Preparation method and antioxidant application of small-cup fungus genus fungi cordis with antioxidant activity

Abstract

The application relates to a preparation method and antioxidant application of a small-cortex fungus mycelium with antioxidant activity. First, a wild small-cortex fungus strain, specifically a black-brown small-cortex fungus with the number LX230921-01, is obtained through field separation; then, a pure culture is obtained through purification, and a mycelium product is obtained in the subsequent culture process; the mycelium product has antioxidant activity and can be used in antioxidant occasions, such as cosmetics (face cream, face mask, hand cream, etc.) and oral products; the dry weight yield of the mycelium is high, artificial mass production can be realized, the antioxidant product demand can be met, and thus the wild picking can be reduced, and the wild resources can be protected.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and provides a method for preparing mycelial cords of the genus *Amanita* with antioxidant activity and their antioxidant applications. Background Technology

[0002] Marasmius Fr., belonging to the phylum Basidiomycota, order Agaricales, family Agaricales. The dark brown Marasmius collected in this invention has fruiting bodies growing in clusters. The cap is membranous, hard, 0.5-0.8 cm wide, hemispherical, with a central hilum and radial stripes, dark brown to blackish-brown; gills are adnate, of equal length, forming a collar; stipe is central, smooth, hairless, brittle, blackish-brown, 6-10 cm long and 0.5-1 mm thick; mycelial cords are well-developed. Basidiospores are elliptical, colorless, and transparent; the hyphae in the cap cortex are arranged in a palisade pattern, composed of broom-like cells.

[0003] Mycelial cords are a special structure in fungi, usually composed of tightly intertwined hyphae, resembling plant roots in appearance, hence also known as "rhinoid roots." The main function of mycelial cords is to help fungi expand in the environment, absorb nutrients, and survive under adverse conditions.

[0004] There is little mention in the existing technology of the artificial preparation and antioxidant application of mycelial cords of the genus *Scutellaria*. The applicant and inventors believe it is necessary to explore and research this area in order to increase the production of such products to meet the market demand for antioxidant products and reduce the damage to resources caused by wild harvesting. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide a method for preparing mycelial cords of *Amanita muscaria* fungi with antioxidant activity and their antioxidant applications.

[0006] To achieve the above objectives, the technical solution adopted by this invention is: a method for preparing mycelial cords of *Amanita phalloides* fungi with antioxidant activity, comprising the following steps: ①. Isolation, purification and culture: Wild-type *Amanita muscaria* strains were collected, and the isolates were obtained by separating the mycelium from the flesh tissue at the junction of the cap and stipe. The isolates were placed on PDA slant medium in test tubes and cultured at room temperature. After 3 days of culture, the germinating white mycelium was observed. After 5 days, the mycelium grew stably and was not contaminated by other bacteria. After the test tubes were fully colonized, the mycelium was taken for sequencing. The sequence obtained was consistent with the sequence of the fruiting body, thus obtaining a pure culture strain. ②. Expand cultivation The bacterial strain obtained after step ① was transferred to PDA medium, expanded cultured, and cultured at room temperature for 15 days under dark conditions at 20-25℃. ③. Mycelium production The bacterial strain obtained in step ② was inoculated into PDA medium in a test tube and cultured statically at room temperature (20-25℃) in the dark for 15 days. The mycelial cord was then expanded and cultured at 20-25℃ to obtain a mycelial cord product with a dry weight of 0.1-0.3 g / ml.

[0007] Preferably, the PDA culture medium is calculated in grams per 1000 ml as follows: 12 g potato extract powder, 20 g glucose, 20 g agar powder, natural pH, and pure water to prepare a volume of 1000 ml.

[0008] An antioxidant application of a fungal mycelium obtained by the above method is proposed for use in cosmetics and oral health supplements.

[0009] The previously mentioned dark brown Marasmius sp. daughter entity ITS sequence showed 84% similarity to the NCBI Blast sequence of Marasmius nigrobrunneus. >Dark brown small leather umbrella Marasmius sp_LX230921-01_ITS GTTGAGCTGGCTCTTCACGGGCATGTGCTCGCCTTTCTTTCAATCTTCATCCACCTGTGCACTTTTTGTAGGGAGCTTTGAGAATAGACCTTTCGGGGTTTTTAATAATGGGCTCTCCATGGTTTCCCCCCCTCCTGAATGGATGTCCTTGAATGGCTTTTATAAGGACTTAATTGACCCCTTAAAAACT AAACCACTTTCCACAACGGAACTCCTGGCTCCCCCATCCATGAAAAACCCCACCAAATGGCATAAATAATGGGAATTGCAAAATTCCATGAATCCTCCAATCCTTTAACGCACCTTGGGCCCCCTGGTATTCCCAAAAGGATGCCTGGTTGAATGGCATTAAATTCCCCACTTCCAAAACTTTTGTTTTTT Beneficial effects of this invention: This invention obtains a wild strain of the genus *Mallotus*, specifically *Mallotus purpureus* (number LX230921-01), through field isolation. A pure culture is obtained after purification, and mycelial products are obtained during further cultivation. These mycelial products possess antioxidant activity and can be used in antioxidant applications, such as cosmetics (face creams, masks, hand creams, etc.) and oral products. The mycelial products have a high dry weight yield, enabling large-scale artificial production to meet the demand for antioxidant products. This, in turn, can reduce wild harvesting and protect wild resources. Attached Figure Description

[0010] Figure 1 One of the images of fruiting bodies in the wild. Figure 2 This is the second image of a fruiting body in the wild. Figure 3 This is the third image of a fruiting body in the wild. Figure 4 One of the images of the folded sac. Figure 5 This is the second image of the folded sac. Figure 6 Images of basidiospores taken at a scale of 10 μm; Figure 7 Images of basidiospores taken at a scale of 5 μm; Figure 8 This is a magnified image of the hyphae in the cap cortex; Figure 9 This is a magnified image taken at a scale of 5μm for the hyphae of the cap cortex; Figure 10 Images showing the isolation and purification of bacterial strains; Figure 11 Image of newly sprouted mycelial cords; Figure 12 Image of the prepared mycelial cord. Detailed Implementation

[0011] The specific embodiments of the present invention will be further described in detail below with reference to examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the raw materials involved are all commercially available conventional raw materials; and the test methods involved are all conventional methods.

[0012] Example 1: A method for preparing mycelial cords of *Amanita muscaria* fungi with antioxidant activity, comprising the following steps: ①. Isolation, purification, and culture: Wild-type *Schefflera purpurea* strains were collected, see [reference needed]. Figures 1-3 . Figures 4-9 These are microscopic images of a localized area of ​​the strain.

[0013] The isolate was obtained by isolating the mycelium from the fleshy tissue at the junction of the cap and stipe. The isolate was placed on a PDA slant in test tubes and incubated at room temperature. After 3 days of incubation, the germinating white mycelium was observed. After 5 days, the mycelium grew stably without contamination. Once the test tubes were fully colonized, the mycelium was sequenced. The sequence obtained was consistent with the fruiting body sequence, thus obtaining a pure culture. See [link to relevant documentation]. Figure 10 ; ②. Expand cultivation The bacterial strain obtained after step ① was transferred to PDA medium, expanded cultured, and cultured at room temperature for 15 days under dark conditions at 20-25℃. ③. Mycelium production The bacterial strain obtained in step ② was inoculated into PDA medium in test tubes and cultured statically at 20-25℃ in the dark for 15 days. The mycelial cords were then expanded and cultured at 20-25℃ to obtain a mycelial cord product with a dry weight of 0.1-0.3 g / ml. (See [reference needed]). Figure 11-12 . 、 The PDA culture medium is calculated in grams per 1000 ml: 12 g potato extract powder, 20 g glucose, 20 g agar powder, natural pH, and pure water to prepare a volume of 1000 ml.

[0014] Example 2: An application example of the antioxidant activity of the small bark mycotoxin product prepared in Example 1 above.

[0015] (1). Preparation of aqueous extract of *Amanita muscaria* mycelium Weigh 0.5g of mycelium, grind it into powder, add 20mL of distilled water, and extract at 100℃ for 2h. Centrifuge at 8000 r•min-1 for 15min, collect the supernatant, and then add distilled water to make up to 20ml.

[0016] (2). DPPH removal test Add 75 μL of LDPPH (mass concentration of 0.07 mg / mL) to 25 μL of ethanol, and measure the absorbance value as blank A; Add 75 μL of DPPH to 25 μL of sample and measure the absorbance value as control A. Add 75 μL of ethanol to 25 μL of sample, and measure the absorbance value as A.

[0017] After adding DPPH, react for 30 minutes and measure the absorbance at a wavelength of 517 nm.

[0018] Clearance rate / % = [1 - (A assay - A control) / A blank] × 100%.

[0019] (3) Antioxidant effect DPPH free radical scavenging capacity is an important indicator for evaluating the effectiveness of antioxidants, directly reflecting their resistance to free radicals. The aqueous extract of mycelium showed a DPPH scavenging rate of 41.31-84.43% within spores (mycelium), indicating that the mycelium has strong antioxidant capacity and can be applied to cosmetics (face creams, masks, hand creams, etc.) and oral health supplements.

[0020]

Claims

1. A method for preparing a mycelial cord of a genus of fungi with antioxidant activity, comprising the following steps: ①. Isolation, purification and culture: Wild-type *Amanita muscaria* strains were collected, and the isolates were obtained by separating the mycelium from the flesh tissue at the junction of the cap and stipe. The isolates were placed on PDA slant medium in test tubes and cultured at room temperature. After 3 days of culture, the germinating white mycelium was observed. After 5 days, the mycelium grew stably and was not contaminated by other bacteria. After the test tubes were fully colonized, the mycelium was taken for sequencing. The sequence obtained was consistent with the sequence of the fruiting body, thus obtaining a pure culture strain. ②. Expand cultivation The bacterial strain obtained after step ① was transferred to PDA medium, expanded cultured, and cultured at room temperature for 15 days under dark conditions at 20-25℃. ③. Mycelium production The bacterial strain obtained in step ② was inoculated into PDA medium in a test tube and cultured statically at room temperature (20-25℃) in the dark for 15 days. The mycelial cord was then expanded and cultured at 20-25℃ to obtain a mycelial cord product with a dry weight of 0.1-0.3 g / ml.

2. The method for preparing mycelial cords of *Amanita phalloides* fungi with antioxidant activity as described in claim 1, characterized in that, The PDA culture medium is calculated in grams per 1000 ml: 12 g potato extract powder, 20 g glucose, 20 g agar powder, natural pH, and pure water to prepare a volume of 1000 ml.

3. An antioxidant application of a mycelium of a genus of fungi obtained by any one of claims 1-2, applicable to cosmetics and oral products.

Images