Nucleic acid constructs encoding human hepatocyte growth factor and uses thereof

Abstract

The present disclosure provides nucleic acid constructs encoding human hepatocyte growth factor and applications thereof. The mRNA of the present disclosure has high translation efficiency and better safety, can effectively promote angiogenesis, and shows good application potential for treating ischemic diseases and the like.

Description

Technical Field

[0001] This disclosure pertains to the field of biomedicine, and in particular relates to a nucleic acid construct encoding human hepatocyte growth factor (HGF) and its applications. Background Technology

[0002] Angiogenesis refers to the process by which new capillaries form from existing capillaries and postcapillary venules. The growth and maturation of new blood vessels is a highly complex and precisely coordinated biological process. Blood vessel formation and development depend on a dynamic balance between pro-angiogenic and anti-angiogenic factors. This process requires interactions between cells and between cells and the extracellular matrix, and involves the activation and regulation of a series of receptors by various pro-angiogenic and anti-angiogenic factors. Currently, more than 20 pro-angiogenic factors have been identified, including hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and platelet-derived growth factor (PDGF).

[0003] HGF, initially isolated from rat plasma and platelets, is a multifunctional cytokine. Known to be produced by mesenchymal cells, HGF binds to the c-Met receptor and activates its tyrosine kinase activity, thereby promoting the growth, migration, and morphogenesis of various cells, including hepatocytes, epithelial cells, endothelial cells, melanocytes, and hematopoietic cells. It also promotes angiogenesis (e.g., microvascularization) and the repair of nerve damage (e.g., diabetic peripheral neuropathy). Therefore, HGF holds promise for development as a therapeutic agent for HGF / c-Met-related diseases.

[0004] Currently, there are various forms of administration for pro-angiogenic factors, but all of them have significant drawbacks: (1) After the purified protein is injected intravenously, it can reach the ischemic tissue through blood circulation. However, the body's immune system will produce an immune response to the foreign protein, and the injected foreign protein will be rapidly degraded by proteases, resulting in poor treatment effect. Furthermore, multiple injections of growth factors into the ischemic area may cause serious adverse reactions.

[0005] (2) DNA therapy does not require surgery and can directly inject DNA into the ischemic muscle tissue, i.e., in situ therapy. However, a large number of DNA plasmids exist outside the cells in this method, which are easily degraded, have a short half-life, and low expression efficiency. Although viral vector transfection technology can improve transfection efficiency, it may integrate the nucleic acid sequence of the viral vector into the host genome, thus posing a risk.

[0006] RNA therapy can avoid genome integration, but it is easily degraded by RNases. Therefore, it is necessary to improve the stability of RNA to allow its encoded protein products to accumulate in vivo, and to maintain the integrity of RNA structure and function during storage and administration. Naturally occurring eukaryotic mRNA molecules have been found to contain stabilizing elements, such as their 5' and 3' untranslated regions (UTRs), as well as other structural features such as 5' cap structures or 3' polyadenylates.

[0007] Therefore, seeking to design sequences with better performance is one of the core research contents of nucleic acid drug development. Summary of the Invention

[0008] This disclosure provides a nucleic acid construct encoding human hepatocyte growth factor (hHGF) and its application, wherein the mRNA corresponding to the hHGF nucleic acid construct has high translation efficiency and low immunogenicity.

[0009] This disclosure solves the above-mentioned technical problems through the following technical solutions.

[0010] On the one hand, this disclosure provides an isolated nucleic acid molecule encoding hHGF, said nucleic acid molecule comprising a nucleotide sequence as shown in any of SEQ ID NO: 4-22.

[0011] The nucleic acid molecule includes any of the nucleotide sequences shown in SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22.

[0012] In some implementations, the nucleic acid molecule also includes a DNA sequence encoding a stop codon, such as TGATAATAG.

[0013] On the other hand, this disclosure provides a nucleic acid construct comprising one or more nucleic acid molecules as described in this disclosure.

[0014] In some embodiments, the nucleic acid construct further includes a nucleic acid molecule encoding one or more of 5'UTR, 3'UTR, and poly(A).

[0015] In some implementations, the nucleotide sequence of the nucleic acid molecule encoding the 5'UTR is shown in SEQ ID NO: 23.

[0016] In some implementations, the nucleotide sequence of the nucleic acid molecule encoding the 3'UTR is shown in SEQ ID NO: 24.

[0017] In some implementations, the nucleotide sequence of the nucleic acid molecule encoding poly(A) is shown in SEQ ID NO: 25.

[0018] In some embodiments, from the 5' end to the 3' end, the nucleic acid construct includes a nucleic acid molecule encoding a 5'UTR, a nucleic acid molecule encoding hHGF, a nucleic acid molecule encoding a 3'UTR, and a nucleic acid molecule encoding poly(A).

[0019] In some embodiments, the nucleic acid molecule is constructed into the nucleic acid construct using one or more restriction endonucleases selected from, for example, BsaI, Hind III, and Sap I. Preferably, the nucleic acid molecule is constructed into the nucleic acid construct using BsaI.

[0020] In some implementations, the nucleic acid construct is an expression cassette, which, in addition to the aforementioned nucleic acid molecules, may optionally include regulatory elements such as promoters and enhancers.

[0021] On the other hand, this disclosure provides a recombinant vector comprising the nucleic acid molecules or nucleic acid constructs described in this disclosure.

[0022] In some embodiments, the recombinant vector is a plasmid, a granule, or a viral vector, preferably a bacteriophage, retroviral vector, lentiviral vector, adenovirus vector, or adeno-associated virus vector.

[0023] On the other hand, this disclosure provides a transformant containing the nucleic acid molecule, nucleic acid construct, or recombinant vector described in this disclosure.

[0024] In some implementations, the transformant is a non-animal variety or a non-plant variety.

[0025] In some embodiments, the host cell of the transformant is a eukaryotic cell or a prokaryotic cell.

[0026] On the other hand, this disclosure provides an mRNA, which includes the mRNA sequence or modified sequence encoded by the nucleic acid molecule or nucleic acid construct described in this disclosure.

[0027] In some implementations, the mRNA sequence is codon-optimized.

[0028] In some implementations, the mRNA sequence contains at least one base modification.

[0029] In some embodiments, the base modification includes any one or more of the following: pseudouridine, N1-methylpseuuridine, N1-ethylpseuuridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseuuridine, 2-thio-1-methylpseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methylpseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0030] In some embodiments, the base modification includes replacing uridine with pseudouridine and / or N1-methylpseudouridine.

[0031] In some embodiments, the base modification is 1% to 100% base modification.

[0032] In some embodiments, the base modification includes replacing all uridines in the sequence with pseudouridines or N1-methylpseudouridines. In some specific embodiments of the present invention, the base modification, which includes replacing all uridines in the sequence with N1-methylpseudouridines, can significantly reduce the immunogenicity of exogenously synthesized mRNA and improve translation efficiency.

[0033] In some implementations, the 5' end of the mRNA is attached to a 5' cap structure.

[0034] In some implementations, the 5' cap structure is Cap 0, Cap 1, Cap 2, or the like.

[0035] In some embodiments, the 5' cap structure has the structure shown in formula (I):

[0036] Where n is selected from 1 or 0; m is selected from 1 or 0; X1 is selected from -C(OH)H- or a single bond; X2 is selected from -CH-, -O-, -CN, -C(O)-, Or a single key; X3 is selected from -CH2, -CFH-, or -O-; R1 is selected from -OH or -NHAc; R2 is selected from -CH3, -F, -H, or does not exist; R3 is selected from -OR6, -NHC(O)R7, -N(R8)2, -CN, -F, -C(O)N(R9)2, substituted or unsubstituted C 1-C3 alkyl group, -H or absent; R4 is selected from -CH3, -F, or -H; R5 is selected from -OR 10 -NHC(O)R 11 -N(R) 12 )2、-CF2H、-F、-C(O)N(R 13 2. Substituted or unsubstituted C 1- C3 alkyl groups may not be present; R6, R8, R 10 R 11 R 12 and R 13 Each is independently selected from unsubstituted C1-C3 alkyl groups or -H; R7 is selected from -OR 14 -NHC(O)R 15 -F or substituted or unsubstituted C 1- C3 alkyl; R9 is selected from unsubstituted C2-C3 alkyl groups; R 14 and R 15 Each is independently selected from unsubstituted C1-C3 alkyl groups.

[0037] In some implementations, the 5' cap structure has the following structural formula: .

[0038] In some implementations, the 5' cap structure has the following structural formula: .

[0039] On the other hand, this disclosure provides a method for preparing mRNA, the method comprising transcribing the mRNA based on the nucleic acid molecule or nucleic acid construct described in this disclosure. Optionally, the transcription process includes a capping reaction.

[0040] On the other hand, this disclosure provides compositions comprising lipid nanoparticles and the mRNA described in this disclosure encapsulated within the lipid nanoparticles.

[0041] In some embodiments, the lipid nanoparticles include cationic lipids and auxiliary lipids.

[0042] In some embodiments, the cationic lipid is YK-009.

[0043] In some embodiments, the auxiliary lipid is DSPC, cholesterol, and / or DMG-PEG-2000.

[0044] In some embodiments, the lipid nanoparticles include the mRNA, YK-009, DSPC, cholesterol, and DMG-PEG-2000.

[0045] In some implementations, the molar ratio of YK-009, DSPC, cholesterol and DMG-PEG-2000 is (40~60):(2~15):(30~40):(0.8~1.6), for example 49:10:39.5:1.5.

[0046] In some embodiments, the composition further includes a pharmaceutically acceptable carrier and / or excipient.

[0047] On the other hand, this disclosure provides a method for preparing the above composition, the method comprising: An organic phase was prepared by dissolving the cationic lipid and the auxiliary lipid in anhydrous ethanol in a certain proportion; The mRNA molecule is dissolved in a buffer solution to form an aqueous phase; The composition is prepared by mixing the aqueous phase and the organic phase using a pipette or a microfluidic chip.

[0048] In some embodiments, the volume ratio of the aqueous phase to the organic phase is (2~4):1.

[0049] On the other hand, this disclosure provides the application of the nucleic acid molecules, nucleic acid constructs, recombinant vectors, transformants, mRNAs, and compositions described herein in the preparation of one or more of the following products: (1) Products that increase hHGF expression levels; (2) Drugs that promote endothelial cell growth and / or migration; (3) Drugs that promote angiogenesis; (4) Drugs that promote nerve damage repair; (5) Medications for the prevention and / or treatment of ischemic diseases, metabolic syndrome, diabetic complications, restenosis, and / or nerve damage.

[0050] In some embodiments, the ischemic disease is selected from coronary artery disease (CAD), peripheral artery disease (PAD), myocardial infarction, limb ischemia, and thromboangiitis obliterans (TAO); preferably, the limb ischemia is lower limb ischemia, more preferably, the limb ischemia is severe lower limb ischemia (CLI).

[0051] In some implementations, the diabetic complication is selected from diabetic peripheral neuropathy, diabetic foot (DFU), and diabetic arteriosclerosis obliterans (DAO).

[0052] In some implementations, the restenosis is selected from restenosis following percutaneous coronary intervention (PCI), restenosis following bypass grafting, and restenosis caused by ischemia-reperfusion.

[0053] In some embodiments, the nerve injury is selected from neurodegenerative diseases, traumatic nerve injury, and peripheral neuropathy; preferably, the neurodegenerative disease is selected from amyotrophic lateral sclerosis (ALS), Parkinson's disease, and Alzheimer's disease, and the peripheral neuropathy is diabetic peripheral neuropathy.

[0054] On the other hand, this disclosure provides the nucleic acid molecules, nucleic acid constructs, recombinant vectors, transformants, mRNAs, and compositions described herein for (1) increasing hHGF expression, (2) promoting endothelial cell growth and / or migration, (3) promoting angiogenesis, (4) promoting nerve injury repair, and / or, (5) preventing and / or treating ischemic diseases, metabolic syndrome, diabetic complications, restenosis, and / or nerve injury.

[0055] In some implementations, the ischemic disease is selected from coronary artery disease, peripheral artery disease, myocardial infarction, limb ischemia, and thromboangiitis obliterans; preferably, the limb ischemia is lower limb ischemia, and more preferably, the limb ischemia is severe lower limb ischemia.

[0056] In some implementations, the diabetic complication is selected from diabetic peripheral neuropathy, diabetic foot, and diabetic arteriosclerosis obliterans.

[0057] In some implementations, the restenosis is selected from restenosis following percutaneous coronary intervention, restenosis following bypass surgery, and restenosis caused by ischemia-reperfusion.

[0058] In some embodiments, the nerve injury is selected from neurodegenerative diseases, traumatic nerve injury, and peripheral neuropathy; preferably, the neurodegenerative disease is selected from amyotrophic lateral sclerosis, Parkinson's disease, and Alzheimer's disease, and the peripheral neuropathy is diabetic peripheral neuropathy.

[0059] On the other hand, this disclosure provides a method for (1) increasing hHGF expression, (2) promoting endothelial cell growth and / or migration, (3) promoting angiogenesis, (4) promoting nerve injury repair, and / or, (5) preventing and / or treating ischemic diseases, metabolic syndrome, diabetic complications, restenosis, and / or nerve injury. The method includes applying an effective amount of the nucleic acid molecule, the nucleic acid construct, the recombinant vector, the mRNA, or the composition described in this disclosure to the desired system.

[0060] In some implementations, the ischemic disease is selected from coronary artery disease, peripheral artery disease, myocardial infarction, limb ischemia, and thromboangiitis obliterans; preferably, the limb ischemia is lower limb ischemia, and more preferably, the limb ischemia is severe lower limb ischemia.

[0061] In some implementations, the diabetic complication is selected from diabetic peripheral neuropathy, diabetic foot, and diabetic arteriosclerosis obliterans.

[0062] In some implementations, the restenosis is selected from restenosis following percutaneous coronary intervention, restenosis following bypass surgery, and restenosis caused by ischemia-reperfusion.

[0063] In some embodiments, the nerve injury is selected from neurodegenerative diseases, traumatic nerve injury, and peripheral neuropathy; preferably, the neurodegenerative disease is selected from amyotrophic lateral sclerosis, Parkinson's disease, and Alzheimer's disease, and the peripheral neuropathy is diabetic peripheral neuropathy.

[0064] In some implementations, the system includes cells, tissues, or subjects.

[0065] In some implementations, the subject is a mammal, such as a human, rat, mouse, pig, dog, or non-human primate, more preferably a human.

[0066] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of this disclosure.

[0067] The reagents and raw materials used in this disclosure are all commercially available or can be manufactured in compliance with regulations and can be prepared repeatedly.

[0068] The positive and progressive effects of this disclosure include at least the following: The disclosed mRNA exhibits high translation efficiency and improved safety, and can effectively promote angiogenesis, demonstrating good application potential for the treatment of ischemic diseases. Specifically: This disclosure yields a series of nucleic acid molecules with high translation efficiency by optimizing the hHGF coding sequence. Both in vitro and in vivo experiments demonstrate that the nucleic acid molecules of this disclosure significantly enhance the hHGF protein expression level in cells and mouse muscle tissue compared to existing technologies.

[0069] The mRNA-LNP composition containing the optimized sequence of this disclosure exhibited good therapeutic effects in a mouse model of lower limb ischemia, with a single intramuscular injection significantly improving blood perfusion in the affected limb and promoting angiogenesis in ischemic tissue. Toxicological studies showed that the mRNA-LNP composition of this disclosure did not produce significant toxicological effects after multiple intramuscular injections, had no significant effect on the release of pro-inflammatory factors, and demonstrated good safety.

[0070] The above results indicate that the nucleic acid molecules and compositions disclosed herein have promising applications in the treatment of ischemic diseases. Attached Figure Description

[0071] Figure 1 The images show the Western blot (WB) results of HGF mRNA and control plasmid expression in 293T cells. Parts A, B, and C are the imaging results of three independent electrophoresis gels, respectively.

[0072] Figure 2 The results of ELISA detection of HGF mRNA and control plasmid expression in 293T cells.

[0073] Figure 3 Line graph showing the change in hHGF protein expression levels over time in mouse muscle tissue using HGF mRNA-LNP and control plasmids.

[0074] Figure 4 The results of HGF mRNA-LNP and control plasmid on blood perfusion ratio (affected side / unaffected side) in a mouse model of lower limb ischemia are shown.

[0075] Figure 5 The results show the effects of HGF mRNA-LNP and control plasmids on angiogenesis in a mouse model of lower limb ischemia.

[0076] Figure 6 The results show the effects of different cap-structure modified mRNAs on blood perfusion ratio (affected side / unaffected side) in a mouse model of lower limb ischemia.

[0077] Figure 7 The following figures illustrate the effect of different doses of HGF mRNA-LNP on blood perfusion ratio (affected side / healthy side) in a mouse model of lower limb ischemia. Figure 7 The results of A) and ischemic necrosis score ( Figure 7 B).

[0078] Figure 8 The effect of HGF mRNA-LNP on rat cytokine secretion was demonstrated. Detailed Implementation

[0079] All terms used herein are intended to be understood as such by one of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0080] Throughout this disclosure, whenever a range of values ​​or parameters is enumerated, the purpose is to indicate that any intermediate values ​​and ranges of these referenced values ​​are also intended to be disclosed herein. It should be understood that the description of quantities in range format is merely for convenience and brevity and should not be construed as a limitation on the range of any embodiment. Therefore, the description of ranges should be considered as specifically disclosing all possible subranges and all individual values ​​within that range, unless the context explicitly specifies otherwise. For example, a description of a range such as 1 to 6 should be considered as specifically disclosing subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and individual values ​​within that range, such as 1.1, 2, 2.3, 4.62, 5, and 5.9. This applies regardless of the width of the range. The upper and lower limits of these intermediate ranges may be independently included within smaller ranges and are also covered within this disclosure, subject to any specific exclusion limits of the ranges. Where the range includes one or both of the limits, the range excluding one or both of the included limits is also included in this disclosure unless the context clearly specifies otherwise.

[0081] The articles “a” and “an” as used in this article refer to one or more (i.e., at least one) grammatical objects of the article. By way of example, “an element” refers to one element or more elements, such as multiple elements.

[0082] The terms "including," "comprising," or "containing," or similar words, refer to elements preceding the word that encompass the elements listed following the word and their equivalents, without excluding elements not mentioned. Therefore, the terms "including," "comprising," or "containing" as used herein can be open-ended, semi-closed, or closed-ended. In other words, the above terms can also refer to similar meanings such as "including but not limited to," "substantially composed of," or "composed of."

[0083] The term “or” here refers to the term “and / or” and is used interchangeably with it unless the context clearly indicates otherwise.

[0084] As used herein, the term “about” or “approximately” when applied to one or more target values ​​means a value similar to the reference value. In some embodiments, unless otherwise stated or otherwise apparent from the context, the term “approximately” or “about” means a range of values ​​falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in any direction (unless such a number would exceed 100% of the possible value).

[0085] As used herein, “optional,” “optional,” “optional,” or “optionally” have the same meaning as “the event or condition described thereafter may or may not occur,” and the description includes both the possibility that the event or condition may occur and the possibility that it may not occur.

[0086] The letters “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. “T” and “dT” are used interchangeably herein and refer to deoxyribonucleotides in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it should be understood that the terms “ribonucleotide,” “nucleotide,” or “deoxyribonucleotide” can also refer to a modified nucleotide (as further detailed below) or an alternative substitution. Those skilled in the art will readily recognize that guanine, cytosine, adenine, and uracil can be substituted with other parts without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide with such a substitution). For example, and not limited to, nucleotides containing inosine as a base can base-pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be substituted in the nucleotide sequence of this disclosure with a nucleotide containing, for example, inosine. Sequences containing such substitutions are embodiments of this disclosure.

[0087] In this article, the term "coding" refers to the process by which a specific nucleotide sequence in a nucleic acid sequence (such as DNA) is transcribed to obtain the corresponding RNA sequence, or the process by which a specific protein or polypeptide is synthesized according to the rules of the genetic code.

[0088] As used herein, a “nucleic acid construct” refers to a functional nucleic acid structure formed by artificially designing and assembling one or more nucleic acid elements linked in a predetermined sequence; the nucleic acid elements include the nucleic acid molecules described in this disclosure, as well as optional regulatory elements such as promoters, untranslated regions, terminators, and signal peptide coding sequences; it can be a linear or circular nucleic acid, mainly used to achieve the expression, transcription, or functional delivery of the target nucleic acid. The term “expression cassette” refers to the smallest transcriptional / translational functional unit constituting a nucleic acid construct, which at least contains the target nucleic acid sequence and may optionally contain one or more regulatory elements (such as promoters, enhancers, 5'UTR, 3'UTR, and poly(A) tails).

[0089] As used herein, “recombinant vector” refers to a recombinant nucleic acid molecule obtained by inserting the nucleic acid molecule or nucleic acid construct described in this disclosure into a vector backbone; the vector backbone includes, but is not limited to, plasmids, granules, viral vectors, phage vectors, etc., and usually contains elements such as replication origins and selection markers, which can autonomously replicate in host cells, stably maintain or mediate the expression and delivery of the target nucleic acid.

[0090] As used herein, the term "host cell" refers to any type of cell that may contain the nucleic acids or vectors described herein. In exemplary respects, the host cell is a eukaryotic cell, such as a plant, animal, fungus, or algae; or it may be a prokaryotic cell, such as a bacterium or protozoan.

[0091] The term "analog" as used in this article refers to synthetic cap compounds whose chemical structures are homologous to the natural Cap 0, Cap 1, and Cap 2 structural backbones, and which are chemically modified by base, ribose, and phosphate chains to retain or optimize the core biological functions of the natural cap structure. They are not limited to natural unmodified cap molecules, but possess mRNA 5' end capping activity and can achieve at least one of the following functions: promoting mRNA translation initiation, enhancing mRNA intracellular stability, reducing cellular innate immune recognition, inhibiting mRNA degradation, and enhancing hHGF protein expression levels.

[0092] The Cap analogues include, but are not limited to: methyl-modified, thiophosphate-modified, fluororibose-modified, alkyl-substituted, bridging phosphate-modified, non-guanine mimic caps, hydrolysis-resistant cap derivatives, and modified cap structures that can be co-transcribed or in vitro enzymatically linked.

[0093] In this disclosure, the composition may comprise a suitable pharmaceutically acceptable carrier, such as a pharmaceutical excipient, as known in the art, including buffers, etc. The term "pharmaceutically acceptable carrier or excipient" as used herein refers to a substance that is compatible with the lipid nanoparticle-encapsulated mRNA composition described in this disclosure, is non-toxic, and does not impair its therapeutic activity at the doses used, including but not limited to: pH adjusters (such as citrate buffer, phosphate buffer), isotonic adjusters (such as sucrose, trehalose, mannitol, sodium chloride), chelating agents (such as EDTA), preservatives (such as benzyl alcohol), and water for injection or physiological saline. The carrier or excipient is used to formulate the mRNA-LNP formulation of this disclosure into a pharmaceutical composition suitable for local or systemic administration (preferably intravenous, intramuscular, or local injection).

[0094] The term "enhanced hHGF expression" as used in this article refers to an increase in the expression level and / or secretion of human hepatocyte growth factor (hHGF) in target cells, tissues, or in vivo. "Enhanced" means a statistically significant increase in the protein expression level and / or secretion of hHGF compared to the untreated control group or the positive control group.

[0095] The term "promoting endothelial cell growth and / or migration" as used in this article refers to stimulating endothelial cell proliferation, accelerating cell cycle progression, and / or enhancing the directional migration ability of endothelial cells. The corresponding mechanisms of action include, but are not limited to: activating the c-Met receptor signaling pathway, upregulating the expression of pro-angiogenic factors such as VEGF, and promoting the formation of tubular structures by endothelial cells.

[0096] The term "angiogenesis" as used in this article refers to the induction of endothelial cell activation, proliferation, migration, and luminal structure formation in vivo or in vitro, thereby promoting the establishment of new capillaries and collateral circulation.

[0097] The term "promoting nerve injury repair" as used in this article refers to improving the structure and function of the damaged nervous system by inhibiting neuronal apoptosis, promoting axonal regeneration and / or myelin repair, and enhancing nerve conduction function.

[0098] The term "system" as used in this article refers to in vitro biological systems such as cells and tissues, or in vivo systems in mammals.

[0099] As used herein, the term "patient" or "subject" is intended to include humans or non-human animals, preferably mammals such as monkeys. Most preferably, the subject or patient is a human. In this document, "patient" or "subject" may also be referred to as "object" in some instances.

[0100] As used herein, the term "treatment" refers to the administration of one or more pharmaceutically acceptable substances to a patient or subject suffering from a disease or exhibiting symptoms of such a disease, in order to cure, alleviate, reduce, improve, or affect the disease or its symptoms. As used herein, the term includes prevention of the worsening of the disease, condition, or related symptoms. It should be understood that the term "treatment," as used herein, may not be effective for all subjects seeking treatment. However, preferably, the term should require successful treatment of a statistically significant proportion of subjects suffering from the disease or condition described herein. Statistical significance can be determined using various known statistical assessment tools, such as confidence interval determination, p-value determination, t-test, Mann-Whitney test, etc.

[0101] The term "prevention" as used in this article refers to administering medication before the corresponding symptoms occur, thereby reducing the likelihood of the target disease or injury, delaying the onset of lesions, and reducing the severity of damage after the onset of the disease.

[0102] The “effective dose” mentioned in this article refers to the dosage of nucleic acid, carrier, or composition that can effectively achieve any of the following pharmacological objectives: increasing hHGF expression, promoting endothelial cell proliferation and migration, promoting angiogenesis, repairing nerve damage, and preventing / treating ischemic diseases, metabolic syndrome, diabetic complications, vascular restenosis, or nerve damage, while having no significant toxicity. The effective dose can be flexibly adjusted according to the in vitro cell model, animal or human subjects, administration method, and severity of the disease.

[0103] The following examples are used to further describe this disclosure, but these examples are not intended to limit the scope of this disclosure. Experimental methods in the examples of this disclosure that do not specify specific conditions are generally performed under conventional conditions, such as those described in Cold Spring Harbor's Antibody Technology Manual or Molecular Cloning Manual; or under conditions recommended by the raw material or commercial manufacturer. Reagents that do not specify a specific source are commercially available, conventional reagents.

[0104] Example 1: HGF mRNA construct sequence design

[0105] Mature hemoglobin (HGF) is a heterodimer composed of a heavy chain (α chain) and a light chain (β chain) linked by interchain disulfide bonds. The α chain contains 463 amino acids, approximately 69 kDa, while the β chain contains 234 amino acids, approximately 34 kDa. The N-terminus of the α chain has a hairpin structure, and near its C-terminus are four plasmin-like Kringle structures (referred to sequentially as K1, K2, K3, and K4 regions), each consisting of approximately 80 amino acids. It is known that the hairpin structure and the K1 region are key sites for HGF binding to its receptor c-Met, while the hairpin structure and the K2 region together constitute the essential structure for HGF affinity for heparin and heparan sulfate. The β chain contains a serine protease-like folded region but lacks serine protease activity. The half-life of HGF protein in the blood is only a few minutes. Using the mRNA-LNP form can delay mRNA degradation, prolong the time for mRNA to translate into protein, and thus extend the half-life of HGF. In addition, by optimizing the mRNA sequence with codons, the half-life of the mRNA can be extended and the protein translation efficiency can be improved, thereby extending the half-life of HGF.

[0106] Based on the above aspects, multiple nucleotide sequences were designed to screen for hHGF mRNA sequences with long half-life and high biological activity. The designed mRNA coding region sequences are shown in Table 1 below, and the DNA sequence corresponding to the 3' stop codon is TGATAATAG. The 5' end of the hHGF mRNA sequence was supplemented with the 5'-UTR sequence of SEQ ID NO: 23, and the 3' end was supplemented with the 3'-UTR sequence as shown in SEQ ID NO: 24 and the poly(A) sequence as shown in SEQ ID NO: 25. Among them, AB01 is the collategene naked plasmid; AB02 is m-A16-B12 (hHGF) in patent CN119013405A, and its corresponding DNA sequence is shown in SEQ ID NO: 1; AB04 is the wild-type hHGF sequence; AB24 adopts the coding region sequence of AB02.

[0107] Table 1 hHGF mRNA selection sequences

[0108] Example 2: Preparation of hHGF mRNA

[0109] 2.1 Experimental Materials

[0110] The experimental materials involved are shown in Table 2 below.

[0111] Table 2. Experimental materials for mRNA stock solution preparation

[0112] 2.2 Experimental Procedure

[0113] (1) Plasmid linearization and enzyme digestion

[0114] Plasmid DNA was linearized using the BsaI restriction endonuclease. The digestion system included plasmid DNA containing the target gene, 10 × FuniCut buffer, BsaI, and sterile enzyme-free water (RNase-free ddH2O). The digestion reaction was carried out at 37℃ for 15-30 min. The digestion reaction components are shown in Table 3 below.

[0115] Table 3 Components of Enzyme Digestion Reaction

[0116] After the enzyme digestion reaction was completed, the linearized product was recovered using a DNA product purification kit, the product concentration was determined using a Denovix ultraviolet spectrophotometer, and the length and status of the linearized plasmid were detected by agarose gel electrophoresis.

[0117] (2) Co-transcription capping

[0118] Using the linearized plasmid prepared in the above steps as a template, and NTP solution and Cap1 cap analogue as starting materials, mRNA was synthesized by transcription using T7 RNA polymerase. The structure of the Cap1 cap analogue is as follows:

[0119] Named CAP1, with the molecular formula C 35 H 48 N 16 O 24 P4; or,

[0120] Named YK-CAP-110, with the molecular formula C 33 H 43 F2N 15 O 23 P4.

[0121] The specific reaction components are shown in Table 4 below. The prepared reaction mixture was placed in a constant temperature incubator at 37 ℃ and shaken for 3 h.

[0122] Table 4 Components of in vitro transcription co-capping reaction

[0123] After the above reaction was completed, 1 μL of DNase I was added to 20 μL of the reaction solution, mixed well, and then digested at 37℃ for 15 min to obtain the co-transcriptional capping product.

[0124] (3) Purification by LiCl precipitation method

[0125] The co-transcriptional capping product obtained above was purified by lithium chloride precipitation, as follows: Add LiCl: Add LiCl to the co-transcriptional capping product to a final concentration of 2.8 M and incubate at -20℃ for 2 h.

[0126] Precipitation: Centrifuge at 12000 rpm for 15 min and retain the precipitate.

[0127] Washing: Wash twice with 75% ethanol, and dissolve in sterile enzyme-free water to obtain the purified transcription product, i.e., mRNA stock solution.

[0128] Detection: The concentration of the purified transcript was determined using a micro-volume ultraviolet spectrophotometer (Denovix), and its integrity was detected by capillary electrophoresis. The detection parameters are shown in Table 5 below.

[0129] Table 5. mRNA detection indicators (CAP1 is the cap analogue).

[0130] Example 3: LNP formulation preparation

[0131] Accurately weigh 20 mg of cationic lipids YK-009, DSPC, cholesterol, and DMG-PEG2000, respectively, dissolve them in anhydrous ethanol, and prepare a solution with a concentration of 10 mg / mL. Prepare a mixed solution with a molar ratio of 49:10:39.5:1.5 as the organic phase for later use.

[0132] hHGF mRNA was dissolved in 50 mM pH 4.0 citrate buffer and diluted to prepare a 0.15 mg / mL solution for use as the aqueous phase. 2 mL of the organic phase was drawn using a 3 mL BD syringe, and 7 mL of the aqueous phase was drawn using a 10 mL BD syringe. These were injected into the left and right pumps of the microfluidic device, respectively. The flow rate of the organic phase was set to 5.0 mL / min, and the flow rate of the aqueous phase was set to 15 mL / min. A 9.0 mL LNP intermediate solution was prepared and collected.

[0133] The LNP intermediate solution obtained above was diluted with PBS solution, and then concentrated by ultrafiltration. After being concentrated to a certain volume, PBS solution was added again for dilution, and the concentration was carried out by ultrafiltration. Ultrafiltration was stopped when the final concentrated volume was less than 5 mL to obtain mRNA-LNP. The detection indicators are shown in Table 6 below.

[0134] Table 6 mRNA-LNP detection indicators

[0135] Example 4: Western Blot detection of hHGF expression in cells

[0136] Cells were transfected with mRNA stock solution (CAP1 as a cap analog), and the expression of hHGF in cells and culture supernatant was detected by Western blotting.

[0137] 4.1 Experimental Materials:

[0138] The experimental materials involved are shown in Table 7 below.

[0139] Table 7. Main experimental materials and their sources

[0140] 4.2 Experimental Procedure

[0141] Cell culture and transfection: 293T cells were cultured at a rate of 2.5 × 10⁻⁶ cells / mL. 5 Seeds were placed into 12-well plates. The required volume of stock mRNA for 750 ng mRNA was calculated, and the corresponding volume of stock mRNA sample was mixed with the transfection reagent Lipofectamine. TM MessengerMAX TM Reagent mixture, 1 μg of AB01 plasmid Collategene and Novizan transfection reagent were mixed and added to the cells, and then mixed thoroughly.

[0142] Experimental group: The mixture of mRNA stock solutions prepared in Example 2 and protein samples obtained by lysing cells after transfection with AB01 plasmid; Negative control NC: RIPA lysis buffer.

[0143] Protein sample preparation: ① Sixteen hours after transfection, remove cells from the incubator. Use a pipette to repeatedly pipette until all cells are detached from the bottom of the dish. Transfer the cells to a 1.5 mL centrifuge tube and centrifuge at 1500 rpm for 3 min at 25 ℃. ② Discard the supernatant, add 1 mL of PBS, and resuspend the cells by pipetting; centrifuge at 1500 rpm for 3 min. ③ Repeat the above step twice. ④ Add 50 μL of RIPA lysis buffer (pre-added with a protease inhibitor, Thermo Fisher Scientific, product number 78430, 1 nM) to each cell tube. Incubate on ice for 30 min, vortexing the sample for 30 s every 5 min. ⑤ Pre-cool the centrifuge. After complete cell lysis, centrifuge the sample at 12000 rpm for 10 min at 4 ℃. Transfer the supernatant to a new 1.5 mL centrifuge tube to obtain the protein sample to be tested.

[0144] Development and analysis: (1) The protein sample concentration was quantitatively detected using the BCA kit. 200 μL of BCA working solution and 10 μL of the sample to be tested were added to prepare a mixture. According to the measured protein sample concentration, the corresponding volume of the mixture was taken into a 1.5 mL centrifuge tube according to the protein content of 10 μg. Water was added to make up to 24 μL. 6 μL of 5× loading buffer was added and purified water was added to make up to 30 μL. The mixture was boiled to denature the protein. Samples with a volume equivalent to 3 μg of protein were taken for loading. The loading volume of the protein marker (Beijing Solarbio Science & Technology Co., Ltd., catalog number: PR1910) was 4 μL. Electrophoresis was then performed at 200V for 30 min. The gel was removed and a transfer "sandwich" was made. The negative electrode plate was covered and the transfer program was set to 21V, 23V, and 25V for 1 min, 4 min, and 2 min, respectively. Then the membrane was blocked at room temperature for 1 h. Primary antibody incubation: Incubation at room temperature for 1 h. Antibody preparation (1:2000 dilution): Take 7.5 μL of antibody (Anti-hHGF antibody) and add 15 mL of primary antibody dilution buffer. (2) Wash the membrane: Use 1×TBST buffer solution as the washing buffer, 5 min / time, 3 times. (3) Secondary antibody incubation: Incubate at room temperature for 1 h. Antibody preparation (1:1000 dilution): Take 30 μL of antibody and add 30 mL of secondary antibody (HRP-conjugated Anti-Goat IgG Secondary Antibody) dilution buffer. (4) Wash the membrane: Use 1×TBST buffer solution diluted with distilled water as the washing buffer for washing, 5 min / time, 3 times. (5) Color development: Mix 1 mL each of developing solution and fixing solution, drop onto the membrane for color development, and take a picture.

[0145] The Western Blot results of the corresponding protein samples after transfection of cells with the mRNA stock solutions prepared in Example 2 are shown below. Figure 1 The results showed that, except for AB01 and AB03, all other groups had obvious hHGF protein bands.

[0146] Example 5: ELISA detection of hHGF expression in cells

[0147] The expression of hHGF in cells was detected using a double-antibody sandwich ELISA method. Anti-HGF antibodies were pre-coated onto an ELISA plate. Standards and samples were added to the wells, respectively. HGF in the samples bound to the antibodies on the solid-phase support. After incubation, unbound samples were washed away. Then, anti-HGF detection antibodies were added to form a double-antibody sandwich. Unbound detection antibodies were washed away, and then enzyme conjugates were added to the wells. After incubation and washing, the substrate TMB was added. The HGF content in the sample was positively correlated with the color intensity of the TMB reaction. The reaction was terminated by adding acid, and the absorbance was measured. A standard curve was plotted based on the absorbance values ​​of serially diluted HGF standards, and the sample concentration was determined. Details are as follows: 5.1 Reagent preparation: 1. Before use, bring the required reagents to room temperature. If crystals precipitate in the concentrate, gently shake the reagents at room temperature until the crystals are completely dissolved.

[0148] 2. Standards: Add 0.9 mL of standard / sample diluent R1 to the lyophilized product, mix gently for at least 15 min to completely dissolve the lyophilized product to a concentration of 8000 pg / mL, and perform serial dilutions at 8000, 4000, 2000, 1000, 500, 250, 125, and 0 pg / mL.

[0149] 3. Concentrated biotinylated antibody (30x): Dilute the concentrated biotinylated antibody at a ratio of 1:30 with biotinylated antibody diluent (R2) before use.

[0150] 4. Concentrated Streptavidin-HRP (30x): Before use, dilute the concentrated Streptavidin-HRP at a ratio of 1:30 with Streptavidin-HRP diluent (R3).

[0151] 5. Washing solution: Dilute the washing solution with double-distilled water or deionized water at a ratio of 1:20 before use. Transfect 293T cells with the HGF mRNA stock solution, and quantitatively detect HGF protein expression levels using ELISA.

[0152] 5.2 Sample Preparation

[0153] 1. Cell plating: After digesting 293T cells, follow the regimen of 1.5 × 10⁻⁶ cells / mL. 5 Seeds were seeded at 24-well plates, with 500 µL of cell suspension added to each well. Cells were incubated at 37°C in a 5% CO2 incubator for 24 h.

[0154] 2. Cell transfection: Transfect cells at a dose of 750 ng of the stock solution (cap analogue CAP1) using Lipofectamine. TM MessengerMAX TMReagent transfection reagent), 1 μg of plasmid was transfected (using Novizan transfection reagent), and the diluted and mixed sample was added to HEK293T cells. Each sample was transfected into one well, and the 24-well plate was incubated at 37°C and 5% CO2 for 18 h.

[0155] 3. Cell collection: Collect intracellular proteins and culture supernatant from 293T cells according to the instructions of the Human HGF ELISA Kit (manufacturer: Abclonal, catalog number: RK04211).

[0156] 5.3 Operating Procedures: 1. Prepare all reagents, standards, and samples as described above. Remove the unused microplate strips from the plate frame, put the remaining strips back into the aluminum foil bag containing the desiccant, and then reseal and store them.

[0157] 2. Add 100 μL of standard / sample diluent (R1) to the blank well.

[0158] 3. Add 100 μL of standard or sample of different concentrations to the other wells, seal the wells with the provided sealing film, and incubate at 37°C for 90 min.

[0159] 4. Prepare the working solution of biotinylated antibody (30x) 15 minutes before use.

[0160] 5. Discard the liquid in the wells. Add 350 μL of 1x washing buffer to each well, let stand for 40 seconds, and then discard the liquid. Repeat this washing step 5 times.

[0161] 6. Add biotinylated antibody working solution (100 μL / well) to each well, cover with a new sealing film, and incubate at 37°C for 60 min.

[0162] 7. Prepare the working solution of streptavidin-HRP (30x) 15 minutes before use.

[0163] 8. Repeat the washing steps in step 5.

[0164] 9. Add streptavidin-HRP working solution (100 μL / well) to each well, cover with a new sealing film, and incubate at 37°C for 30 min.

[0165] 10. During incubation, turn on the microplate reader and preheat for 30 minutes before taking measurements.

[0166] 11. Repeat the washing steps in step 5.

[0167] 12. Add TMB substrate (100 μL / well) to the wells. Incubate at 37°C in the dark for 15 min.

[0168] 13. Add stop solution (100 μL / well) and immediately place the well in a microplate reader. Measure the OD value of each well at 450 nm within 3 min.

[0169] 5.4 Calculation of Results

[0170] 1. Calculate the average OD value of each concentration of standard protein, quality control, and sample replicates. The OD value of the blank well and the OD value of the second wavelength should be subtracted from the OD value of each test.

[0171] 2. Plot a standard curve using the OD values ​​obtained from the tests, and fit it using 4-PL. Use computer software to plot the standard curve with absorbance (OD) as the ordinate (Y) and the corresponding HGF standard concentration as the abscissa (X). The concentration of the sample can be calculated from the standard curve based on its OD value.

[0172] 3. The sample was diluted during loading and testing; the concentration needs to be multiplied by the corresponding dilution factor. The results are shown in Table 8 below.

[0173] Table 8. ELISA detection of hHGF protein expression

[0174] Experimental results are as follows Figure 2 As shown in Table 8, the expression of the target protein hHGF was detected in all groups. Normalized to AB02, the expression levels of groups AB05, AB06, AB07, AB09, AB14, AB16, AB19, AB22, AB23, AB24, and AB25 were all higher than those of group AB02.

[0175] Example 6: Validation of in vivo expression of hHGF protein

[0176] Seven-week-old male BALB / c mice weighing 20-22 g were injected intramuscularly with mRNA-LNP (cap analog CAP1) in a single injection (n=3 mice for each time point). Protein levels in the gastrocnemius muscle and serum were measured at 2h, 6h, 24h, 48h, 72h, 96h, 120h, 168h and 336h after injection.

[0177] 6.1 Experimental Grouping

[0178] The mice were grouped and treated as shown in Table 9 below.

[0179] Table 9. Mouse grouping and treatment

[0180] 6.2 Facilities

[0181] Laboratory animals are raised in accordance with ethical principles and common methods of laboratory animal husbandry and management, and undergo 3-7 days of acclimatization before the experiment.

[0182] 6.3 Experimental Procedure

[0183] (1) Randomized grouping for modeling and drug administration

[0184] Based on body weight, mice were divided into 12 groups, with each group having 9 detection time points and 3 mice at each time point. Mice were injected intramuscularly with Collategene plasmid and mRNA-LNP in the gastrocnemius muscle in a single injection. Protein levels in the gastrocnemius muscle and serum were measured at 2h, 6h, 24h, 48h, 72h, 96h, 120h, 168h and 336h after injection.

[0185] (2) Detection indicators

[0186] At the corresponding time points, blood was collected from the heart of mice and added to anticoagulant tubes (anticoagulant: EDTA-K2). Plasma of at least 100 μL was collected, frozen to -20°C, and the expression of the target protein was detected using ELISA. At the corresponding time points, gastrocnemius muscle from the drug-treated side was collected, flash-frozen in liquid nitrogen, and then transferred to -80°C. Subsequent ELISA detection of the target protein expression was performed, and the results are shown in Table 10 below.

[0187] Table 10. hHGF protein expression levels (pg / mg) in mouse muscle tissue Indicates the significance of the comparison with group AB02: where This indicates that p < 0.05. This indicates that p < 0.01. # indicates p < 0.001; # indicates significance compared to AB25: where # indicates p < 0.05, ## indicates p < 0.01, and ### indicates p < 0.001.

[0188] The results of hHGF protein detection in mouse muscle tissue are as follows: Figure 3 As shown in Table 10, AB01 expressed extremely low levels of hHGF protein, close to background levels; AB02, AB06, AB07, AB09, AB14, AB16, AB23, and AB25 reached their maximum hHGF protein expression at 24 h post-drug administration; AB05 and AB19 reached their maximum hHGF protein expression at 6 h post-drug administration. Compared with the saline group, hHGF protein expression was significantly increased in all groups except AB01, indicating normal hHGF protein expression. Compared with AB02 and AB25, the optimized sequence showed significantly increased hHGF protein expression. hHGF expression was not detected in plasma in any of the groups.

[0189] Example 7: Validation of the therapeutic function of hHGF-expressing mRNA in a mouse model of lower limb ischemia

[0190] BALB / c mice are a common experimental model of lower limb ischemia, established by unilateral ligation of the femoral and popliteal arteries in the hind limb, to simulate lower limb ischemia in humans. BALB / c mice exhibit decreased blood flow and necrosis in the lower limbs after ischemia. This study investigates whether a test drug has a therapeutic effect on this mouse model of unilateral lower limb ischemia induced by intramuscular injection.

[0191] 7.1 Animal Modeling

[0192] Six- to eight-week-old male BALB / c mice were selected and allowed free access to food and water for acclimatization. Mice in the model group were anesthetized and fixed in a supine position. The skin at the surgical site was disinfected. A 1-cm incision was made from the knee towards the inner thigh. Subcutaneous adipose tissue was dissected to fully expose the femoral artery. The membranous femoral sheath was gently pierced with micro-forceps to expose the neurovascular bundle. The femoral artery and femoral vein were separated, and the proximal portion of the nerve near the groin was isolated. After thorough separation, the proximal femoral artery was ligated with 6-0 sutures below it. The femoral artery and femoral vein were separated distally near the knee, and the popliteal artery (ligated at the bifurcation of the popliteal and saphenous arteries) was ligated with 6-0 sutures below it. The wound was sutured. For three consecutive days post-surgery, the model mice were injected with sodium penicillin for anti-infection treatment.

[0193] 7.2 Animal Grouping

[0194] After acclimatization, the animals were randomly divided into 6 groups according to their body weight, as shown in Table 11 below. These groups include the G1 blank control group (no modeling, corresponding to...). Figure 4-5 The saline-normal group and the G2 model control group (corresponding to) Figure 4-5 (In the saline-modeling group), G3-G6 are different test sample groups (corresponding to...) Figure 4-5 The mRNAs in groups AB01, AB02 (mRNA-LNP), AB07 (mRNA-LNP), and AB25 (mRNA-LNP) were modified with CAP1 at the 5' end. Blood flow was measured on the day of model establishment. After successful model establishment, the mRNAs were administered intramuscularly in groups, and the day of administration was recorded as Day 0.

[0195] Table 11 Grouping Information

[0196] 7.3 Detection Indicators

[0197] (1) General observation

[0198] All surviving mice in each group were observed once a day during the experiment, including whether the animals were dead or dying, their mental state, behavior, fecal characteristics, and the supply of feed and water.

[0199] (2) Laser speckle blood flow detection

[0200] Before drug administration (Day 0) and on Day 4, Day 7, Day 10, and Day 14 after modeling, blood flow in the affected and unaffected lower limbs of all surviving mice was detected using a laser speckle blood flow imaging system; drug administration was performed in groups based on the imaging data.

[0201] (3) Immunohistochemical staining

[0202] At the end of the experiment, the calf muscles (gastrocnemius muscles) on the surgical side of all surviving mice were collected, fixed with 4% paraformaldehyde, and subjected to immunofluorescence staining.

[0203] 7.4 Data Processing and Statistical Analysis

[0204] Experimental data are expressed as mean ± standard deviation (Mean ± SD). Data plotting and statistical analysis were performed using analytical software. One-way ANOVA was used to compare differences among multiple groups; when variances were homogeneous according to the Leven test, the LSD method was used for post-hoc multiple comparisons; when variances were unequal, the Dunnett T3 method was used for post-hoc multiple comparisons. P < 0.05 indicates a statistically significant difference. p <0.05, p <0.01, p <0.001.

[0205] The results are as follows Figure 4 As shown in Figure A, blood flow imaging of the mouse lower limbs at D14 indicated that AB07 could promote vascular recovery in ischemic lower limbs. Figure 4 B shows the change in the blood perfusion ratio of the affected side of the mouse over time. Compared with the control group, the blood perfusion ratio of AB01, AB02 and AB25 was significantly improved; the blood perfusion ratio of AB07 was significantly better than that of AB02 and AB25.

[0206] To verify its role in promoting angiogenesis in a mouse model of lower limb ischemia, gastrocnemius muscle samples near the ischemic tissue were collected on day 15 after drug administration. Paraffin sections were prepared, and the samples were immunohistochemically stained with anti-CD31 antibody. Images were taken, and the stained area was calculated. The results are as follows: Figure 5 As shown, compared with the saline model group, the CD31 positive area of ​​AB01, AB02, AB07 and AB25 was significantly increased.

[0207] Example 8: Validation of the therapeutic function of mRNAs expressing hHGF with different cap structures at the 5' end in a mouse model of lower limb ischemia.

[0208] 8.1 Modeling Method

[0209] The operation is the same as in Example 7.

[0210] 8.2 Animal Grouping

[0211] After acclimatization, the animals were randomly divided into 4 groups according to their body weight, as shown in Table 12 below. These groups included the G1 blank control group (no modeling was performed, corresponding to...). Figure 6 The saline-normal group and the G2 model control group (corresponding to) Figure 6 The saline-model group), G3 is the AB07 mRNA-LNP test sample group with CAP1 modification at the 5' end of the mRNA (corresponding to...). Figure 6 The AB07-CAP1 group and G4 group are AB07 mRNA-LNP test samples with YK-CAP-110 modification at the 5' end of the mRNA (corresponding to respectively). Figure 6 (AB07-CAP110 group). Blood flow was measured on the day of model establishment. After the model was determined to be successful, the group was divided into groups and administered the drug via intramuscular injection. The day of drug administration was recorded as Day 0.

[0212] Table 12 Grouping Information

[0213] 8.3 Detection Indicators

[0214] (1) General observation

[0215] All surviving mice in each group were observed once a day during the experiment, including whether the animals were dead or dying, their mental state, behavior, fecal characteristics, and the supply of feed and water.

[0216] (2) Laser speckle blood flow detection

[0217] Before drug administration (Day 0) and on Day 4, Day 7, Day 10, and Day 14 after modeling, blood flow in the affected and unaffected lower limbs of all surviving mice was detected using a laser speckle blood flow imaging system; drug administration was performed in groups based on the imaging data.

[0218] 8.4 Data Processing and Statistical Analysis

[0219] Experimental data are expressed as mean ± standard deviation (Mean ± SD). Data plotting and statistical analysis were performed using analytical software. One-way ANOVA was used to compare differences among multiple groups; when variances were homogeneous according to the Leven test, the LSD method was used for post-hoc multiple comparisons; when variances were unequal, the Dunnett T3 method was used for post-hoc multiple comparisons. P < 0.05 indicates a statistically significant difference. This indicates a comparison with the model saline group: p <0.05, p <0.01, p <0.001.

[0220] The results are as follows Figure 6 As shown, the change in the blood perfusion ratio of the affected side of mice over time was compared with that of the model control group. The blood perfusion ratio of AB07 with CAP1 and YK-CAP-110 modified at the 5' end of mRNA was significantly improved. The blood perfusion ratio of the ischemic lower limbs in both groups gradually recovered over time.

[0221] Example 9: Therapeutic effect of different doses of hHGF mRNA-LNP on a mouse model of lower limb ischemia

[0222] 9.1 Modeling Method

[0223] The operation is the same as in Example 7.

[0224] 9.2 Animal Grouping

[0225] After acclimatization, the animals were randomly divided into 8 groups according to their body weight, as shown in Table 13 below. These groups include the G1 blank control group (no modeling, corresponding to...). Figure 7 The saline-normal group and the G2 model control group (corresponding to) Figure 7 (In the saline-modeling group), G3 is the AB01 plasmid group (corresponding to) Figure 7 The AB01-200 μg group, and G4 and G5 are different doses of the AB02 mRNA-LNP test sample groups (corresponding to...). Figure 7 The groups containing AB02-0.5 μg and AB02-0.1 μg were G6-G8, which were different doses of the AB07 mRNA-LNP test sample (corresponding to...). Figure 7 The mRNA in the G4-G8 groups (AB07-1 μg, AB07-0.5 μg, and AB07-0.1 μg groups) had a YK-CAP-110 modification at the 5' end. Blood flow was measured on the day of model establishment. After successful model establishment, the mRNA was administered intramuscularly to the selected groups, and the day of administration was recorded as Day 0.

[0226] Table 13 Grouping Information

[0227] 9.3 Detection Indicators

[0228] (1) General observation

[0229] All surviving mice in each group were observed once a day during the experiment, including whether the animals were dead or dying, their mental state, behavior, fecal characteristics, and the supply of feed and water.

[0230] (2) Laser speckle blood flow detection

[0231] Before drug administration (Day 0) and on Day 4, Day 7, Day 10, and Day 14 after modeling, blood flow in the affected and unaffected lower limbs of all surviving mice was detected using a laser speckle blood flow imaging system; drug administration was performed in groups based on the imaging data.

[0232] (3) Lower extremity ischemia-necrosis score

[0233] Testing time: Day 14 after drug administration.

[0234] Test content: Photograph the hind limbs of mice to observe the necrosis. Scoring criteria: 0 = hind limb detaches spontaneously; 1 = leg necrosis; 2 = foot necrosis; 3 => 2 toes discolor; 4 = 1 toe necrosis; 5 => 2 nails discolor; 6 = 1 nail discolor; 7 = no necrosis.

[0235] 9.4 Data Processing and Statistical Analysis

[0236] Experimental data are expressed as mean ± standard deviation (Mean ± SD). Data plotting and statistical analysis were performed using analytical software. One-way ANOVA was used to compare differences among multiple groups; when variances were homogeneous according to the Leven test, the LSD method was used for post-hoc multiple comparisons; when variances were unequal, the Dunnett T3 method was used for post-hoc multiple comparisons. P < 0.05 indicates a statistically significant difference. p <0.05, p <0.01, p <0.001.

[0237] The results are as follows Figure 7The results showed that the blood perfusion ratio of the affected side in mice changed over time. Compared with the same dose of AB02, the blood perfusion ratio of the high, medium, and low dose groups of AB07 was significantly improved, and the blood perfusion ratio of the ischemic lower limb gradually recovered over time. Figure 7 (A); compared with the saline model group, the necrosis scores of all dose groups of AB02 and AB07 were significantly improved (A); Figure 7 B).

[0238] Example 10: Toxicological assay of hHGF-expressing mRNA-LNP in rats

[0239] The purpose of this study was to administer the test substance to SD rats via intramuscular (gastrocnemius) injection once a week for 5 consecutive weeks (a total of 5 administrations), without a recovery period, and to observe its toxic effects.

[0240] Rats were screened for inclusion in the study using body weight and clinical data. The rats were randomly assigned to groups based on body weight, ALT, and AST levels: one saline control group, one empty LNP control group, and two test substances (different doses) with YK-CAP-110 modification at the 5' end of the mRNA. Specific groupings and dosages are shown in Table 14 below. Each group consisted of eight rats, half male and half female.

[0241] Table 14 Grouping Information

[0242] Blood samples were collected 6 hours after the last dose for cytokine detection, and 24 hours later for complete blood count and blood biochemistry tests. Results are as follows: Figure 8 Tables 15 and 16.

[0243] Table 15 Blood Routine Test Results Indicates significance compared to the saline group: where p<0.05, This indicates that p < 0.01.

[0244] Compared with the saline group, the number of white blood cells and neutrophils increased in the empty LNP, AB02 and AB07 groups after drug administration, indicating that the change in cell number was caused by LNP.

[0245] Table 16 Blood Biochemistry Test Results Indicates significance compared to the saline group: where This indicates that p < 0.05. This indicates that p < 0.01.

[0246] Compared with the saline group, both the low-dose and high-dose AB02 groups showed elevated CK and LDH levels after administration; AST also increased in the high-dose AB02 group. With AB07, only the high-dose group showed increased CK and LDH levels. Elevated CK and LDH indicate skeletal muscle damage accompanied by muscle cell rupture; elevated AST indicates abnormal liver metabolism. Compared with empty LNP, there were no significant changes in the measured indicators across the AB02 and AB07 dosage groups. This result indicates that AB07 has better safety.

[0247] Cytokine results as follows Figure 8 As shown, compared with the saline group, IL-10 secretion in the AB07 group was significantly increased 6 hours after the last administration, returning to a level indistinguishable from the control group after 24 hours. No significant differences were observed in IL-1β, IL-2, IL-4, IL-5, IL-6, IFN-γ, and TNF-α. This result indicates that the increase in IL-10 induced by the test sample is transient, and the test sample has a weak effect on cytokine release. In conclusion, AB07 exhibits excellent safety.

[0248] The sequences involved in this disclosure are as follows: SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 SEQ ID NO: 5 SEQ ID NO: 6 SEQ ID NO: 7 SEQ ID NO: 8 SEQ ID NO: 9 SEQ ID NO: 10 SEQ ID NO: 11 SEQ ID NO: 12 SEQ ID NO: 13 SEQ ID NO: 14 SEQ ID NO: 15 SEQ ID NO: 16 SEQ ID NO: 17 SEQ ID NO: 18 SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21 SEQ ID NO: 22 Coding sequence of 5'UTR (SEQ ID NO: 23) AGCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGGCCACC Coding sequence of 3'UTR (SEQ ID NO: 24) GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC Poly(A) (SEQ ID NO: 25) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 26 SEQ ID NO: 27 While specific embodiments of this disclosure have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of this disclosure. Therefore, the scope of protection of this disclosure is defined by the appended claims.

Claims

1. An isolated nucleic acid molecule encoding hHGF, characterized in that, The nucleic acid molecule includes a nucleotide sequence as shown in any of SEQ ID NO: 4-22.

2. A nucleic acid construct, characterized in that, The nucleic acid construct comprises one or more nucleic acid molecules as described in claim 1.

3. The nucleic acid construct as described in claim 2, characterized in that, The nucleic acid construct also includes nucleic acid molecules encoding one or more of 5'UTR, 3'UTR, and poly(A); Preferably, the nucleotide sequence of the nucleic acid molecule encoding the 5'UTR is shown in SEQ ID NO: 23; The nucleotide sequence of the nucleic acid molecule encoding the 3'UTR is shown in SEQ ID NO: 24; and / or, The nucleotide sequence of the nucleic acid molecule encoding poly(A) is shown in SEQ ID NO:

25.

4. A recombinant vector, characterized in that, The recombinant vector comprises the nucleic acid molecule as described in claim 1 or the nucleic acid construct as described in claim 2 or 3; Preferably, the recombinant vector is a plasmid, a granule, or a viral vector, and the viral vector is preferably a bacteriophage, a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

5. A transformant, characterized in that, The transformant contains the nucleic acid molecule as described in claim 1, the nucleic acid construct as described in claim 2 or 3, or the recombinant vector as described in claim 4.

6. An mRNA, characterized in that, The mRNA includes the mRNA sequence encoded by the nucleic acid molecule as described in claim 1 or the nucleic acid construct as described in claim 2 or 3, or a modified sequence thereof; Preferably, the mRNA sequence is codon-optimized.

7. The mRNA as described in claim 6, characterized in that, The mRNA sequence contains at least one base modification; the base modification preferably includes any one or more of the following: pseudouridine, N1-methylpseuuridine, N1-ethylpseuuridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseuuridine, 2-thio-1-methylpseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methylpseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methoxyuridine, and 2'-O-methyluridine; and / or, The 5' end of the mRNA is attached to a 5' cap structure; the 5' cap structure is preferably Cap 0, Cap 1, Cap 2 or similar structures.

8. The mRNA as described in claim 7, characterized in that, The base modification includes replacing uridine with pseudouridine and / or N1-methylpseudouridine; and / or, The base modification is 1% to 100% base modification; and / or, The 5' cap structure has the structure shown in formula (I): Where n is selected from 1 or 0; m is selected from 1 or 0; X1 is selected from -C(OH)H- or a single bond; X2 is selected from -CH-, -O-, -CN, -C(O)-, Or a single key; X3 is selected from -CH2, -CFH-, or -O-; R1 is selected from -OH or -NHAc; R2 is selected from -CH3, -F, -H, or does not exist; R3 is selected from -OR6, -NHC(O)R7, -N(R8)2, -CN, -F, -C(O)N(R9)2, substituted or unsubstituted C 1- C3 alkyl group, -H or absent; R4 is selected from -CH3, -F, or -H; R5 is selected from -OR 10 -NHC(O)R 11 -N(R) 12 )2、-CF2H、-F、-C(O)N(R 13 2. Substituted or unsubstituted C 1- C3 alkyl groups may not be present; R6, R8, R 10 R 11 R 12 and R 13 Each is independently selected from unsubstituted C1-C3 alkyl groups or -H; R7 is selected from -OR 14 -NHC(O)R 15 -F or substituted or unsubstituted C 1- C3 alkyl; R9 is selected from unsubstituted C2-C3 alkyl groups; R 14 and R 15 Each is independently selected from unsubstituted C1-C3 alkyl groups.

9. The mRNA as described in claim 7 or 8, characterized in that, The base modification includes replacing all uridines in the sequence with N1-methylpseudouridine or pseudouridine; and / or, The structural formula of the 5' cap structure is as follows: ;or, 。 10. A method for preparing mRNA, characterized in that, The method includes obtaining the mRNA by transcription based on the nucleic acid molecule as described in claim 1 or the nucleic acid construct as described in claim 2 or 3; Optionally, the transcription process includes a capping reaction.

11. A composition, characterized in that, The composition comprises lipid nanoparticles and mRNA as described in any one of claims 6-9 encapsulated in the lipid nanoparticles.

12. The use of one or more of the nucleic acid molecule of claim 1, the nucleic acid construct of claim 2 or 3, the recombinant vector of claim 4, the transformant of claim 5, the mRNA of any one of claims 6-9, and the composition of claim 11 in the preparation of one or more of the following products: (1) Products that increase hHGF expression levels; (2) Drugs that promote endothelial cell growth and / or migration; (3) Drugs that promote angiogenesis; (4) Drugs that promote nerve damage repair; (5) Medications for the prevention and / or treatment of ischemic diseases, metabolic syndrome, diabetic complications, restenosis, and / or nerve damage; Preferably, the ischemic disease is selected from coronary artery disease, peripheral artery disease, myocardial infarction, limb ischemia, and thromboangiitis obliterans; preferably, the limb ischemia is lower limb ischemia, more preferably, the limb ischemia is severe lower limb ischemia; and / or, The diabetic complications are selected from diabetic peripheral neuropathy, diabetic foot, diabetic arteriosclerosis obliterans; and / or, The restenosis is selected from restenosis following percutaneous coronary intervention, restenosis following bypass surgery, and restenosis caused by ischemia-reperfusion injury; and / or, The nerve injury is selected from neurodegenerative diseases, traumatic nerve injury, and peripheral neuropathy; preferably, the neurodegenerative diseases are selected from amyotrophic lateral sclerosis, Parkinson's disease, and Alzheimer's disease, and the peripheral neuropathy is diabetic peripheral neuropathy.

Images