Use of slc1a4 as an immunotherapy target in the preparation of anti-tumor drugs

Abstract

The application belongs to the field of biological medicine and tumor immunotherapy, and particularly relates to application of SLC1A4 as a tumor immunotherapy target in preparation of an antitumor drug. + T cell nutrition deficiency and immune surveillance failure, and targeting SLC1A4 can release the nutritional hijacking and re-activate the anti-tumor immunity. SLC1A4 is highly expressed in tumor cells and is related to poor prognosis. Knocking out SLC1A4 has no direct effect on tumor cell proliferation, but can significantly inhibit the growth and metastasis of orthotopic liver cancer, lung cancer and colorectal cancer, and reshape the immune microenvironment, which is completely dependent on CD8 + T cells. The application also provides a significant synergistic effect of the SLC1A4 inhibitor combined with the immune checkpoint inhibitor, which can be used for preparing an antitumor drug and improving the inhibitory effect on solid tumors that are not responsive or resistant to the treatment with the immune checkpoint inhibitor alone.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and tumor immunotherapy, specifically involving the application of SLC1A4 (also known as ASCT1) as a tumor immunotherapy target in the preparation of anti-tumor drugs. Background Technology

[0002] The amino acid transporter SLC1A4 (Solute Carrier Family 1 Member 4, also known as ASCT1) gene belongs to the solute carrier transporter family 1, contains 8 exons, and is located on chromosome 2p14.8. SLC1A4 is a sodium-dependent neutral amino acid transporter, primarily responsible for transporting small neutral amino acids such as serine, alanine, and cysteine. SLC1A4 protein is mainly expressed in the central nervous system. The physiological functions of SLC1A4 have been studied since its initial discovery, but current understanding of its functions is limited. Existing research on SLC1A4 mainly focuses on its functions in the nervous system, with its most accepted function appearing to be related to brain homeostasis.

[0003] Immune checkpoint inhibitor therapy has shown remarkable efficacy in many malignant solid tumors, effectively inhibiting tumor growth and prolonging patient survival. The mechanism of action of immune checkpoint inhibitors primarily involves antagonizing immunosuppressive receptors such as CTLA-4, PD-1, or PD-L1, restoring the immune activity of the patient's T cells, thereby enhancing the anti-tumor immune response.

[0004] PD-1 (programmed death receptor 1), also known as CD279 (differentiation cluster 279), is an important immunosuppressive molecule. It modulates the immune system and promotes self-tolerance by downregulating the immune system's response to human cells and by suppressing T-cell inflammatory activity. This can prevent autoimmune diseases, but it can also prevent the immune system from killing cancer cells.

[0005] PD-1 inhibitors are a new class of drugs that block PD-1, which can activate the immune system to attack tumors and are used to treat certain types of cancer.

[0006] Combined immunotherapy can significantly improve tumor remission rates, reduce the risk of disease progression, thereby prolonging overall survival and improving patients' quality of life.

[0007] Current technologies have never revealed any function of SLC1A4 in tumor immune escape, nor have they addressed the mechanism by which tumor cells actively plunder serine residues in the microenvironment via SLC1A4 to limit the nutrient availability of immune cells, thereby suppressing the anti-tumor immune response. Furthermore, there are no reports of combination therapy between SLC1A4 inhibitors and PD-1 inhibitors. Summary of the Invention

[0008] To overcome the shortcomings of current technology, this invention provides the application of SLC1A4 as a therapeutic target in the preparation of anti-tumor drugs. This application reveals a targeting strategy that specifically blocks tumor cells from plundering serine residues from the microenvironment, thereby precisely restoring T cell function. This provides a novel intervention target for tumor immunotherapy.

[0009] This invention is achieved through the following technical solution: This invention provides the application of SLC1A4 as a therapeutic target in the preparation of antitumor drugs.

[0010] Furthermore, this invention provides the application of SLC1A4 as an immunotherapy target in the preparation of antitumor drugs.

[0011] Furthermore, this invention provides the application of SLC1A4 as an immunotherapy target in the development, design, and screening of antitumor drugs.

[0012] Furthermore, the tumor is a tumor that highly expresses SLC1A4, preferably liver cancer, colorectal cancer, lung cancer, melanoma, or breast cancer.

[0013] This invention, through immunofluorescence analysis of 90 pairs of liver cancer-adjacent tissue microarrays using the TCGA database, revealed that the levels of SLC1A4 mRNA and protein in liver cancer tissues were significantly higher than those in normal liver tissues, and the overall survival rate of patients with high SLC1A4 expression was significantly lower than that of patients with low expression. SLC1A4 is widely expressed in human liver cancer cell lines.

[0014] Using CRISPR / Cas9 technology, SLC1A4 knockout in human HepG2 and mouse Hepa1-6BL hepatocellular carcinoma cells was consistently demonstrated by CCK-8, EdU, Annexin V, scratch healing, and colony formation assays. These results showed that SLC1A4 deficiency did not affect the viability, proliferation, apoptosis, migration, or colony formation ability of tumor cells. However, SLC1A4 knockout in hepatocellular carcinoma cells still significantly inhibited tumor growth and metastasis and reduced liver damage.

[0015] Experimental results show that tumor cells take up large amounts of serine from the microenvironment through SLC1A4, leading to a decrease in serine levels in tumor interstitial fluid and serum, thereby "starving" CD8 cells. + SLC1A4 inhibits the proliferation and effector function of T cells; however, knocking out SLC1A4 can break this nutrient hijacking, restore the PI3K / AKT / mTORC1, MAPK, and NF-κB signaling pathways of T cells, and reactivate anti-tumor immunity. Therefore, SLC1A4 can serve as a target for immunotherapy of liver cancer for the development, design, and screening of anti-liver cancer drugs, and can also be used to prepare anti-liver cancer drugs.

[0016] The drug works by blocking the uptake of serine from the microenvironment by tumor cells, thereby relieving the inhibition of CD8. + Nutritional suppression of T cells restores the PI3K / AKT / mTORC1, MAPK, and NF-κB signaling pathways of T cells, thereby enhancing the anti-tumor immune response.

[0017] This invention provides an SLC1A4 inhibitor, which is one or more of the following: small molecule inhibitors targeting SLC1A4 that can reduce SLC1A4 expression or block its amino acid transport activity, small interfering RNA (siRNA), short hairpin RNA (shRNA), antisense oligonucleotides, monoclonal antibodies, bispecific antibodies, nanobodies, aptamers, and CRISPR / Cas9 gene editing reagents.

[0018] Preferably, the SLC1A4 inhibitor is a small molecule inhibitor targeting SLC1A4, sgRNA, siRNA, shRNA, or antisense oligonucleotide.

[0019] The siRNA contains a sequence complementary to SLC1A4 mRNA and can specifically silence the expression of the SLC1A4 gene.

[0020] The present invention further provides an SLC1A4 inhibitor, wherein the SLC1A4 inhibitor is selected from sequences whose forward 5'-3' ends are SEQ ID No. 1-8 and whose reverse 5'-3' ends are SEQ ID No. 9-16 or their modified forms.

[0021] Furthermore, the modified form refers to a nanomedicine delivery system containing the above-mentioned SLC1A4 inhibitor, such as liposomes, nanoparticles, nanosuspensions, etc.

[0022] The sequences of the SLC1A4 inhibitors are shown in Table 1.

[0023]

[0024] Furthermore, the nanosuspension comprises sgRNA or siRNA and PLGA-PEG copolymer as listed in Table 1, with a mass ratio of sgRNA or siRNA to PLGA-PEG copolymer of 1:10-50. The molecular weight of PLGA is 1000-5000, the molecular weight of PEG is approximately 2000-5000, and the PLGA monomer ratio is lactic acid / glycolic acid = 50 / 50.

[0025] It is prepared by a dual-emulsion-solvent evaporation method. The preparation method includes the following steps: (1) Slc1a4 siRNA was diluted with a small amount of DEPC water to an appropriate concentration to form an inner aqueous phase. The concentration of Slc1a4 siRNA in the inner aqueous phase was 0.5-2 mg / mL.

[0026] (2) The PLGA-PEG copolymer was dissolved in dichloromethane as the oil phase, and the concentration of the PLGA-PEG copolymer was 10-30 mg / mL.

[0027] (3) Add the aqueous phase dropwise to the oil phase and emulsify it by ultrasonication with a 40-60W probe to form the primary emulsion (W / O).

[0028] (4) The colostrum is then rapidly injected into the external aqueous phase containing polyvinyl alcohol (PVA) (PVA concentration is 1%), and ultrasonically emulsified again to form a double emulsion (W / O / W).

[0029] (5) The organic solvent in the resulting emulsion was removed using a rotary evaporator, and the nanoparticle suspension was concentrated to obtain a nanoparticle suspension encapsulated with siRNA. The particle size of the prepared nanoparticle suspension was approximately 100-150 nm.

[0030] This invention provides an enhanced CD8 + Methods for T cell proliferation, granzyme B expression, and tumor-killing ability, the methods including knocking out SLC1A4 in tumor cells and culturing CD8 cells in conditioned medium. + T cells, the conditioned medium is TCM medium.

[0031] The present invention provides a tumor immunotherapy composition comprising an SLC1A4 inhibitor and an immune checkpoint inhibitor.

[0032] Furthermore, the immune checkpoint inhibitor is a PD-1 antibody inhibitor, a PD-L1 antibody inhibitor, or a CTLA-4 inhibitor, preferably a PD-1 antibody inhibitor, wherein the PD-1 antibody inhibitor is an anti-PD-1 monoclonal antibody.

[0033] The mass ratio of the immune checkpoint inhibitor to the SLC1A4 inhibitor is 1:10-100, preferably 1:10-50, and more preferably 1:30-40.

[0034] The composition may also contain a pharmaceutically acceptable carrier or excipient.

[0035] In the tumor immunotherapy composition, the SLC1A4 inhibitor combined with the PD-1 antibody can effectively overcome PD-1 antibody resistance and significantly enhance the anti-tumor efficacy of the immune checkpoint inhibitor.

[0036] The SLC1A4 inhibitor is one or more of the following: small molecule inhibitors targeting SLC1A4, small interfering RNA (siRNA), short hairpin RNA (shRNA), antisense oligonucleotides, monoclonal antibodies, bispecific antibodies, nanobodies, aptamers, and CRISPR / Cas9 gene editing reagents; preferably, the SLC1A4 inhibitor is SLC1A4 siRNA targeting SLC1A4.

[0037] This invention provides the use of the tumor immunotherapy composition in the preparation of antitumor drugs, especially drugs for treating liver cancer.

[0038] This invention provides the use of SLC1A4 inhibitors in the preparation of sensitizers or enhancers for tumor immunotherapy.

[0039] Furthermore, the present invention provides the use of SLC1A4 inhibitors in the preparation of sensitizers that enhance PD-1 inhibitor treatment of liver cancer.

[0040] This invention provides the application of SLC1A4 inhibitor combined with PD-1 antibody in the preparation of antitumor drugs.

[0041] The dose ratio of the SLC1A4 inhibitor to the PD-1 antibody is 1:10-100, preferably 1:10-50.

[0042] Furthermore, the SLC1A4 inhibitor is any one of the genes listed in Table 1.

[0043] Furthermore, based on mice, the dosages of the SLC1A4 inhibitor and the PD-1 antibody are 250-350 μg / mouse and 6-10 μg siRNA / mouse, respectively, with the preferred dosages being 300 μg / mouse and 8 μg siRNA / mouse.

[0044] The tumor in question is a solid tumor that does not respond to, develops resistance to, or has poor efficacy when treated with immune checkpoint inhibitors alone.

[0045] The aforementioned combination refers to administering at least one dose of an SLC1A4 inhibitor and at least one dose of a PD-1 antibody within a certain time period. The time period can be within a dosing cycle, preferably within 4 weeks, 3 weeks, 2 weeks, 1 week, or within 24 hours.

[0046] Combined administration methods are selected from simultaneous administration, independently prepared and co-administered, or independently prepared and sequentially administered.

[0047] Preferably, the combined administration method is to administer PD-1 antibody and SLC1A4 inhibitor simultaneously or sequentially.

[0048] This invention provides the application of SLC1A4 as a biomarker in the preparation of liver cancer diagnostic products.

[0049] The aforementioned biomarkers are serum diagnostic biomarkers, plasma diagnostic biomarkers, or tissue cell diagnostic biomarkers.

[0050] This invention provides the application of reagents for detecting SLC1A4 in the preparation of products for immunotherapy efficacy or screening of suitable populations.

[0051] The products mentioned are reagent kits, chips, or nucleic acid membrane strips.

[0052] Furthermore, this invention provides the application of SLC1A4 as a biomarker in the preparation of diagnostic kits for predicting the efficacy of immune checkpoint inhibitors or screening suitable populations.

[0053] This invention provides a nanodelivery system comprising siRNA targeting SLC1A4 and a pharmaceutically acceptable carrier, wherein the nanodelivery system can be lipid nanoparticles, polymer nanoparticles, or inorganic nanoparticles. The nanodelivery system is capable of delivering siRNA to liver tumor tissue.

[0054] The inventors first discovered through TCGA database and tissue microarray analysis that SLC1A4 is significantly highly expressed in liver cancer tissues, and its high expression is negatively correlated with overall patient survival. In vitro experiments showed that SLC1A4 knockout had no direct effect on the proliferation, apoptosis, migration, and colony formation of liver cancer cells, indicating that SLC1A4 does not exert its pro-cancer effect by directly promoting tumor cell proliferation. However, in various mouse tumor models (orthotopic liver cancer, subcutaneous liver cancer, lung cancer, and colorectal cancer), SLC1A4 knockout in tumor cells significantly inhibited tumor growth and metastasis and reduced liver damage. This anti-tumor effect is entirely dependent on CD8. + The presence of T cells. Mechanistic studies have confirmed that tumor cells take up large amounts of serine from the microenvironment through SLC1A4, leading to a decrease in serine levels in tumor interstitial fluid and serum, thereby "starving" CD8 cells. + T cells are inhibited, their proliferation and effector functions are suppressed; however, knocking out SLC1A4 can break this nutrient hijacking, restore the PI3K / AKT / mTORC1, MAPK, and NF-κB signaling pathways of T cells, and reactivate anti-tumor immunity. More importantly, this invention achieves significant anti-tumor effects in an orthotopic liver cancer model by delivering SLC1A4-targeting siRNA via nanoparticles. Furthermore, this invention is the first to demonstrate that the combined use of SLC1A4 siRNA and PD-1 antibody inhibitors has a synergistic effect, further enhancing anti-tumor efficacy in models where PD-1 antibodies or their antigen-binding fragments are ineffective as a single agent. These results validate the feasibility and significant clinical translational value of SLC1A4 as a drug target.

[0055] Beneficial effects Compared with the prior art, the present invention has the following beneficial technical effects: The invention reveals a novel mechanism by which tumor cells hijack serine residues in the microenvironment through SLC1A4 and competitively inhibit the immune escape of T cells, providing a new intervention target for tumor immunotherapy.

[0056] 1. Precise mechanism of action and tumor selectivity: SLC1A4 knockout only affects the immune response in the tumor microenvironment, has no direct effect on tumor cell proliferation, and has no effect on spleen weight or body weight in mice. SLC1A4 knockout significantly increases CD45.2 in the tumor microenvironment. + Immune cells, CD4 + T cells, CD8 + The ratio and absolute number of T cells and NK cells. Functionally, CD4 + T cells and CD8 + The levels of IFNγ, granzyme B, and the activation marker DNAM-1 expressed on T cells were significantly increased; the expression of IFNγ and granzyme B in NK cells was also significantly increased. SLC1A4 knockout significantly enriched activation and cytotoxic pathways in T cell and NK cell subsets, while inhibitory pathways were downregulated; T cell activation markers were upregulated, and exhaustion markers were downregulated. Pro-inflammatory cytokine production pathways in macrophages and dendritic cells were also enhanced. This indicates that SLC1A4 deletion comprehensively remodels the tumor immune microenvironment, and its effects are entirely dependent on CD8+. + T cells have a clear mechanism and solid evidence.

[0057] 2. Implementation of targeted delivery system: SLC1A4 siRNA delivered by nanoparticles can reduce the number of lung metastases from 180 to 30 in an orthotopic liver cancer model, shrink the largest tumor nodule by more than half, and has no toxic side effects such as weight loss, which has great potential for clinical translation.

[0058] 3. Synergistic effect of SLC1A4 combined with immune checkpoint inhibitors: SLC1A4 knockout can enhance CD8 efficacy. + The mechanisms of T cell infiltration and function, and the synergistic reversal of immune resistance by combining SLC1A4 inhibitors with PD-1 antibodies.

[0059] 4. SLC1A4 can be used as a biomarker to predict the efficacy of immunotherapy: detection kits can be prepared to detect the expression level of SLC1A4, thereby predicting the prognosis of cancer patients and the efficacy of immunotherapy. Attached Figure Description

[0060] Figure 1SLC1A4 is expressed in liver cancer tissues and different liver cancer cell lines.

[0061] A: TCGA database analysis of SLC1A4 mRNA levels in liver cancer and normal liver tissues; BD: Immunofluorescence staining and protein expression quantification of liver cancer tissue microarray; E: Correlation between SLC1A4 mRNA levels and overall survival; F: SLC1A4 mRNA expression in different human hepatocellular carcinoma cell lines; G: SLC1A4 protein expression in different human hepatocellular carcinoma cell lines.

[0062] Figure 2 Effects of SLC1A4 knockout on the proliferation, growth, survival, migration, and colony formation of liver cancer cells.

[0063] A: Western blot verification of the SLC1A4 knockout effect; B: Effect of SLC1A4 knockout on HepG2 cell viability; C: Effect of SLC1A4 knockout on Hepa1-6BL cell viability; D: Effect of SLC1A4 knockout on HepG2 cell proliferation; E: Effect of SLC1A4 knockout on the proliferation of Hepa1-6BL cells; F: Effect of SLC1A4 knockout on apoptosis in HepG2 cells; G: Effect of SLC1A4 knockout on apoptosis in Hepa1-6BL cells; H: Effect of SLC1A4 knockout on HepG2 cell migration; I: Effect of SLC1A4 knockout on Hepa1-6BL cell migration; J: Effect of SLC1A4 knockout on the clonogenic ability of HepG2 cells; K: Effect of SLC1A4 knockout on the clonogenic ability of Hepa1-6BL cells.

[0064] Figure 3 :sg Slc1a4 The effects of knocking out SLC1A4 liver cancer cells on the growth, metastasis, and liver damage of in situ liver cancer.

[0065] A: Schematic diagram of in situ hepatocellular carcinoma model construction B: Liver weight C: Liver weight / body weight ratio D: Number of in situ nodules E: Liver images of Hepa1-6BL; F: Serum ALT and AST levels.

[0066] Figure 4 : sgSlc1a4-2The effect of knocking out SLC1A4 liver cancer cells on the growth of in situ liver cancer.

[0067] A: Mouse body weight and liver weight B: Liver weight / body weight ratio C: Hepa1-6BL liver image D: Number of in situ nodules E: Serum ALT; F: Spleen weight; G: Representative image.

[0068] Figure 5 Effects of SLC1A4 knockout on immune cell infiltration and function in orthotopic hepatocellular carcinoma tissue.

[0069] A: CD45.2 in the tumor microenvironment + Cell proportion and number; B: CD4 in the tumor microenvironment + T cell ratio and number; C: CD8 in the tumor microenvironment + T cell proportion and number; D: NK cell proportion and number in the tumor microenvironment; E:CD4 + Flow cytometry quantification of T cell IFNγ, granzyme B and DNAM-1 expression; F: CD8 + Flow cytometry quantification of T cell IFNγ, granzyme B and DNAM-1 expression; G: Flow cytometry quantification of IFNγ and granzyme B expression in NK cells.

[0070] Figure 6 Effects of SLC1A4 knockout on tumor growth and immune cell function in a subcutaneous hepatocellular carcinoma model.

[0071] A: Experimental diagram B: Tumor growth curve C: Tumor weight D: Representative image EG tumor infiltration CD4 + T, CD8 + Expression of IFNγ and granzyme B in T and NK cells.

[0072] Figure 7 The effect of knocking out SLC1A4 in lung cancer cells on lung cancer tumor growth.

[0073] A: Validation of SLC1A4 knockout in 3LL cells B: Tumor growth curve C: Tumor weight and representative images D: Spleen weight

[0074] Figure 8 Knocking out SLC1A4 colorectal cancer cells inhibits tumor growth.

[0075] A: Verification of SLC1A4 knockout in MC38 cells B: Experimental diagram C: Tumor growth curve D: Tumor weight E: Representative image of MC38 tumor; F: Spleen weight; G: Representative image.

[0076] Figure 9 Single-cell RNA sequencing reveals that SLC1A4 knockout remodels the tumor immune microenvironment.

[0077] AC: CD45.2 + Cellular UMAP clustering and marker genes; D: Changes in the proportion of each cell subset; EF: Regrouping and frequency of T cell subsets; GH: Enrichment analysis of the KEGG pathway in T cells and NK cells; IJ: Heatmap and violin plot of differentially expressed genes; K: GSEA analysis of core T cell functional genes.

[0078] Figure 10 Effects of SLC1A4 knockout on macrophages and dendritic cells.

[0079] Analysis of KEGG pathway and differential gene expression in AC macrophages and DCs.

[0080] Figure 11 CD8 + The effect of T cells on the anti-tumor effect of SLC1A4 knockout.

[0081] A: Experimental diagram B: Liver weight C: Size of the largest nodule D: Number of in situ hepatocellular carcinoma nodules E: Lung weight F: Number of lung metastases.

[0082] Figure 12 Effects of SLC1A4 knockout on serine levels in tumor interstitial fluid and serum.

[0083] A: Serine level in tumor interstitial fluid B: Serine level in serum.

[0084] Figure 13 The effect of SLC1A4 hijacking of serine in tumor cells on T cell function.

[0085] A: CD4 + B: T cell proliferation; C: IFNγ expression; D: Experimental diagram D:CD8 + T cell proliferation E: Granulase B expression FG: CD8 + T cell killing function H: Relative abundance of amino acids in TCM; I: Relative abundance of amino acids in cell lysate. J: Absolute concentration of serine in TCM; KM: Supplementing with serine restores T cell proliferation and effector function.

[0086] Figure 14 Knocking out Slc1a4 in tumor cells regulates T cells by activating multiple signaling pathways.

[0087] A: KEGG pathway enrichment in T cells B: PI3K / AKT / mTORC1 pathway protein expression and activation C: Expression and activation of MAPK and NF-κB pathway proteins; D: Effects of PI3K and mTORC1 inhibitors on T cell proliferation.

[0088] Figure 15 IFNγ-STAT1 signaling upregulates SLC1A4 expression in tumor cells.

[0089] A: Effects of different cytokines and LPS on SLC1A4 expression in tumor cells; B: Correlation between STAT1 and SLC1A4 expression in HCC tissues; C: Correlation between STAT2 and SLC1A4 expression in HCC tissues; DE: Effects of IFNγ, spleen cell supernatant, IFNγ antibody and inhibitor on STAT1 phosphorylation and SLC1A4 expression.

[0090] Figure 16 The effect of nanocarrier delivery of siRNA targeting SLC1A4 on the growth and metastasis of hepatocellular carcinoma in situ.

[0091] A: Verification of siRNA knockdown efficiency; B: Mouse liver weight; C: Body weight; D: Liver weight / body weight ratio; E: Size of the largest orthotopic hepatocellular carcinoma nodule. F: Total number of in situ hepatocellular carcinoma nodules; G: Representative liver image. H: Number of lung metastases; I: Representative lung image.

[0092] Figure 17 Synergistic effect of SLC1A4 siRNA combined with PD-1 antibody in drug-resistant liver cancer model.

[0093] A: Schematic diagram of the experimental protocol; B: Liver weight statistics; C: Representative liver images; D: Size of the largest tumor nodule. E: Total number of tumor nodules; FG: Statistics on the number of tumor nodules of different sizes (≥2 mm and <2 mm). Detailed Implementation

[0094] The present invention will be further described in detail below through embodiments, but the scope of protection of the present invention is not limited to these embodiments. Main materials used in the experiments: SLC1A4: Gene ID 6509.

[0095] L-serine was purchased from MCE, anti-CD8β antibody (clone number 53-5.8) and anti-PD-1 antibody (clone number RMP1-14) were purchased from Bio X Cell, and the STAT1 inhibitor fludarabine was purchased from MCE.

[0096] Human hepatocellular carcinoma cells HepG2, Huh7, and SNU-387, mouse lung adenocarcinoma cells 3LL, and mouse colorectal carcinoma cells MC38 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai).

[0097] Wild-type C57BL / 6J mice (6-8 weeks old, female) were purchased from Cyagen. Liver cancer tissue microarrays were purchased from Shanghai ChipSuper Biotechnology Co., Ltd.

[0098] Example 1: SLC1A4 is highly expressed in liver cancer and is significantly associated with poor prognosis. TCGA data analysis showed that the SLC1A4 mRNA level in liver cancer tissue was significantly higher than that in normal liver tissue. Figure 1 A).

[0099] Immunofluorescence staining was performed on microarrays containing 90 hepatocellular carcinoma tissues and 90 paired adjacent normal tissues. The results showed that the SLC1A4 protein level in hepatocellular carcinoma tissues was significantly higher than that in normal liver tissues. Figure 1 BD).

[0100] Kaplan-Meier survival analysis showed that patients with high SLC1A4 expression had significantly shorter overall survival than those with low expression. Figure 1 E). Human liver cancer cell lines SNU-387, Huh7, and HepG2 all extensively express SLC1A4 (E). Figure 1 FG).

[0101] Example 2: Effects of SLC1A4 knockout on hepatocellular carcinoma cell proliferation, apoptosis, and migration Using CRISPR / Cas9 technology, the following methods are employed: Homo sgSLC1A4, Homo sgSLC1A4 -2 、 Homo sgSLC1A4 -3 knockout of SLC1A4 in HepG2 and Hepa1-6BL cells.

[0102] Mouse sgSlc1a4、 Mouse sgSlc1a4-2 SLC1A4 was knocked out in Hepa1-6BL cells.

[0103] The specific experimental steps are as follows: 1. Recombinant sgRNA into the pX458 CRISPR vector.

[0104] 2. It was effectively transfected into HepG2 or Hepa1-6BL tumor cells via liposome transfection.

[0105] 3. Using GFP (green fluorescent protein) on the CRISPR vector, effectively transfected positive cells were sorted by flow cytometry.

[0106] 4. After scaling up the culture, perform a Western blot to verify whether the target protein has been successfully knocked out. Western blot confirms successful knockout. Figure 2 A) indicates that these sequences can effectively knock out SLC1A4.

[0107] The proliferation, apoptosis, migration, and colony formation abilities of SLC1A4-knockout tumor cells were examined using standard experimental methods. The results are shown in [Figure number missing]. Figure 2 BK.

[0108] Experimental results showed that CCK-8, cell counting (proliferation), Annexin V apoptosis, scratch healing, and colony formation experiments consistently demonstrated that SLC1A4 knockout did not affect the cell viability, proliferation, apoptosis, migration, and colony formation ability of HepG2 and Hepa1-6BL tumor cells. In other words, SLC1A4 deficiency does not affect the viability, proliferation, apoptosis, migration, and colony formation ability of tumor cells.

[0109] Example 3: Effects of SLC1A4 knockout on hepatocellular carcinoma growth and liver damage according to Figure 3 Method A involves injecting Hepa1-6BL-control and Hepa1-6BL-Slc1a4 KO cells obtained in Example 2 into wild-type mice via high-pressure tail vein injection (5 × 10⁻⁶ cells per ... 5 An orthotopic hepatocellular carcinoma model was established (n=7). Animals were sacrificed after 21 days. Hepa1-6BL-control was used as the control group, and Hepa1-6BL-Slc1a4 KO was used as the SLC1A4 knockout group. Liver weight, number of orthotopic nodules, liver weight / body weight ratio were recorded in the control and knockout groups, and serum ALT and AST levels were measured in each group.

[0110] Obtaining Hepa1-6BL-control: Control cells were prepared by recombining control sgRNA into the PX458 plasmid and then transfecting Hepa1-6BL tumor cells.

[0111] Control sgRNA sequences: forward oligo (5′→3′): CACCGACGGAGGCTAAGCGTCGCAA (SEQ ID No. 17), reverse oligo (5′→3′): AAACTTGCGACGCTTAGCCTCCGTC (SEQ ID No. 18).

[0112] The results showed that the SLC1A4 knockout group ( sgSlc1a4 The liver weight and liver weight / body weight ratio were approximately the same as those of the control group. sgControl The number of in situ hepatocellular carcinoma nodules decreased to about 1 / 2, and the number of nodules larger than 2 mm and smaller than 2 mm both decreased significantly; serum ALT levels decreased to about 1 / 4, and AST levels decreased to about 1 / 2. Figure 3 ).

[0113] The results showed that SLC1A4 knockout in liver cancer cells significantly inhibited the growth of in situ liver cancer and reduced liver damage. Therefore, SLC1A4 can serve as a target for both tumor immunotherapy and liver injury treatment.

[0114] Example 4: Using a Mouse sgSlc1a4- 2. Effects of SLC1A4 knockout on the growth of hepatocellular carcinoma and liver injury Following the method in Example 2, using a Mouse sgSlc1a4-2 Hepa1-6BL-Slc1a4-2 KO cells were constructed, and an orthotopic liver cancer model was established according to the method in Example 3. The results were then investigated. sgSlc1a4-2 The effect of knocking out SLC1A4 liver cancer cells on the growth of in situ liver cancer and liver damage.

[0115] The results showed that, compared to the control group ( sgControl SLC1A4 knockout group ( sgSlc1a4-2 The liver weight and liver weight / body weight ratio were significantly reduced in ( ) Figure 4 AB), the number of in situ nodules (including nodules >2 mm and <2 mm) was significantly reduced ( Figure 4 D), ALT levels decreased to 1 / 2 of the control group ( Figure 4 E), while the mouse body weight and spleen weight remained unchanged (E), Figure 4 (A, F). This eliminates off-target effects and confirms SLC1A4 as a reliable target.

[0116] Example 5: SLC1A4 knockout increases immune cell infiltration and effector function in hepatocellular carcinoma. Flow cytometry analysis was performed on Hepa1-6BL-control and Hepa1-6BL-Slc1a4 KO tumor tissues from Example 3. The results showed that Hepa1-6BL-Slc1a4 KO (i.e., the SLC1A4 knockout group) sgSlc1a4 CD45.2 in tumors + Immune cells, CD4 + T, CD8 + The proportion and number of T and NK cells both increased by more than 100%. Figure 5 AD). Functional testing shows that CD4 + IFNγ in T cells + Granulase B + and DNAM-1 + The proportion increased significantly; CD8 + IFNγ in T cells + The ratio doubled, granzyme B + IFNγ + Double positive and DNAM-1 + The proportion increased significantly (DNAM-1) + (Increased nearly 3 times); IFNγ in NK cells + The proportion also increased significantly. Figure 5 EG).

[0117] Example 6: Effects of SLC1A4 knockout on tumor growth and immune cell infiltration in a subcutaneous hepatocellular carcinoma model according to Figure 6 Method A will use 7×10 5 Hepa1-6BL-control and Hepa1-6BL-Slc1a4 KO cells obtained in Example 2 were subcutaneously inoculated into C57BL / 6 mice. Referring to Example 3, the effects of SLC1A4 knockout on tumor growth and immune cell infiltration in a subcutaneous hepatocellular carcinoma model were investigated.

[0118] Experimental results show that the Hepa1-6BL-Slc1a4 KO group (i.e., the SLC1A4 knockout group) sgSlc1a4 Tumor growth was significantly slowed, with an inhibition rate exceeding 50%, and tumor size was significantly reduced. The endpoint tumor weight decreased from approximately 200 mg in the control group to below 100 mg. Figure 6 BD).

[0119] Flow cytometry analysis showed that CD4 in Hepa1-6BL-Slc1a4 KO tumors + T cells IFNγ + The proportion increased by approximately 2 times, granzyme B + The ratio increased by more than 6 times; CD8 + T cells IFNγ + The proportion increased from about 20% to about 50%, granzyme B + Increased 4-fold; NK cell IFNγ+ increased from 10% to 30%, granzyme B + From 2% to 8% Figure 6 EG).

[0120] Example 7: Effect of SLC1A4 knockout on lung cancer tumor growth Referring to the method in Example 2, the mouse was used in 3LL cells via CRISPR / Cas9. sgSlc1a4-2 SLC1A4 was knocked out, and Western blot confirmed the knockout was successful. Figure 7 A), subcutaneous injection of 2×10 5 1 cell. Following the method in Example 3, using 3LL sgControl as the control group, the effect of knocking out SLC1A4 in lung cancer cells on lung cancer cell growth was investigated.

[0121] Obtaining 3LL sgControl: Control sgRNA was recombined into the PX458 plasmid and then transfected into 3LL tumor cells to prepare control cells. The sequence of the control sgRNA was the same as in Example 3.

[0122] The results showed that the Slc1a4-2 KO group (i.e. sgSlc1a4-2 The tumor growth rate in the group was approximately half that of the control group, the tumor weight was halved at the endpoint, and the spleen weight remained unchanged. Figure 7 BD).

[0123] Example 8: Effect of SLC1A4 knockout on colorectal cancer tumor growth

[0124] Referring to the method in Example 2, the mouse was used in MC38 cells via CRISPR / Cas9. sgSlc1a4 SLC1A4 was knocked out, and Western blot confirmed the knockout was successful. Figure 8 A), subcutaneous injection of 5×10 5 Using the method described in Example 3, with MC38 sgControl as the control group, the effect of knocking out colorectal cancer cells SLC1A4 on colorectal cancer tumor growth was investigated.

[0125] Obtaining MC38 sgControl: Control sgRNA was recombined into the PX458 plasmid and then transfected into MC38 tumor cells to prepare control cells. The sequence of the control sgRNA was the same as in Example 3.

[0126] The results showed that the Slc1a4 KO group (i.e. sgSlc1a4 (Group) The tumor growth inhibition rate reached 60%, the tumor weight decreased from about 400 mg to 150 mg, the tumor volume decreased significantly, and the spleen weight remained unchanged. Figure 8 CG).

[0127] Example 9: Single-cell sequencing reveals that SLC1A4 knockout comprehensively remodels the immune microenvironment CD45.2 in tumor tissues of the Hepa1-6BL-control or Hepa1-6BL-Slc1a4 KO orthotopic hepatocellular carcinoma model in Example 3 was sorted. + Cells undergo scRNA-seq ( Figure 9 A). UMAP clusters comprise 10 groups ( Figure 9 BC). In the Slc1a4 KO group, the proportion of macrophages decreased from 42.05% to 38.71%, the proportion of T cells increased from 24.81% to 30.47%, and the proportion of DCs increased (BC). Figure 9 D). T cells were regrouped into 6 subsets, with Slc1a4 KO group CD4 + T, Early activation of CD8 + The ratio of T to Treg increases ( Figure 9 EF). GSEA showed that cell proliferation, activation, and cytotoxicity pathways were significantly enriched in T cells and NK cells of the Slc1a4 KO group, while VEGF signaling and oxidative phosphorylation pathways were downregulated (EF). Figure 9 GH). The Slc1a4 KO group upregulated activator-toxic genes such as Ifng, Cd28, Cd69, Gzma, and Gzmb, and downregulated exhaustion genes such as Tigit, Pdcd1, and Ctla4. Figure 9 IJ). The core gene set for T cell function (type I IFN production, IFNγ response) was enriched in the KO group ( Figure 9 K).

[0128] Single-cell RNA sequencing revealed that Slc1a4 knockout significantly enriched activation and cytotoxic pathways (such as IFNγ response, positive regulation of cell proliferation, and cell-mediated cytotoxicity) in T cells and NK cell subsets, while inhibitory pathways (such as VEGF signaling and oxidative phosphorylation) were downregulated. T cell activation markers (Ifng, Cd28, Cd69, Gzmb, etc.) were upregulated, while exhaustion markers (Tigit, Pdcd1, Ctla4) were downregulated.

[0129] In the Slc1a4 KO group, the production pathways and gene expression of pro-inflammatory cytokines in macrophages and dendritic cells were upregulated, but also enhanced. However, there were no significant changes in antigen processing and presentation markers. Figure 10 ).

[0130] The results above indicate that the loss of SLC1A4 comprehensively reshapes the tumor immune microenvironment, exhibiting characteristics of immune cell infiltration and enhanced immune response.

[0131] Example 10: CD8 + The effect of T cells on tumor growth and metastasis after SLC1A4 knockout according to Figure 11 Method A involves injecting Hepa1-6BL-control and Hepa1-6BL-Slc1a4 KO cells obtained in Example 2 into wild-type mice via high-pressure tail vein injection (5 × 10⁻⁶ cells per ... 5 An orthotopic hepatocellular carcinoma model was established (n=6-7 mice per group). In the Hepa1-6BL orthotopic hepatocellular carcinoma model, a control group (sgControl), a Slc1a4 KO group (sgSlc1a4), an anti-CD8β antibody group (sgControl+α-CD8β), and a combined treatment group (sgSlc1a4+α-CD8β) were set up.

[0132] The anti-CD8β antibody group and the combined treatment group received intraperitoneal injections of 200 μl of PBS solution containing CD8β antibody (100 μg of CD8β antibody) on days 1, 6, 12, and 18 after injection of Hepa1-6BL-control and Hepa1-6BL-Slc1a4KO cells, respectively. On day 21, liver and other tissues were collected to analyze tumor growth and metastasis.

[0133] The results showed that the liver weight, largest nodule size, number of nodules, lung weight, and number of lung metastases in the Slc1a4 KO group were significantly lower than those in the control group; while the combined use of anti-CD8β antibody depleted CD8 + After T cell administration, the tumor-suppressing effect of Slc1a4 KO completely disappeared, and the tumor burden recovered and even exceeded that of the control group. Figure 11 ).

[0134] It is evident that using anti-CD8β antibodies in an orthotopic liver cancer model depletes CD8. + After T cell administration, the inhibitory effect of Slc1a4 knockout on tumor growth and lung metastasis completely disappeared, demonstrating that CD8... + T cells are a necessary and sufficient condition for the anti-tumor effect of Slc1a4 knockout. This further demonstrates that Slc1a4 knockout exerts its anti-tumor effect by improving the tumor immune microenvironment.

[0135] Example 11: Knocking out SLC1A4 in tumor cells effectively increases the concentration of serine in the tumor microenvironment and blood. Tumor interstitial fluid (TIF) and serum were collected from Hepa1-6BL-control and Hepa1-6BL-Slc1a4 KO orthotopic hepatocellular carcinoma models, respectively. HPLC-MS / MS analysis showed that the serine concentration in TIF of the Slc1a4 KO group increased from approximately 300 μM to approximately 600 μM, and the serum serine concentration increased from approximately 250 μM to approximately 400 μM. Figure 12 ).

[0136] It is evident that knocking out SLC1A4 can significantly increase the concentration of serine in the tumor microenvironment and even throughout the body.

[0137] Example 12: Tumor cells SLC1A4 competitively inhibit T cell function through serine. CD4+ cells were cultured in conditioned medium (TCM) using Hepa1-6BL-control or Hepa1-6BL-Slc1a4 KO cells obtained in Example 2. + and CD8 + T cells were investigated to assess their impact on T cell function. Flow cytometry sorted CD4 and CD8 T cells, and then labeled with CellTrace Violet (CTV) staining to monitor cell proliferation. CTV-labeled T cells were cultured in 96-well plates containing TCM (TCM to fresh medium ratio 1:1) pre-coated with anti-CD3 antibody. Anti-CD28 antibody (1 μg / ml) and IL-2 (100 U / ml) were added during culture. After 48 hours of culture, changes in CTV intensity, cell number, expression levels of effector molecules (IFNγ and granzyme B), and tumor cell killing ability in T cells were detected by flow cytometry.

[0138] Experimental results show that Hepa1-6BL-Slc1a4 KO TCM promotes CD4 + T cell proliferation and IFNγ expression Figure 13 AB), enhanced CD8 + T cell proliferation, granzyme B expression, and tumor cell killing ability ( Figure 13 DG).

[0139] Amino acid analysis showed that the concentrations of serine and cysteine ​​in Hepa1-6BL-Control TCM were significantly lower than those in Hepa1-6BL-Slc1a4 KO TCM, while the intracellular concentrations of Hepa1-6BL-Control were higher. Figure 13 HI). The absolute concentration of serine in Hepa1-6BL-Control TCM is lower than the concentration required for optimal T cell function. Figure 13 J). Hepa1-6BL- supplementation with 400 μM serine in Control TCM restored T cell proliferation and IFNγ and granzyme B expression to levels comparable to those in KO TCM. Figure 13 (KM). This demonstrates that tumor cells compete with T cells for serine via SLC1A4.

[0140] Metabolite assays showed that the concentrations of serine and cysteine ​​in the conditioned medium (TCM) of tumor cells expressing SLC1A4 were significantly lower than those in Slc1a4 knockout TCM, while the concentration of intracellular serine was increased, demonstrating that SLC1A4 enables tumor cells to take up large amounts of serine from the microenvironment.

[0141] In vitro functional experiments showed that Slc1a4 knockout of TCM can enhance CD4 + T and CD8 + T cell proliferation and expression of effector molecules (IFNγ, granzyme B), and enhanced CD8 expression. + The ability of T cells to kill tumor cells was demonstrated. Supplementing the control TCM with 400 μM serine completely restored T cell proliferation and effector function, achieving the effect of Slc1a4 knockout TCM. This directly confirms that tumor cells compete with T cells for serine through SLC1A4, depriving T cells of nutrition.

[0142] Example 13: Serine activates T cells through pathways such as PI3K / AKT / mTORC1. scRNA-seq showed that the PI3K / AKT / mTORC1 pathway was enriched in Hepa1-6BL-Slc1a4 KO group T cells. Figure 14 A), activation of these signaling pathways is crucial for T cell proliferation and function. Western blot confirmed that serine supplementation with Hepa1-6BL-Slc1a4 KO TCM or Hepa1-6BL-Control TCM increased the levels of p-AKT, p-S6 (downstream of mTORC1), p-MAPK, and p-NF-κB. Figure 14 (BC). The PI3K inhibitor TG100713 blocked p-S6 upregulation, and the mTORC1 inhibitor rapamycin inhibited serine-mediated T cell proliferation enhancement. This indicates that serine supports T cell function by activating the PI3K / AKT / mTORC1, MAPK, and NF-κB pathways.

[0143] Example 14: IFNγ-STAT1 signaling upregulates SLC1A4 expression in tumor cells Cytokine screening showed that IFNγ significantly upregulated STAT1 phosphorylation and SLC1A4 expression in Hepa1-6BL cells, and this upregulation was mediated by STAT1 phosphorylation. Figure 15 A). In HCC tissues, STAT1 / STAT2 expression is positively correlated with SLC1A4 expression ( Figure 15(BC). Splenic cell supernatant can mimic the IFNγ effect. The use of the STAT1 inhibitor fludarabine completely blocked IFNγ or spleen cell supernatant-induced SLC1A4 expression, indicating that IFNγ in the tumor microenvironment upregulates SLC1A4 through the STAT1 signaling pathway, forming a positive feedback loop of immune escape. Figure 15 D). Prove that IFNγ in the TME is upregulated by the STAT1 signal to express SLC1A4.

[0144] Example 15: SLC1A4-targeting siRNA nanomedicine effectively inhibits liver cancer growth and metastasis. Design and synthesize the siRNAs for mouse Slc1a4 (Mouse Slc1a4 siRNA) or human Slc1a4 (Homo SLC1A4 siRNA) listed in Table 1.

[0145] CDS sequences of the human and mouse SLC1A4 genes were obtained. For each sequence, 21–23 nucleotide double-stranded siRNAs were designed, following conventional rules such as a GC content of 30%–55%, avoiding consecutive poly-G / C or A / U sequences and inverted repeat sequences, and prioritizing sequences starting with AA. Candidate sequences were specifically validated using NCBI BLAST alignment to ensure complete matching with the target gene and no homology of more than 17 consecutive nucleotides with other genes, thus reducing off-target effects. A negative control (Scramble siRNA) was also designed. The validated siRNA sense and antisense strands were synthesized using a solid-phase phosphorusamide method, with optional chemical modifications such as 2′-O-methyl or thiophosphate to enhance stability. The purified single strands were mixed in equimolar ratios, annealed to form double strands, and purified by HPLC to obtain a product with a purity ≥90%. Molecular weight and concentration were identified by mass spectrometry and ultraviolet spectrophotometry.

[0146] In vitro transfection with siRNA targeting mouse Slc1a4 effectively reduced SLC1A4 mRNA levels. Figure 16 A).

[0147] Mouse Slc1a4 siRNA or negative control control siRNA dry powder (1 OD = 2.5 nmol) was diluted with a small amount of DEPC water to an appropriate concentration to form the inner aqueous phase. The concentration of Slc1a4 siRNA or control siRNA in the inner aqueous phase was 1 mg / mL.

[0148] The PLGA-PEG copolymer (Slc1a4 siRNA or Control siRNA to copolymer mass ratio of 1:20) was dissolved in dichloromethane as the oil phase (PLGA-PEG copolymer concentration of 15 mg / mL).

[0149] The aqueous phase was added dropwise to the oil phase, and the emulsion was formed by ultrasonic emulsification using a 50W probe (W / O).

[0150] The colostrum was then rapidly injected into an aqueous phase containing polyvinyl alcohol (PVA) (PVA concentration of 1%), and ultrasonically emulsified again to form a double emulsion (W / O / W). The resulting emulsion was then used to remove the organic solvent using a rotary evaporator, and the nanoparticle suspension was concentrated to obtain a nanomaterial suspension encapsulated with siRNA. The prepared nanoparticle suspension had a particle size of approximately 120-150 nm.

[0151] It was prepared using PBS into a nanosuspension containing 8 μg of Slc1a4 siRNA per 200 μL volume, i.e., Slc1a4siRNA@np, for in vivo injection. Simultaneously, a nanosuspension containing 8 μg of Control siRNA per 200 μL volume was prepared, i.e., Control siRNA@np.

[0152] The forward sequence (5'-3') of the negative control siRNA is UUCUCCGAACGUGUCACGUTT (SEQ ID No. 19). The reverse sequence (5'-3') is ACGUGACACGUUCGGAGAATT (SEQ ID No. 20).

[0153] An orthotopic hepatocellular carcinoma model was established using hydrodynamic tail vein injection: Hepa1-6BL tumor cells were resuspended in serum-free and antibiotic-free RPMI 1640 medium to prepare a tumor cell suspension. Each mouse was injected with 1.5 mL of the tumor cell suspension (containing 2 × 10⁻⁶ cells / mL). 5 SLC1A4 siRNA@np (200 μL / mouse, containing 8 μg siRNA) was rapidly injected into mice via the tail vein within 8 seconds. On day 10 post-inoculation, tumor-targeting siRNA@np (200 μL / mouse, containing 8 μg siRNA) was injected via the tail vein to silence the tumor gene in vivo. By day 20, results showed that the SLC1A4 siRNA@np group had significantly reduced liver weight and liver weight / body weight ratio, the largest tumor nodule shrank from 15 mm to 6 mm, the total number of nodules was significantly reduced, and the number of lung metastases decreased from an average of 180 to 30. Mouse body weight was unaffected. Figure 16 (BI). This demonstrates that the nanomedicine is highly effective and safe, validating the great potential of SLC1A4 as a druggable target.

[0154] Example 16: Synergistic effect of SLC1A4 siRNA combined with PD-1 antibody in a drug-resistant liver cancer model like Figure 17 As shown in Figure A, an orthotopic hepatocellular carcinoma model (Hepa1-6BL cells, 2×10⁻⁶ cells) was established in WT mice using a hydrodynamic tail vein injection method. 6 1.5 mL injected per mouse over 8 seconds. On day 11 after model establishment, mice were randomly divided into four groups (n=7 per group): (A) Control group (on day 11, each animal was injected via tail vein with 200 μL of Control siRNA@np from Example 15, containing 8 μg of Control siRNA). (B) PD-1 antibody monotherapy group (200 μL / animal PD-1 antibody PBS solution containing 100 μg PD-1 antibody was injected intraperitoneally every 3 days, i.e., once on days 11, 14 and 17). (C) SLC1A4 siRNA@np monotherapy group (on day 11, Slc1a4 siRNA@np from Example 15 was injected via tail vein, 200 μL / animal, containing 8 μg siRNA); (D) Combination therapy group (PD-1 antibody + SLC1A4 siRNA@np, administration time and dosage are the same as the monotherapy group).

[0155] Mice were sacrificed on day 19, and tumor burden in each group was analyzed. Results are as follows: Figure 17 As shown in BG: In this model, the PD-1 antibody monotherapy group had no significant effect on the burden of in situ hepatocellular carcinoma, confirming that the model is a PD-1 antibody resistance model.

[0156] The SLC1A4 siRNA@np monotherapy group effectively inhibited the growth of in situ hepatocellular carcinoma, specifically manifested as a reduction in liver weight, a significant reduction in the largest hepatocellular carcinoma nodule, and a general decrease in the total number of hepatocellular carcinoma nodules and the number of nodules of each size and grade, especially the number of hepatocellular carcinoma nodules ≥2 mm was significantly lower than that in the control group.

[0157] More importantly, the combination treatment group of PD-1 antibody and SLC1A4 siRNA@np showed a significant synergistic anti-tumor effect: (a) the total weight of the liver burdened with in situ hepatocellular carcinoma was closer to the level of normal liver without tumor (about 2 grams); (b) the size of the largest hepatocellular carcinoma nodule was reduced to about 1 / 3 of that in the control group, while the single treatment group was reduced to about 1 / 2 of that in the control group; (c) the total number of hepatocellular carcinoma nodules was reduced to about half of that in the control group; (d) the total number of hepatocellular carcinoma nodules ≥2 mm was reduced to about 1 / 3 of that in the control group.

[0158] The results showed that PD-1 had little effect on the above indicators. However, when PD-1 antibody was combined with SLC1A4 siRNA@np, the effects on each indicator were not only better than those of SLC1A4 siRNA@np or PD-1 alone, but also better than the sum of the effects of the two treatments alone. The combination produced a synergistic effect.

[0159] Therefore, for PD-1 antibody-resistant hepatocellular carcinoma in situ models, siRNA@np targeting SLC1A4 can effectively overcome PD-1 antibody resistance. This means that siRNA@np targeting SLC1A4 exhibits a significant synergistic effect with immune checkpoint inhibitors, providing a novel combination therapy strategy for patients resistant to clinical immunotherapy.

Claims

1. Application of SLC1A4 as an immunotherapy target in the preparation of antitumor drugs.

2. Application of SLC1A4 as an immunotherapy target in the development, design, and screening of antitumor drugs.

3. Application of SLC1A4 inhibitors in the preparation of antitumor drugs.

4. The application according to any one of claims 1-3, characterized in that, The tumor is a tumor that highly expresses SLC1A4, preferably liver cancer, colorectal cancer, lung cancer, melanoma, or breast cancer.

5. The application according to claim 3, characterized in that, The antitumor drug is one or more of the following: small molecule inhibitors targeting SLC1A4 that can reduce SLC1A4 expression or block its amino acid transport activity, siRNA, shRNA, antisense oligonucleotides, monoclonal antibodies, bispecific antibodies, nanobodies, aptamers, and CRISPR / Cas9 gene editing reagents.

6. An SLC1A4 inhibitor, characterized in that, The SLC1A4 inhibitor is selected from sequences with SEQ ID No. 1-8 at the forward 5'-3' end and SEQ ID No. 9-16 at the reverse 5'-3' end, or their modified forms, and is selected from any of the following genes: 。 7. The application according to any one of claims 1-5, characterized in that, The drug works by blocking the uptake of serine from the tumor microenvironment by tumor cells, thereby relieving SLC1A4-mediated inhibition of CD8 in the tumor microenvironment. + Nutritional suppression of T cells enhances the anti-tumor immune response.

8. An enhanced CD8 + Methods for T cell proliferation, granzyme B expression, and tumor killing ability, the methods including knocking out SLC1A4 in tumor cells and culturing T cells in a conditioned medium, wherein the conditioned medium is TCM medium.

9. Application of reagents for detecting SLC1A4 in the preparation of products for immunotherapy efficacy or screening of suitable populations.

10. A tumor immunotherapy composition, characterized in that, It includes SLC1A4 inhibitors and immune checkpoint inhibitors.

11. The tumor immunotherapy composition of claim 10, characterized in that, The immune checkpoint inhibitor is one or more of PD-1 inhibitors, PD-L1 inhibitors, or CTLA-4 inhibitors; preferably, the PD-1 inhibitor is an anti-PD-1 monoclonal antibody, and the SLC1A4 inhibitor is one or more of the following, or their nanoparticle delivery systems, including small molecule inhibitors targeting SLC1A4, siRNA, shRNA, antisense oligonucleotides, monoclonal antibodies, bispecific antibodies, nanobodies, aptamers, and CRISPR / Cas9 gene editing reagents. The mass ratio of the immune checkpoint inhibitor to the SLC1A4 inhibitor is 1:10-100, preferably 1:10-50.

12. The tumor immunotherapy composition of claim 11, characterized in that, The aforementioned nano-drug delivery system is a liposome, nanoparticle, or nanosuspension containing an SLC1A4 inhibitor, preferably a nanosuspension containing an SLC1A4 inhibitor and a PLGA-PEG copolymer.

13. The use of the tumor immunotherapy composition according to any one of claims 10-12 in the preparation of an antitumor drug, wherein the tumor is preferably a solid tumor that is unresponsive to or resistant to treatment with immune checkpoint inhibitors alone, or has poor efficacy.

14. Application of SLC1A4 inhibitors in the preparation of sensitizers or potentiators to enhance the treatment of liver cancer with PD-1 inhibitors.

15. Application of SLC1A4 inhibitors in combination with immune checkpoint inhibitors in the preparation of antitumor drugs.

16. The application according to claim 15, characterized in that, The immune checkpoint inhibitor is one or more of PD-1 inhibitors, PD-L1 inhibitors, or CTLA-4 inhibitors; preferably, the PD-1 inhibitor is an anti-PD-1 monoclonal antibody, and the SLC1A4 inhibitor is one or more of the following: small molecule inhibitors targeting SLC1A4, siRNA, shRNA, antisense oligonucleotides, monoclonal antibodies, bispecific antibodies, nanobodies, aptamers, CRISPR / Cas9 gene editing reagents, or their lipid nanoparticles; the dose ratio of the immune checkpoint inhibitor to the SLC1A4 inhibitor is 1:10-100, preferably 1:10-50.

Images