Use of smoc-1 in the preparation of a medicament for preventing and / or treating heart rupture

Abstract

The application relates to the field of biological medicine, and discloses application of SMOC-1 and / or an agonist of SMOC-1 in preparation of a medicine for preventing and / or treating heart rupture. The application provides a product of a novel biomarker capable of serving as an early heart rupture treatment target after acute myocardial infarction, and the biomarker is SMOC-1 protein. The application finds for the first time through plasma proteomics that, compared with patients with acute myocardial infarction without heart rupture, the expression of SMOC-1 in plasma of patients with acute myocardial infarction with heart rupture is significantly increased. Further sample quantity verification is carried out, and it is confirmed that the expression of plasma SMOC-1 in patients with acute myocardial infarction with heart rupture is significantly increased.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically to the use of SMOC-1 in the preparation of medicaments for the prevention and / or treatment of cardiac rupture. Background Technology

[0002] The "China Cardiovascular Health and Disease Report 2024" indicates that cardiovascular disease (CVD) remains the leading cause of death among urban and rural residents in my country, with the mortality rate from acute myocardial infarction (AMI) showing an overall upward trend. Currently, clinical identification of cardiac rupture mainly relies on clinical symptoms (such as sudden hypotension and cardiac tamponade) and imaging examinations, lacking effective early prediction and intervention methods. Existing myocardial injury markers (such as cardiac troponin) are used for AMI diagnosis, but they cannot predict cardiac rupture and lack therapeutic target value. Furthermore, the occurrence of cardiac rupture is closely related to the myocardial repair process, especially insufficient reparative fibrosis, which is considered one of the important mechanisms. Therefore, there is an urgent need to find a key molecule that can both predict the risk of cardiac rupture and directly participate in the myocardial repair process, serving as an intervention target. Summary of the Invention

[0003] This invention provides the use of SMOC-1 in the preparation of medicaments for the prevention and / or treatment of cardiac rupture, in order to address the problem of the lack of key molecules that can both predict the risk of cardiac rupture and directly participate in the myocardial repair process and serve as intervention targets.

[0004] In a first aspect, the present invention provides the use of SMOC-1 and / or SMOC-1 agonists in the preparation of medicaments for the prevention and / or treatment of cardiac rupture.

[0005] In one alternative implementation, the cardiac rupture includes cardiac rupture associated with acute myocardial infarction.

[0006] In one alternative implementation, the SMOC-1 prevents and / or treats acute myocardial infarction-related cardiac rupture by reducing the incidence of cardiac rupture following acute myocardial infarction.

[0007] In one alternative implementation, the SMOC-1 prevents and / or treats acute myocardial infarction-related cardiac rupture by increasing the area of ​​early myocardial fibrosis following acute myocardial infarction.

[0008] In one alternative implementation, the SMOC-1 increases the area of ​​early myocardial fibrosis after acute myocardial infarction by promoting cardiac fibroblast activation, promoting collagen secretion, and / or activating the Smad pathway.

[0009] In one alternative implementation, the promotion of cardiac fibroblast activation includes enhancing α Expression levels of smooth muscle actin.

[0010] In one alternative embodiment, promoting collagen secretion includes promoting the secretion of type I and type III collagen.

[0011] In one alternative implementation, the activation of the Smad pathway includes enhancing TGF-βR1 activation and improving the stability of the TGF-βR1 / 2 receptor complex.

[0012] In one alternative implementation, the SMOC-1 agonist comprises a viral vector overexpressing SMOC-1.

[0013] In one alternative implementation, the viral vector includes an adenovirus vector.

[0014] Secondly, the present invention also provides the use of products for detecting SMOC-1 expression levels in the prevention and / or treatment of cardiac rupture.

[0015] In one alternative implementation, the cardiac rupture includes cardiac rupture associated with acute myocardial infarction.

[0016] In one alternative implementation, the SMOC-1 expression level includes protein and / or mRNA levels.

[0017] In one alternative implementation, the product includes a kit, test strip, reagent, primer, biochip, or probe.

[0018] In one alternative implementation, the kit includes an ELISA detection kit.

[0019] In one alternative implementation, the product sample to be tested includes at least one of plasma, serum, cells, animal tissue, and cell culture supernatant.

[0020] The technical solution of this invention has the following advantages: This invention provides the use of SMOC-1 and / or SMOC-1 agonists in the preparation of medicaments for the prevention and / or treatment of cardiac rupture. This invention also provides a product containing a novel biomarker that can serve as a therapeutic target for early cardiac rupture following acute myocardial infarction, wherein the biomarker is SMOC-1 protein. This invention, through plasma proteomics, for the first time discovered that SMOC-1 expression in the plasma of patients with acute myocardial infarction and cardiac rupture was significantly upregulated compared to patients with acute myocardial infarction without cardiac rupture. Further validation with a larger sample size confirmed that plasma SMOC-1 expression was significantly elevated in patients with acute myocardial infarction and cardiac rupture.

[0021] Primary cardiomyocytes and primary cardiac fibroblasts were extracted from adult wild-type mice at different time points after myocardial infarction using an in vitro heart perfusion method. RT-qPCR analysis revealed that SMOC-1 mainly originated from primary cardiomyocytes in the early stage of acute myocardial infarction. Acute myocardial infarction models were established using SMOC-1 overexpression mice and cardiomyocyte-specific SMOC-1 knockout mice. SMOC-1 overexpression significantly reduced the incidence of cardiac rupture after acute myocardial infarction, while cardiomyocyte-specific SMOC-1 knockout significantly increased the incidence of cardiac rupture. Masson staining analysis showed that SMOC-1 overexpression significantly increased the area of ​​early myocardial fibrosis after acute myocardial infarction, while cardiomyocyte-specific SMOC-1 knockout significantly reduced the fibrosis area. Immunohistochemical staining and Western blot results showed that SMOC-1 overexpression could enhance fibrosis repair after acute myocardial infarction by promoting cardiac fibroblast activation, collagen secretion, and Smad pathway expression; while cardiomyocyte-specific SMOC-1 knockout weakened fibrosis repair by reducing cardiac fibroblast activation, collagen secretion, and Smad pathway expression.

[0022] Stimulation of primary cardiac fibroblasts with different concentrations of recombinant SMOC-1 protein also revealed that recombinant SMOC-1 protein affected Smad pathway expression in a dose-dependent manner. Immunoprecipitation experiments further confirmed that SMOC-1 derived from primary cardiomyocytes interacts with TGF-βR1 and EPRS on primary cardiac fibroblasts through paracrine effects. Further experiments demonstrated that SMOC-1 does not alter TGF-βR1 stability, but mainly plays a role in the interaction between TGF-βR1 and EPRS by enhancing TGF-βR1 activation and increasing the stability of the TGF-βR1 / 2 receptor complex. These results indicate that SMOC-1 can promote myocardial repair fibrosis through the TGF-βR1 / EPRS / Smad signaling pathway, thereby exerting an anti-cardiac rupture effect. Therefore, these results suggest that SMOC-1 may serve as a novel biomarker for the treatment of early cardiac rupture after acute myocardial infarction. Attached Figure Description

[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 This is the result of plasma proteomics detection of SMOC-1 expression in the plasma of patients with cardiac rupture in this embodiment of the invention; Figure 2 This is the result of ELISA detection of SMOC-1 expression in the plasma of patients with cardiac rupture in this embodiment of the invention; Figure 3 This embodiment of the invention describes the RT-qPCR detection of SMOC-1 expression in primary cardiomyocytes and primary cardiac fibroblasts during the early stage of acute myocardial infarction in adult wild-type mice; CM represents primary cardiomyocytes and CF represents primary cardiac fibroblasts. Figure 4 This invention describes the incidence of cardiac rupture after acute myocardial infarction in SMOC-1 overexpressing mice (A) and cardiomyocyte-specific SMOC-1 knockout mice (B) as observed in this embodiment of the invention. Figure 5 In this embodiment of the invention, the area of ​​myocardial fibrosis in the early stage of acute myocardial infarction was analyzed by masson staining in SMOC-1 overexpressing mice (AB) and cardiomyocyte-specific SMOC-1 knockout mice (CD). Figure 6 This invention relates to an example of immunohistochemical staining analysis of Col 1 and Col 3 expression in SMOC-1 overexpressing mice during the early stage of acute myocardial infarction; (A) Immunofluorescence image; (B) Quantitative image of Col 1; (C) Quantitative image of Col 3; Figure 7 This invention relates to an example of immunohistochemical staining analysis of the expression of Col 1 and Col 3 in cardiomyocyte-specific SMOC-1 knockout mice during the early stage of acute myocardial infarction; (A) Immunofluorescence image; (B) Quantitative image of Col 1; (C) Quantitative image of Col 3; Figure 8 In this embodiment of the invention, Western blot analysis was performed to detect and analyze the expression of α-SMA in SMOC-1 overexpressing mice during the early stage of acute myocardial infarction. Figure 9 In this embodiment of the invention, Western blot analysis was performed to detect and analyze the expression of the Smad pathway in SMOC-1 overexpressing mice during the early stage of acute myocardial infarction. Figure 10 In this embodiment of the invention, Western blot was used to detect and analyze the expression of α-SMA in cardiomyocyte-specific SMOC-1 knockout mice during the early stage of acute myocardial infarction. Figure 11 In this embodiment of the invention, Western blot was used to detect and analyze the expression of the Smad pathway in cardiomyocyte-specific SMOC-1 knockout mice during the early stage of acute myocardial infarction. Figure 12 In this embodiment of the invention, Western blot was used to detect and analyze the expression of the Smad pathway in primary cardiac fibroblasts after stimulation with different concentrations of recombinant SMOC-1 protein. Figure 13 The results of immunoprecipitation analysis in this embodiment of the invention show the interaction between SMOC-1 derived from primary cardiomyocytes and TGF-βR1 and EPRS on primary cardiac fibroblasts. Figure 14 In this embodiment of the invention, Western blot was used to detect and analyze the stability and activation level of TGF-βR1 after recombinant SMOC-1 protein stimulated primary cardiac fibroblasts, and immunoprecipitation was used to analyze the stability of the TGF-βR1 / 2 receptor complex. Detailed Implementation

[0025] The following embodiments are provided to better understand the present invention, but the following embodiments do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the scope of protection of the present invention.

[0026] Unless otherwise specified, all experimental steps or conditions in the examples were performed according to conventional experimental procedures and conditions in the art. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0027] Example 1. Experimental subjects This embodiment is to test the therapeutic target value of stromal cell protein SMOC-1 in early cardiac rupture after acute myocardial infarction. Two populations, animals and cells were used for testing: (1) Population 1: This population included 9 patients with acute myocardial infarction complicated with cardiac rupture and 9 patients with acute myocardial infarction without cardiac rupture. The diagnostic criteria for cardiac rupture (meeting at least one of the following evidence): ① cardiac rupture confirmed by autopsy or surgery; ② cardiac rupture confirmed by echocardiography, right heart catheterization and ventriculography; ③ no history of heart failure, cardiac arrest caused by electromechanical dissociation, and pericardial hematoma confirmed by echocardiography; ④ persistent hypotension, pericardial effusion confirmed by echocardiography (pericardial effusion ≥10mm with right atrial compression) and bloody pericardial effusion by pericardiocentesis. (2) Population 2: This population included 20 patients with acute myocardial infarction complicated with cardiac rupture and 20 patients with acute myocardial infarction without cardiac rupture. All of the above cases were patients who visited Beijing Anzhen Hospital affiliated to Capital Medical University. (3) Animals: Acute myocardial infarction models were established using C57BL / 6J wild-type mice, SMOC-1 overexpressing mice, and cardiomyocyte-specific SMOC-1 knockout mice. (4) Cells: Primary cardiomyocytes and primary cardiac fibroblasts were extracted from the hearts of C57BL / 6J wild-type mice (Beijing Huafukang Biotechnology Co., Ltd.) and 1-3 day old SD suckling mice (Beijing Huafukang Biotechnology Co., Ltd.).

[0028] 2. Experimental Methods (1) Proteomics: Venous blood was collected from enrolled patients, placed in EDTA anticoagulant tubes, centrifuged within 30 min, and plasma was separated and stored at -80 ℃ for later use. Quantitative proteomics analysis using iTRAQ was performed on the plasma samples. The proteomics analysis was performed by Shanghai Zhongke New Life Biotechnology Co., Ltd. Differentially expressed proteins between the two groups were screened based on a fold change of more than 1.2-fold (upregulation greater than 1.2-fold or downregulation less than 0.83-fold) and P < 0.005.

[0029] (2) ELISA: The Human SMOC-1 ELISA Kit (CSB-EL021842HU, CUSABIO) was used to detect the expression level of SMOC-1 in human plasma samples according to the kit instructions. The specific operating steps are as follows: 1) Remove the required strips from the aluminum foil bag after equilibration at room temperature for 60 min, and seal the remaining strips in a self-sealing bag and return them to 4 ℃; 2) Set up standard wells, blank wells, and sample wells, adding 50 μL of different concentrations of standard to each standard well; 3) Add 50 μL of the sample to be tested to the sample well, and add 50 μL of sample diluent to the blank well; 4) Add 100 μL of horseradish peroxidase (HRP)-labeled detection antibody to each of the blank wells, standard wells, and sample wells, seal the reaction wells with sealing film, and incubate at 37 ℃ for 60 min; 5) Discard the liquid, pat dry on absorbent paper, fill each well with washing buffer (350 μL), let stand for 1 min, shake off the washing buffer, pat dry on absorbent paper, and repeat 5 times; 6) Add 50 μL each of substrate A and B to each well, and incubate at 37 ℃ in the dark for 15 min; 7) Add 50 μL of stop solution to each well, and incubate at 450 ℃ for 15 min. The OD value of each well was measured at a wavelength of nm. A standard curve was plotted based on the OD values ​​of the blank and standard wells, and the concentration of SMOC-1 protein in the plasma sample was obtained using the standard curve. Each sample was tested in triplicate.

[0030] (3) Construction of SMOC-1 overexpression mice: AAV9-SMOC-1 carrying the SMOC-1 gene (NM_001146217.1) and AAV9 carrying the control gene (AAV9-NC) were both generated and provided by Shandong Weizhen Biotechnology Co., Ltd. The viral vector used in the experiment was constructed based on the pAV-CMV-C-3Flag plasmid. The specific construction strategy is as follows: 1) Obtaining the target gene: Using the mouse (Mus musculus) genome as a template, the target gene fragment (synthesized by Shandong Weizhen Biotechnology Co., Ltd.) was obtained by whole-genome synthesis based on the full-length coding sequence (CDS) of NCBI Reference Sequence NM_001146217.1 (gene name: Smoc-1, gene size: 1392 bp). 2) Construction of recombinant expression vector: The adeno-associated virus packaging vector pAV-CMV-C-3Flag (commercially available) was selected. This vector carries the CMV promoter, which is used to drive the efficient expression of the target gene in the host cell. ① Restriction restriction sites: The vector backbone was double-digested using restriction endonucleases AsiSI and MluI, and the linearized vector was recovered. ② Fragment addition and modification: A Kozak co-recognition sequence (GCCACC) was added upstream of the start codon (ATG) to the synthesized target gene fragment to improve eukaryotic translation efficiency; a 3×Flag tag sequence was fused to the C-terminus of the target gene (before the stop codon) to facilitate subsequent protein detection. ③ Ligation and transformation: The Smoc-1 gene fragment with the Kozak sequence and 3×Flag tag (with AsiSI and MluI sticky ends at both ends, respectively) was cloned into the linearized pAV-CMV-C-3Flag vector using T4 DNA ligase. The ligation product was transformed into competent E. coli (e.g., DH5α) cells, plated on LB plates containing ampicillin (Amp, final concentration 100 μg / mL), and positive clones were screened. ④ Sequencing verification: Positive clones were identified by PCR and verified by first-generation sequencing (using 5' sequencing primer: CGCAATGGGCGGTAGGCGTG (SEQ ID NO.1); 3' sequencing primer: CTCTACAAATGTGGTATGGC (SEQ ID NO.2). The recombinant plasmid with correct sequencing was named pAV-CMV-Smoc-1-3Flag (i.e., the recombinant vector of AAV9-SMOC-1). ⑤ The inserted fragment sequence is shown in SEQ ID NO.3.3) Packaging and Production of Recombinant AAV9 Virus: Virus packaging was performed in HEK293 cells using a three-plasmid co-transfection system: ① Co-transfection plasmids: recombinant expression vector pAV-CMV-Smoc-1-3Flag (carrying the target gene); adeno-associated virus helper plasmid pHelper (commercially available, carrying E2A, E4, and VA genes); and serotype 9 (AAV9) replication and capsid plasmid pAAV-RC9 (commercially available, carrying rep and cap genes). ② Transfection method: The above three plasmids were co-transfected into well-growing HEK293 cells at an equimolar ratio using the calcium phosphate method or the PEI method. ③ Culture and collection: After transfection, cells were cultured at 37°C in a 5% CO2 incubator for 72 hours. Cells and culture supernatant were collected, and cells were lysed by repeated freeze-thaw cycles (-80°C / 37°C alternating 3 times) to release viral particles. Cell debris was removed by centrifugation. 4) Virus purification and concentration: The harvested virus lysate was purified and concentrated using iodixanol density gradient ultracentrifugation or PEG precipitation to remove empty shell viruses and impurity proteins, obtaining high-purity recombinant AAV9 virus. 5) Virus titer determination (qPCR): Physical titer (genomic copy number) was determined using SYBR Green qPCR. ① Sample pretreatment: Removal of free DNA: The viral stock solution was diluted 10-fold with PBS, DNase I (final concentration 1 U / μL) was added, and the mixture was incubated at 37℃ for 30 min, followed by heating at 95℃ for 5 min to inactivate DNase I and digest residual free plasmid DNA. Removal of capsid proteins: Proteinase K (final concentration 0.5 μg / μL) was added, and the mixture was incubated at 37℃ for 30 min, followed by heating at 95℃ for 5 min to inactivate proteinase K and release viral genomic DNA. ② qPCR detection: The treated sample was serially diluted 10-fold, and 2 μL was used as template. Amplification was performed using specific primers targeting the transgenic sequence (such as WPRE or SV40 polyA) on a real-time quantitative PCR instrument (program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 5 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 40 cycles). ③ Titer calculation: A standard curve was plotted using standards with known copy numbers, and the viral genome titer was calculated based on the Ct value of the sample. The physical titer of AAV9-SMOC-1 was found to be no less than 2.33 × 10⁻⁶. 13 vg / mL. 6) Construction of AAV9-NC (negative control virus): The negative control virus (AAV9-NC) was constructed using the same packaging, purification, and titer determination methods. The difference was that it was co-transfected with an empty vector pAV-CMV-C-3Flag (i.e., a "lightless" control virus containing only the CMV promoter and a 3×Flag tag, without the Smoc-1 gene ORF) that did not carry any exogenous gene insert fragments. The physical titer was measured to be 6.01 × 10⁻⁶. 13vg / mL. AAV9-SMOC-1 and AAV9-NC were injected via the tail vein into male C57BL / 6J wild-type mice aged 8–12 weeks and weighing 20–25 g, at a dose of 5 × 10E11 vg per mouse. Mice were fed for 28 days post-injection, and SMOC-1 expression levels were then measured. Subsequent experiments were conducted only after successful SMOC-1 overexpression was confirmed.

[0031] (4) Construction of cardiomyocyte-specific SMOC-1 knockout mice: Cardiomyocyte-specific SMOC-1 knockout C57BL / 6J mice (SMOC-1Flox / FloxMyh6-CreERT2, abbreviated as SMOC-1cKO) and control C57BL / 6J mice (Control) were both generated and provided by Jicui Pharmaceutical Co., Ltd. The SMOC-1 gene has three transcripts. Based on the structure of the SMOC-1 gene, exons 2 to 6 of the SMOC-1-202 transcript (ENSMUST00000110347.8) were selected as the knockout region. This region contains a 517 bp coding sequence, and knocking out this region will lead to the destruction of protein function. The SMOC-1 gene was modified using CRISPR / Cas9 technology. The simplified procedure is as follows: The CRISPR / Cas9 system and the donor were microinjected into the fertilized eggs of C57BL / 6J mice, and then the fertilized eggs were transplanted to obtain positive F0 generation mice, which were identified by PCR and sequencing. Positive F0 generation mice were mated with C57BL / 6J mice to obtain a stable F1 generation mouse model (SMOC-1-Flox mice). SMOC-1-Flox mice were then mated with mice expressing Cre recombinase (Myh6-CreERT2 strain mice) to achieve Flox fragment knockout, thereby causing the target gene to lose function in specific tissues and cell types. Currently, the SMOC-1-Flox strain (T037703) has not been publicly disclosed. The Myh6-CreERT2 strain (T004858) has been widely used in combined experiments with other Flox mice and is a mature and feasible procedure. In this invention, tamoxifen-treated Cre-Flox / Flox mice were used as the control group (labeled "Control"), and tamoxifen-treated Cre+Flox / Flox mice were used as the experimental group (labeled "SMOC-1cKO"). SMOC-1cKO mice and Control mice were littermates. When SMOC-1 cKO and Control mice reached 6–8 weeks of age, SMOC-1 knockout was induced by intraperitoneal injection of tamoxifen (Selleck.cn) every 24 hours for 5 consecutive days at a dose of 80 mg / kg. Mice were monitored for behavior and adverse reactions during the experiment; injections were discontinued if significant adverse reactions occurred. After the last injection, mice were kept under normal conditions for at least 7 days to ensure successful induction before subsequent experiments.

[0032] (5) Establishment of an acute myocardial infarction model: An acute myocardial infarction model was established in C57BL / 6J wild-type mice, SMOC-1 overexpressing mice, and cardiomyocyte-specific SMOC-1 knockout mice by permanently ligating the left anterior descending coronary artery. Before the operation, the tubing of the mouse inhalation gas anesthesia machine was connected in advance, and the connection was checked to ensure it was correct, complete, and leak-free. After confirming that the connection was intact, the sealing cap of the inhalation gas anesthesia machine was opened, and an appropriate amount of isoflurane was slowly injected into the isoflurane vaporizer using a 10 ml syringe. The liquid level on the vaporizer was carefully observed, and the level of the added isoflurane was kept between the two scale lines. After injecting the isoflurane, the sealing cap was closed, the three-way valve was opened, and the vaporizer of the inhalation gas anesthesia machine and the anesthesia induction box were connected. The isoflurane was allowed to evaporate from the tubing into the anesthesia induction box. Then the power switch of the air pump was turned on, the valve was loosened, and the output oxygen flow rate was adjusted to 300-500 ml / min. Next, open the vaporizer valve and turn the adjustment button to adjust the isoflurane and oxygen mixture to the induction concentration (generally 3%–4%). Line the anesthesia induction box with 2–3 layers of paper towels beforehand, and place approximately 5 mice into the box at once to inhale the isoflurane and oxygen mixture. After 4–5 minutes, observe the mice naturally collapse, in a state of complete anesthesia with no unconsciousness or spontaneous activity. Then, adjust the isoflurane and oxygen mixture to the maintenance concentration (generally 1%–2%). Remove the anesthetized mice from the induction box and place them in a supine position with their abdomen facing upwards. Cover the mice's mouth / nose with an anesthesia mask to maintain anesthesia, and secure their limbs to the operating table with 3M medical tape. Turn on the operating light and adjust it to a suitable brightness to maintain a bright surgical field. Under continuous inhalation anesthesia, the surgical area of ​​the mouse's left chest was first disinfected with 75% alcohol. After the alcohol evaporated naturally, the mouse's skin was lifted with forceps in one hand, and an ophthalmic scissor was used in the other hand to make an incision about 1 cm long, obliquely towards the mouse's left upper limb, along the lower edge of the pectoralis major muscle in the fourth intercostal space on the left side of the sternum. A 3-0 suture with a needle was held at the skin incision and passed through the incision skin for subsequent rapid suturing to close the chest cavity. The lower edge of the pectoralis major muscle was lifted with toothless forceps in the left hand, and the subcutaneous muscle tissue of the left chest was bluntly dissected with curved hemostats in the right hand to expose the fourth intercostal space on the left side of the sternum. The hemostats were then inserted into the chest cavity through the fourth intercostal space on the left side, and the hemostats were slightly opened to expose the chest cavity. With the left hand, the heart was gently squeezed out of the chest cavity in coordination with the position of the hemostats to expose the heart. Under a microscope, observe the location of the left anterior descending coronary artery (LAD). Quickly use a needle holder to grasp 6-0 suture with a needle and insert the needle 2 mm below the lower edge of the left atrial appendage, ligating it at the proximal 1 / 3 of the LAD (ensuring a shallow entry and wide exit, avoiding penetration of the ventricular wall), thus blocking blood flow to the LAD. If the ligation is successful, the color of the left ventricular anterior wall myocardium below the ligation line will change from dark red to white during the procedure.The heart was then gently returned to the pleural cavity through the opening opened by the hemostat, carefully expelling excess air to prevent pneumothorax. The skin was sutured closed with pre-prepared 3-0 suture thread. Buprenorphine (0.05 mg / kg) was administered to the mice for analgesia during and after the operation. Postoperatively, the mice's chest rise and fall and respiratory rate were closely monitored, and they were kept warm and free from movement. After the mice naturally recovered, they were placed in a warm, quiet environment for 12–24 hours. Once the mice were stable, they were returned to the animal room and cared for normally. Mortality was monitored three times daily for the first 7 days postoperatively. All dead mice underwent necropsy to confirm cardiac rupture (observing for hemothorax and cardiac rupture sites).

[0033] (6) Establishment of an in vitro perfused heart model: An in vitro perfused heart model was established using C57BL / 6J wild-type mice to obtain primary cardiomyocytes and primary cardiac fibroblasts from C57BL / 6J wild-type mice at different time points after acute myocardial infarction. Perfusion fluid, enzyme digestion solution, and termination solution were prepared in advance. Before the experiment, mice were intraperitoneally injected with 0.3 ml of heparin (6 g / L heparin sodium). 15 minutes later, they were anesthetized by intraperitoneal injection of sodium pentobarbital at a dose of 0.1 ml / 20 g body weight. When the mice lost consciousness and reflexes disappeared, the thoracic cavity was quickly opened and the heart was removed. The heart was placed in a calcium-free culture dish, and after locating the aorta, a cannula was quickly inserted into the root of the aorta and ligated. The cannula was then connected to the Langendorff perfusion system, and perfusion was immediately started at a flow rate of 2-3 ml / min at 37 ℃. Perfusion was initially performed with the perfusion fluid for 10-15 minutes until the outflow was no longer red. Then, the perfusion was switched to the enzyme digestion solution for approximately 5-10 minutes. Once the heart softens and loses its elasticity, ventricular tissue is excised and placed in an enzyme digestion solution, then minced into small pieces. Next, 10 ml of an enzyme digestion solution containing 15 μl CaCl2 is added to raise the final CaCl2 concentration to 700 μM, and the mixture is incubated for 2 minutes. The tissue is then further minced to approximately 1 mm in size, and this step is repeated three times. The cell suspension is filtered through a 200 μm filter, and 10 ml of stop solution is added to rinse the filter. The suspension is then centrifuged at 200 g for 2 minutes. The supernatant (containing primary cardiac fibroblasts) is collected, centrifuged again at 1000 g for 5 minutes, and the supernatant is discarded before plating. The pellet (containing primary cardiomyocytes) is immediately used to extract RNA using TRIzol reagent. Approximately 2 hours after primary cardiac fibroblasts adhere to the culture plate, RNA is also extracted using TRIzol reagent.

[0034] (7) RT-qPCR: 1) RNA extraction: ① Add TRIzol: Add 1 ml of TRIzol to the cells in each EP tube; ② RNA separation: Add 200 μl of chloroform to each 1 ml of TRIzol, tighten the cap of the EP tube, and shake vigorously for 15 s to mix the contents. Let stand at room temperature for 10 min, repeat 3 times. Balance the EP tube and place it in a low-temperature high-speed centrifuge, centrifuge at 12000 rpm, 15 min, and 4 ℃. After removing the EP tube, use a pipette to transfer the colorless aqueous phase (about 400-500 μl) to a new 1.5 ml EP tube; ③ RNA precipitation: Add isopropanol to each EP tube according to the standard of adding 500 μl of isopropanol to 1 ml of TRIzol, shake well, and let stand at room temperature for 10-15 min. Balance the EP tube and place it in a low-temperature high-speed centrifuge, centrifuge at 12000 rpm, 10 min, and 4 ℃. Carefully discard the supernatant, keeping the white precipitate at the bottom of the EP tube; ④ RNA elution: Add 1 ml of freshly prepared 75% ethanol (prepared with DEPC water and pre-cooled) to the white precipitate in each EP tube, and vortex to wash the RNA precipitate. Balance the EP tubes and place them in a low-temperature high-speed centrifuge at 7500 rpm for 5 min at 4 ℃, discarding the supernatant. Repeat the above operation twice; ⑤ RNA drying: Remove the liquid from each EP tube with a pipette tip, then open the cap and invert the EP tube onto a paper towel to drain the liquid. Then place the EP tubes in a cell ultrafiltration unit and turn on the blower to blow the RNA precipitate until it is semi-dry, about 5 min, at which point the RNA precipitate will become transparent. Note that it should not be completely dried to prevent a decrease in RNA solubility; ⑥ RNA dissolution: Add DEPC water to each EP tube, the volume of DEPC water added depending on the size of the precipitate. If the white precipitate is the size of a grain of rice, add 20 μl of DEPC water; if the white precipitate is the size of a mung bean, add 50 μl of DEPC water; if the white precipitate is the size of a soybean, add 100 μl of DEPC water. Incubate the EP tube in a 55–60 ℃ metal bath for 10 min to aid dissolution. Reverse transcribe the extracted RNA into cDNA as soon as possible within one week or immediately. If the extracted RNA is not used at this time, it can be stored at -80 ℃ for an extended period. 2) RNA concentration determination: ① Before use, clean the probe of the nucleic acid protein analyzer with DEPC-treated water; ② Use a small-range pipette to add 1 μl of DEPC water to the probe as a blank control, click Blank Measure, measure the A260 / A280 ratio, and zero the instrument to ensure the DEPC water concentration is approximately ±0.2. If it is not within ±0.2, repeat the above steps until the concentration is adjusted to ±0.2.① Wipe the liquid off the probe before each sample addition; ② Add 1 μl of DEPC water to the probe, click Measure, and if the concentration remains within ±0.2, you can begin the formal sample measurement; ③ Wipe the DEPC water off the probe, add 1 μl of RNA sample, and measure the RNA concentration. If the ratio of absorbance A260 to A280 is between 1.8 and 2.0, it indicates that the RNA sample purity meets the requirements, and the experiment can continue; ④ Repeat the above operations until all RNA samples have been measured. 3) Reverse transcription to synthesize cDNA: ① Prepare the cDNA synthesis kit in advance, place each component of the kit on ice to dissolve, vortex to mix, and centrifuge manually for a few seconds; ② Calculate the required RNA volume according to the formula, and add the reactants shown in Table 1 in order to a sterile, nuclease-free PCR eight-pack on ice. Table 1

[0035] ③ Gently mix and briefly centrifuge. Incubate at 65 ℃ for 5 min, cool on ice, briefly centrifuge, and cool on ice again; ④ Add the reactants shown in Table 2 to an ice-cold, nuclease-free PCR eight-pack in the following order: Table 2

[0036] ⑤ Gently mix the total volume of 20 μl of reaction mixture in the eight-pack, and briefly centrifuge to avoid air bubbles; ⑥ Install on the PCR instrument, set the PCR program to 25 ℃, 5 min → 42 ℃, 60 min → 70 ℃, 5 min → 4 ℃, forever; ⑦ At this point, the PCR eight-pack tube contains cDNA synthesized by reverse transcription. The cDNA can be used directly for real-time quantitative PCR or stored at -80 ℃. 4) Real-time quantitative PCR: ① Use the CFX96 Real Time PCR Detection System operating system and TBGreen Premix Ex Taq™ reagents to quantify the RNA in the sample; ② Perform the entire operation on ice, adding the reagents shown in Table 3 in the order listed in the sterile, nuclease-free PCR eight-pack: Table 3

[0037] If the TB Green Premix Ex Taq™ reagent produces a white or pale yellow precipitate, it can be dissolved by heating. Before use, invert the container to mix thoroughly and avoid light during use; ③ Set up 3 replicates for each RNA sample to avoid inaccurate sample loading. Gently mix the 25 μl total volume of the PCR eight-pack reaction mixture on a vortex mixer and then manually centrifuge briefly to avoid air bubbles; ④ Load the instrument. Perform PCR amplification using the two-step method. Set the Bio-rad Real Time PCR instrument program to 95℃, 30 s → PCR reaction → GOTO: 39 (40) cycles → 95℃, 5 s → 60℃, 30 s → Melt Curve → 4℃, forever; ⑤ Analyze the data: Compare the Ct value of the target gene with the Ct value of the internal reference gene (β-actin). The 2-ΔΔCt method is used to compare transcriptional changes. The formula is expressed as ΔΔCt = ΔCt experimental group - ΔCt control group, where ΔCt = Ct target gene - Ct internal reference gene.

[0038] (8) Masson staining: Fresh heart tissue was first rinsed with pre-cooled phosphate buffer to remove blood. The tissue was then fixed in 4% paraformaldehyde, dehydrated routinely, embedded in paraffin, and cut into 5 μm thick tissue sections. According to the manufacturer's instructions, use the Masson trichrome staining kit (G1340, Solarbio) for staining. The specific steps are as follows: 1) Dewaxing, debenzeneizing, and hydrating paraffin sections: xylene I 15 min, xylene II 15 min, anhydrous ethanol I 5 min, anhydrous ethanol II 5 min, 95% ethanol 5 min, 90% ethanol 5 min, 80% ethanol 5 min, 70% ethanol 5 min, distilled water 5 min; 2) Staining with the prepared Weigert iron hematoxylin staining solution for 5-10 min; 3) Differentiation with acidic ethanol differentiation solution for 5-15 s, then washing with water; 4) Re-blueing with Masson blueing solution for 3-5 min, then washing with water; 5) Washing with distilled water for 1 min; 6) Staining with Ponceau S and fuchsin solution for 5-10 min (do not dry the sections after staining); 7) During the above operations, prepare a weak acid working solution with distilled water and weak acid solution at a ratio of 2:1, and wash with the weak acid working solution for 1 min; 8) Washing with phosphomolybdic acid solution for 1-2 minutes. 9) Wash with weak acid working solution for 1 min; 10) Stain in aniline blue staining solution for 1–2 min; 11) Wash with weak acid working solution for 1 min; 12) Rapid dehydration with 95% ethanol; 13) Dehydration with anhydrous ethanol 3 times, 5–10 s each time; 14) Clearing with xylene 3 times, 1–2 min each time; 15) Mounting with neutral resin. Images were acquired using NIS-ELEMENTS software (Nikon). The area of ​​myocardial fibrosis in each tissue section was analyzed using ImageJ software. The degree of myocardial fibrosis was expressed as a percentage of fibrotic area / total heart area.

[0039] (9) Immunohistochemical staining: Fresh heart tissue was first rinsed with pre-cooled phosphate buffer to remove blood. The tissue was then fixed in 4% paraformaldehyde, dehydrated routinely, embedded in paraffin, and cut into 5 μm thick tissue sections. Perform the following steps: 1) Dewaxing, debenzeneizing, and hydration of paraffin sections: xylene I 15 min, xylene II 15 min, anhydrous ethanol I 5 min, anhydrous ethanol II 5 min, 95% ethanol 5 min, 90% ethanol 5 min, 80% ethanol 5 min, 70% ethanol 5 min, distilled water 5 min; 2) Wash 3 times with 1× PBS, 3 min each time; 3) Antigen retrieval: Boil in 1× sodium citrate solution, time for 90 s after boiling, then turn off the heat and allow to cool naturally; 4) Wash 3 times with 1× PBS, 3 min each time; 5) Add 3% hydrogen peroxide to the tissue and incubate at room temperature for 15 min; 6) Wash 3 times with 1× PBS, 3 min each time; 7) Block with 3% bovine serum albumin V at room temperature for 1 h; 8) Add primary antibodies (anti-Col 1 antibody and anti-Col 3 antibody) to the tissue and incubate overnight at 4 ℃; 9) Let stand at room temperature for 30 min; 10) Add 1× 11) Add secondary antibody to the tissue and incubate at room temperature in the dark for 1 h; 12) Wash three times with 1×PBS, 3 min each time; 13) Staining: Add an appropriate amount of freshly prepared DAB to the tissue, observe the staining under a microscope, and then place it in 1×PBS; 14) Counterstaining: Stain with hematoxylin for 3-5 min, wash with tap water for 1 min, differentiate with hydrochloric acid for 2 s, and wash with tap water for 5 min; 15) Routine dehydration and clearing: Rapid dehydration with 95% ethanol. Dehydration with anhydrous ethanol three times, 5-10 s each time. Clearing with xylene three times, 1-2 min each time; 16) Mounting with neutral resin. Using NIS-ELEMENTS software (Nikon) connected to a fully automated upright microscope, local images were taken at 400x magnification, and average samples were taken from the infarct area, marginal area, and distal area. ImageJ software was used to quantitatively analyze the percentage of Col 1 and Col 3 positive areas in each section.

[0040] (10) Western blot: Heart tissue proteins were extracted using RIPA tissue / cell lysis buffer containing protease inhibitors, a mixture of phosphatase inhibitors and Halt™ protease inhibitors, 0.5 M EDTA solution, and PMSF. Protein concentrations were determined using the Pierce™ BCA protein quantification kit. Subsequently, protein samples were separated by SDS-PAGE gel electrophoresis (5% stacking gel and 8-12% separating gel) and transferred to PVDF membranes. PVDF membranes were blocked with 5% bovine serum albumin V at room temperature for 1 hour. They were then incubated overnight at 4 °C with primary antibodies (anti-α-SMA, anti-Phospho-Smad2, anti-Phospho-Smad3, anti-Smad2, anti-Smad3, anti-GAPDH, anti-SMOC-1, anti-EPRS, and anti-TGF-βR1). The next day, the corresponding secondary antibodies (IRDye® 800CW goat anti-mouse and IRDye® 680RD goat anti-rabbit) were added and incubated at room temperature for 1 hour. Protein bands were detected using the Odyssey infrared imaging system (LI-COR Biosciences), and quantitative analysis was performed using ImageJ software.

[0041] (11) Primary cell isolation and culture: Primary cardiomyocytes and primary cardiac fibroblasts were isolated from the hearts of 1-3 day old SD suckling mice. After fixing the SD suckling mice in a laminar flow hood, the skin was disinfected with 75% ethanol, the thoracic cavity was opened and the heart was removed and washed in Hank's balanced salt solution. After removing the major blood vessels and atria of the heart, the ventricular tissue was thoroughly minced to a paste-like consistency. Then, 0.25% Trypsin and Collagenase II mixed digestion solution was added, and digestion was carried out in a 37 ℃ water bath. The supernatant was aspirated and DMEM / F12 complete medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) was added. The above steps were repeated until the heart tissue block was completely digested. The resulting cell suspension was filtered through a 200-mesh sieve, centrifuged at 1000 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in DMEM / F12 complete medium and mixed evenly by pipetting. Then, the cells were plated for culture. After 2 hours of differential adhesion, the supernatant (containing primary cardiomyocytes) was aspirated, centrifuged at 1000 rpm for 5 minutes, the supernatant was discarded, and DMEM / F12 complete medium containing BrdU was added. After thorough mixing, the cells were cultured further. The adherent primary cardiac fibroblasts were cultured in DMEM high-glucose medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin).

[0042] (12) Immunoprecipitation: Primary cardiomyocytes extracted from 1-3 day old SD suckling mice were cultured for 4-6 days and then replaced with serum-free DMEM / F12 medium. The cells were subjected to hypoxia for 6 hours, and the supernatant of the primary cardiomyocytes was transferred to primary cardiac fibroblasts (passage 2-3) for stimulation. After culturing the primary cardiac fibroblasts under normoxic conditions for another 30 minutes, the primary cardiac fibroblasts were collected. The primary cardiac fibroblasts were further processed using an immunoprecipitation kit (Immunoprecipitation Assay Kit, PK10007, Proteintech) according to the manufacturer's instructions. The protein samples obtained by binding to and eluting anti-SMOC-1 (4 μg), anti-EPRS (4 μg), and anti-TGF-βR1 (4 μg) antibodies were analyzed by Western blot.

[0043] 3. Statistical Analysis Methods All statistical analyses were performed using SPSS 26.0 (IBM SPSS Inc., Armonk, NY) and GraphPadPrism 9 (GraphPad Software Inc.). A p-value < 0.05 was considered statistically significant. Categorical variables were expressed as number (or percentage). Continuous variables were expressed as mean ± standard deviation. Comparisons between categorical variables were performed using the chi-square test or Fisher's exact test. For continuous variables, the Shapiro-Wilk test was used to assess the normality of the data distribution. When comparing two groups, the Levene test was used to assess homogeneity of variance; for normally distributed data, an unpaired t-test (equal or unequal variances) was used depending on the homogeneity of variance; for non-normally distributed data, the Mann-Whitney U test was used.

[0044] 4. Experimental Results 4.1 SMOC-1 expression in early cardiac rupture after acute myocardial infarction Plasma samples were collected from 9 patients with acute myocardial infarction complicated with cardiac rupture and 9 patients with acute myocardial infarction without cardiac rupture, matched for age and sex. Plasma samples from every 3 patients were combined to form one sample for proteomics analysis. Results showed that compared with patients without cardiac rupture after acute myocardial infarction, patients with cardiac rupture after acute myocardial infarction had upregulated expression of 9 proteins and downregulated expression of 24 proteins in their plasma (P<0.005, log2 fold change>1.2). SMOC-1 was the most significantly upregulated stromal cell protein. Figure 1As shown. Furthermore, we expanded the sample size, using plasma samples from 20 patients with acute myocardial infarction complicated by cardiac rupture and 20 patients with acute myocardial infarction without cardiac rupture for ELISA validation. We found that the expression level of SMOC-1 was significantly increased in patients with cardiac rupture (P<0.0001). Figure 2 As shown.

[0045] 4.2 Cellular origin of SMOC-1 in the early post-acute myocardial infarction An acute myocardial infarction model was established using C57BL / 6J wild-type mice. Primary cardiomyocytes and primary cardiac fibroblasts (the two most abundant cell types in the heart) were obtained 1 and 3 days after acute myocardial infarction via ex vivo perfusion of the heart. RT-qPCR analysis of mRNA levels in both cell types revealed that SMOC-1 expression was low in both cell types under physiological conditions, but was primarily expressed in primary cardiomyocytes in the early post-acute myocardial infarction period. Figure 3 As shown.

[0046] 4.3 The role and mechanism of SMOC-1 in early cardiac rupture after acute myocardial infarction An acute myocardial infarction (AMI) model was established using SMOC-1 overexpressing mice and cardiomyocyte-specific SMOC-1 knockout mice to investigate the role of SMOC-1 in early cardiac rupture after AMI. By statistically analyzing the cardiac rupture rate within 7 days after AMI in SMOC-1 overexpressing mice and cardiomyocyte-specific SMOC-1 knockout mice, it was found that SMOC-1 overexpression significantly reduced the incidence of cardiac rupture (11% vs. 27%, p = 0.0365), while cardiomyocyte-specific SMOC-1 knockout significantly increased the incidence of cardiac rupture (45% vs. 24%, p = 0.0479). Figure 4 As shown in the figure ("15 / 56" indicates that 15 out of 56 AAV9-NC mice experienced early cardiac rupture after acute myocardial infarction, and the same applies to others). Using Masson staining of hearts at different infarction times, it was found that SMOC-1 overexpression significantly increased the area of ​​early myocardial fibrosis after acute myocardial infarction, while cardiomyocyte-specific knockout of SMOC-1 significantly reduced the area of ​​fibrosis. Figure 5 As shown. Immunohistochemical staining analysis of collagen secretion in the heart tissue of mice in different groups showed that SMOC-1 overexpression promoted the secretion of Col 1 and Col 3 in the heart tissue, thereby enhancing fibrotic repair after acute myocardial infarction. Conversely, cardiomyocyte-specific knockout of SMOC-1 reduced the secretion of Col 1 and Col 3, thereby weakening fibrotic repair. Figure 6 and Figure 7 As shown.

[0047] Western blot results also showed that SMOC-1 overexpression can enhance fibrosis repair after acute myocardial infarction by promoting cardiac fibroblast activation (α-SMA expression) and Smad pathway expression; while cardiomyocyte-specific knockout of SMOC-1 weakens fibrosis repair by reducing cardiac fibroblast activation (α-SMA expression) and Smad pathway expression. Figures 8-11 As shown. Primary cardiac fibroblasts extracted from 1-3 day old SD rats were stimulated for 30 minutes with different concentrations of recombinant SMOC-1 protein (0, 0.5, 1, and 1.5 μg / ml) (5550-SM-050, R&D) in cell culture medium. Western blot results also showed that recombinant SMOC-1 protein affected Smad pathway expression in a dose-dependent manner, such as... Figure 12 As shown.

[0048] Immunoprecipitation experiments further confirmed that primary cardiomyocytes extracted from 1-3 day old SD rats, after 6 hours of hypoxia treatment, were stimulated with their culture medium for 30 minutes (containing endogenous SMOC-1). The results showed that SMOC-1 could interact with TGF-βR1 and EPRS on primary cardiac fibroblasts through paracrine effects. Figure 13 As shown. To further explore the molecular mechanism of the interaction between SMOC-1, TGF-βR1, and EPRS, we used primary cardiac fibroblasts extracted from 1-3 day old SD rats to investigate whether SMOC-1 affects the stability and activation state of TGF-βR1, as well as the stability of the TGF-βR1 / 2 receptor complex. The results showed that SMOC-1 did not alter the stability of TGF-βR1, but it enhanced the activation level of TGF-βR1 and improved the stability of the TGF-βR1 / 2 receptor complex, such as... Figure 14 As shown.

[0049] The above results indicate that SMOC-1 can promote myocardial repair fibrosis through the TGF-βR1 / EPRS / Smad signaling pathway, thereby exerting an anti-cardiac rupture effect. Therefore, SMOC-1 may serve as a novel biomarker for the treatment of early cardiac rupture after acute myocardial infarction.

[0050] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. Use of SMOC-1 and / or SMOC-1 agonists in the preparation of medicaments for the prevention and / or treatment of cardiac rupture.

2. The application according to claim 1, characterized in that, The cardiac rupture includes cardiac rupture associated with acute myocardial infarction.

3. The application according to claim 2, characterized in that, The SMOC-1 prevents and / or treats cardiac rupture associated with acute myocardial infarction by reducing the incidence of cardiac rupture after acute myocardial infarction.

4. The application according to claim 2 or 3, characterized in that, The SMOC-1 prevents and / or treats cardiac rupture associated with acute myocardial infarction by increasing the area of ​​early myocardial fibrosis following acute myocardial infarction.

5. The application according to claim 4, characterized in that, The SMOC-1 increases the area of ​​early myocardial fibrosis after acute myocardial infarction by promoting cardiac fibroblast activation, promoting collagen secretion, and / or activating the Smad pathway.

6. The application according to claim 5, characterized in that, The promotion of cardiac fibroblast activation includes increasing the expression level of α-smooth muscle actin; And / or, the promotion of collagen secretion includes promoting the secretion of type I collagen and type III collagen.

7. The application according to any one of claims 1-6, characterized in that, The activation of the Smad pathway includes enhancing the activation of TGF-βR1 and improving the stability of the TGF-βR1 / 2 receptor complex.

8. The application according to any one of claims 1-7, characterized in that, The SMOC-1 agonist includes a viral vector that overexpresses SMOC-1; Optionally, the viral vector includes an adenovirus vector.

9. Application of products that detect SMOC-1 expression levels in the prevention and / or treatment of cardiac rupture.

10. The application according to claim 9, characterized in that, The cardiac rupture includes cardiac rupture associated with acute myocardial infarction; The SMOC-1 expression level includes protein level and / or mRNA level; And / or, the products include kits, test strips, reagents, primers, biochips, or probes; Optionally, the kit includes an ELISA detection kit; Optionally, the test sample for the product includes at least one of plasma, serum, cells, animal tissue, and cell culture supernatant.

Images