0103] Example 5: Overexpression of Ndufb11 reduces cardiomyocyte damage To investigate the role of Ndufb11 in cardiomyocyte injury, this study overexpressed Ndufb11 in AC16 cells and examined its effects on intracellular reactive oxygen species (ROS) levels and mitochondrial membrane potential (MMP).

[0104] I. Cell Transfection and Drug Treatment 1. Plasmid construction and experimental grouping To facilitate the differentiation of fluorescence channels for different detection indicators, two different fluorescent labeling vectors were used in this experiment. The cDNA of human Ndufb11 (NCBI Gene ID: 54539) was inserted into the pEGFP-C1 vector to construct the N-terminal EGFP fusion protein expression plasmid (GFP-Ndufb11).

[0105] pEGFP The EGFP coding sequence in the C1 vector was replaced with cDNA of the blue fluorescent protein mTagBFP2, and then the cDNA of Ndufb11 was inserted according to the reading frame to obtain the N-terminal mTagBFP2 fusion protein expression plasmid (BFP-Ndufb11). All plasmids were synthesized and sequenced by Shanghai Jereh Biotechnology Co., Ltd.

[0106] (1) For ROS detection experiments: use empty vector (GFP-Vector) or Ndufb11 overexpression plasmid (GFP-Ndufb11). (2) For the mitochondrial membrane potential detection experiment: use an empty vector (BFP-Vector) or an Ndufb11 overexpression plasmid (BFP-Ndufb11).

[0107] 2. Cell transfection procedure When AC16 cells adhered and grew to 70% confluency, the medium was replaced with fresh DMEM containing 10% fetal bovine serum. Following the instructions for the Hieff Trans® universal transfection reagent (Yisheng, 40808ES00), plasmid DNA and transfection reagent were diluted separately with Opti-MEM medium. The diluted plasmid DNA and transfection reagent were mixed at a 1:1 volume ratio and incubated at room temperature for 5 min to form a DNA-liposome complex. This mixture was then added dropwise to the AC16 cells.

[0108] 3. DOX treatment 24 h after transfection, the cells were treated with drugs. The control group was treated with an equal volume of PBS, and the model group was treated with DOX at a final concentration of 1 µmol / L, and then cultured for another 24 h.

[0109] II. Methods for Detecting ROS and Mitochondrial Membrane Potential 1. ROS detection (DHE staining) After treatment, the culture medium was aspirated, and a mixture of 12.5 µM DHE diluted with serum-free DMEM and Hoechst 33342 (1:2000 dilution) was added. The mixture was incubated at 37°C in the dark for 30 min. After gentle washing twice with PBS, fluorescence images were captured using an inverted fluorescence microscope (Leica, Germany). Five fields of view were randomly selected from each group, imaged at 100x magnification, and the average fluorescence intensity was analyzed using ImageJ software. DHE staining showed red fluorescence (indicating ROS accumulation), while Hoechst 33342 staining showed blue fluorescence (indicating nuclear DNA).

[0110] 2. Mitochondrial membrane potential detection (JC-1 staining) After treatment, the cell culture medium was removed, and 5 µM JC-1 staining solution diluted with serum-free DMEM was added. The cells were incubated at 37°C for 30 min. After washing twice with PBS, fluorescence images were captured using an inverted fluorescence microscope. Five fields of view were randomly selected from each group, imaged at 100x magnification, and the red / green fluorescence intensity was analyzed using ImageJ software. JC-1 dye forms aggregates and emits red fluorescence when the mitochondrial membrane potential is high; when the membrane potential decreases, it exists as monomers and emits green fluorescence.

[0111] III. Experimental Results DHE is a peroxide indicator that can penetrate cell membranes and form a fluorescent protein complex. When DHE is dehydrogenated, it binds to RNA or DNA, producing red fluorescence, which can be used to indicate the accumulation of ROS. ROS detection experimental results are as follows... Figure 7 As shown in Figure A, compared with the control group, the intensity of red fluorescence in the model group cells was significantly increased, indicating that DOX led to a large accumulation of ROS in the cells. Overexpression of Ndufb11 could alleviate the increase of ROS, proving that Ndufb11 can alleviate DOX-induced oxidative stress damage in cardiomyocytes. Mitochondrial membrane potential is an important indicator for evaluating the integrity of mitochondrial function, and its decrease is considered a typical feature of early apoptosis.

[0112] JC-1 dye is a widely used fluorescent probe for detecting mitochondrial membrane potential. It forms aggregates and emits red fluorescence when the mitochondrial membrane potential is high; conversely, when the membrane potential decreases, JC-1 exists as a monomer and emits green fluorescence. Therefore, the ratio of red to green fluorescence within the cell can reflect the mitochondrial membrane potential. The results of the mitochondrial membrane potential detection experiment are as follows: Figure 7 Figure B shows the results. The results indicate that, compared with the control group, the red / green fluorescence intensity in the model group cells was significantly reduced, indicating that DOX caused a decrease in mitochondrial membrane potential; overexpression of Ndufb11 could alleviate the decrease in mitochondrial membrane potential, proving that Ndufb11 can alleviate DOX-induced mitochondrial damage in cardiomyocytes.

[0113] The above results indicate that overexpression of Ndufb11 can alleviate DOX-induced oxidative damage, restore mitochondrial membrane potential, and play a protective role in cardiomyocyte injury.

[0114] Example 6: Knockdown of Ndufb11 exacerbates cardiomyocyte damage To verify the regulatory role of Ndufb11 in cardiomyocyte injury, this study knocked down the expression of Ndufb11 in DOX-treated AC16 cells using siRNA interference technology and observed its effect on cell damage.

[0115] I. Experimental Methods 1. siRNA design and transfection methods Two siRNA oligonucleotides (siNdufb11 #1 and siNdufb11 #2) targeting the Ndufb11 gene and a negative control sicontrol (target sequences shown in Table 2) were designed and constructed and synthesized by Shanghai Jereh Biotechnology Co., Ltd. AC16 cells were seeded in 24-well plates and transfected with siRNA at 70% confluence using Hieff Trans® universal transfection reagent according to the reagent instructions (Universal-A solution was not required when diluting the siRNA). 24 h after transfection, cells were treated with either PBS (control group) or DOX at a final concentration of 1 µmol / L (model group) and cultured for another 24 h.

[0116] Table 2 siRNA Target Sequences

[0117] 2. Knockdown efficiency verification and fluorescence detection method Cells were collected after transfection, and Ndufb11 mRNA levels were detected using the qPCR method described in Example 3 to verify the knockdown efficiency. The detection procedures for ROS and mitochondrial membrane potential were the same as in Example 5, except that Hoechst 33342 (1:2000) was added simultaneously during JC-1 staining for nuclear localization. Fluorescence image acquisition and ImageJ quantitative analysis standards were the same as in Example 5.

[0118] (1) ROS detection (DHE staining): Discard the culture medium, add 12.5 µM DHE diluted with serum-free DMEM and Hoechst 33342 (1:2000 dilution) mixed staining solution, incubate at 37℃ in the dark for 30 min, and gently rinse the cells twice with PBS.

[0119] (2) Mitochondrial membrane potential detection (JC-1 staining): Discard the culture medium and add 5 µM JC-1 dye and Hoechst 33342 (1:2000 dilution) mixed dye diluted with serum-free DMEM; incubate at 37℃ in the dark for 30 min, and gently rinse the cells twice with PBS.

[0120] After staining, images were observed and acquired using an inverted fluorescence microscope, and quantitative analysis of fluorescence intensity was performed using ImageJ software.

[0121] II. Experimental Results The effects of knocking down Ndufb11 on DOX-induced increases in cardiomyocyte ROS levels and mitochondrial membrane potential are as follows: Figure 8 As shown. The knockdown efficiency of siRNA was detected by qPCR; both siNdufb11 lines significantly downregulated the intracellular Ndufb11 mRNA level (…). Figure 8 (Figures A and B).

[0122] The results of the investigation on the effects of Ndufb11 downregulation on DOX-induced ROS levels and mitochondrial membrane potential in cardiomyocytes are as follows: Figure 8 As shown in Figure C, compared with the control group, the intensity of red fluorescence in the model group cells was significantly enhanced, indicating that DOX treatment led to a large accumulation of ROS in the cells, and downregulation of Ndufb11 further aggravated the accumulation of this ROS.

[0123] JC-1 staining results are as follows Figure 8 As shown in Figure D, the results indicate that DOX treatment leads to a decrease in mitochondrial membrane potential, and downregulation of Ndufb11 further exacerbates this decrease, demonstrating that knocking down Ndufb11 aggravates DOX-induced mitochondrial damage in cardiomyocytes.

[0124] In summary, knockdown of Ndufb11 exacerbated DOX-induced oxidative damage and mitochondrial dysfunction. Combined with the overexpression results described above, this confirms the protective effect of Ndufb11 against cardiomyocyte injury.

[0125] This invention is the first to discover, through transcriptomics and proteomics, that Ndufb11 expression is significantly downregulated in a doxorubicin (DOX)-induced acute heart failure model, and this was validated in a cardiomyocyte injury model. This invention utilizes transient plasmid transfection and siRNA interference techniques to achieve overexpression and knockdown of Ndufb11 in cardiomyocytes, respectively, and combines these with live-cell immunofluorescence staining to systematically evaluate the effects of Ndufb11 on oxidative stress and mitochondrial function in cardiomyocytes. The results show that overexpression of Ndufb11 significantly inhibits the abnormal increase in DOX-induced reactive oxygen species (ROS) levels in cardiomyocytes and effectively maintains mitochondrial membrane potential; conversely, knockdown of Ndufb11 significantly exacerbates the aforementioned oxidative damage and mitochondrial dysfunction.

[0126] In summary, this invention is the first to demonstrate the crucial protective role of Ndufb11 in alleviating DOX-induced oxidative damage to cardiomyocytes and maintaining mitochondrial homeostasis, providing a novel potential intervention target and theoretical basis for targeted therapy of acute heart failure.

[0127] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Application of the Ndufb11 gene or protein in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

2. Application of Ndufb11 gene or protein as a target in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

3. Application of the Ndufb11 gene or protein in the preparation of drugs for the prevention or treatment of heart failure.

4. Application of the Ndufb11 gene or protein as a target in the preparation of drugs for the prevention or treatment of heart failure.

5. Application of reagents that promote Ndufb11 gene expression in the preparation of drugs for the prevention or treatment of drug-induced myocardial injury.

6. The use of reagents that promote Ndufb11 gene expression in the preparation of drugs for the prevention or treatment of cardiotoxicity caused by anthracycline chemotherapy drugs.

7. Application of reagents that promote Ndufb11 gene expression in the preparation of drugs that enhance the antioxidant capacity of cardiomyocytes.

8. Application of reagents that promote Ndufb11 gene expression in the preparation of drugs that improve oxidative stress damage in cardiomyocytes.

9. Application of reagents that promote Ndufb11 gene expression in the preparation of drugs for the prevention or treatment of mitochondrial dysfunction in cardiomyocytes.

10. A medicament for treating heart failure or improving drug-induced myocardial injury, characterized in that, The drug includes a reagent that promotes the expression of the Ndufb11 gene and a pharmaceutically acceptable pharmaceutical carrier thereof.

Images