A high-value fermentation broth and a preparation method thereof

Abstract

The present application relates to microbial synthesis of human milk oligosaccharides (HMOs), fatty acids and linoleic acid (LA). It belongs to the field of biotechnology, enzyme engineering, genetic engineering and cell engineering technology. The first aspect of the present application provides a composition containing at least one human milk oligosaccharide, fatty acid linoleic acid and Yarrowia lipolytica, wherein the fatty acid comprises linoleic acid. The second aspect of the present application provides a Yarrowia lipolytica genetically modified cell with improved activity of synthesizing the composition of the first aspect. The third aspect of the present application provides the use of the Yarrowia lipolytica genetically modified cell of the first and second aspects in the synthesis of human milk oligosaccharides, fatty acids and linoleic acid. The present application provides a one-time fermentation synthesis of a composition containing at least one human milk oligosaccharide, fatty acid, which improves the synthesis efficiency of the composition of the first aspect.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to Chinese Patent Application No. CN:202510574161X, filed on April 30, 2025, entitled "A High-Value Fermentation Broth Composition and its Preparation Method", the entire contents of which are incorporated herein by reference and constitute a part of this application for all purposes.

[0003] Technical Field: This invention relates to the microbial synthesis of human lactose oligosaccharides (HMOs) and fatty acids, particularly linoleic acid (LA). It belongs to the fields of enzyme engineering, genetic engineering, and cell engineering within the field of biotechnology. Background Technology

[0004] Researchers have discovered that many of the beneficial effects of breast milk are attributed to human milk oligosaccharides (HMOs). Among these, lactose-N-triose II (LNTII), lactose-N-tetraose (LNT), lactose-N-neotetraose (LNnT), 2'-fucosyllactose (2'-FL), and 3-fucosyllactose (3-FL) are the main components of HMOs, acting as bifidus factors. Studies have shown that adding HMOs to infant formula made primarily from cow's or goat's milk and feeding it to infants can achieve nutritional and immune benefits similar to those of breastfeeding. Therefore, adding physiologically functional HMOs to infant formula, some artificial milk, dairy products, baby food, as well as functional health products or foods for special populations will greatly improve the physical fitness of the corresponding populations and enhance their quality of life.

[0005] Fatty acids are essential nutrients for the human body, with main functions including providing energy, forming cell membranes, participating in hormone synthesis, supporting brain development, and maintaining cardiovascular health. Different types of fatty acids (such as saturated and unsaturated fatty acids) have significantly different effects on health, requiring a balanced diet for proper intake. Linoleic acid (LA) is a polyunsaturated fatty acid, chemically known as methyl cis,cis-9,12-octadecadienoic acid (C18:2n6c). It is mainly found in natural foods such as olive oil, nuts, and avocados. The human body cannot synthesize linoleic acid and must obtain it from food. Deficiency may lead to growth retardation, weakened immunity, and dry skin.

[0006] Currently, there are two main methods for preparing LA: chemical and biological. Due to the cumbersome preparation steps and high costs associated with chemical methods, biological methods have been widely researched and used in recent years. However, their lower efficiency in producing LA limits its large-scale application as a conventional food additive.

[0007] In summary, it is crucial to construct cell factories capable of efficiently synthesizing human milk oligosaccharides (HMOs), fatty acids, and linoleic acid (LA) to meet human health needs and provide processes suitable for industrial applications. Summary of the Invention:

[0008] Objective of the invention: To provide a composition containing human milk oligosaccharides (HMO(s)), fatty acids, and yeast cells, which are beneficial to the human body.

[0009] Another objective of this invention is to provide a polypeptide that can promote the synthesis of linoleic acid, thereby increasing the yield of linoleic acid in fermentation broth.

[0010] Another objective of this invention is to provide a gene-modified cell for synthesizing human lactose oligosaccharides and linoleic acid, thereby improving its synthesis efficiency.

[0011] Technical solution:

[0012] The applicant made a surprising discovery: the fermentation broth used to de novo synthesize human milk oligosaccharides using yeast gene-modified cells also contained abundant fatty acids, particularly linoleic acid (LA). This application achieves its inventive objective through the use of yeast gene-modified cells.

[0013] The first aspect of this application provides a composition containing at least one human milk oligosaccharide, a fatty acid, and yeast gene-modified cells. Preferably, the fatty acid contains linoleic acid.

[0014] Preferably, the human milk oligosaccharide is selected from one or more of the following:

[0015] (1) Lacto-N-triose II (LNT II, ​​molecular formula: C 20 H 35 NO 16 (CAS: 75645-27-1); or

[0016] (2) Lacto-N-tetraose (LNT, molecular formula: C 26 H 45 NO 21 CAS: 14116-68-8), lactose-N-trisaccharide; or

[0017] (3) Lacto-N-neotetraose (LNnT, molecular formula: C 26 H 45 NO 21 CAS: 13007-32-4), lactose-N-trisaccharide; or

[0018] (4) Lactose-N-tetrasaccharide, lactose-N-neotetrasaccharide, lactose-N-trisaccharide; or

[0019] (5) 2'-Fucosyllactose (2'-FL, chemical formula: C 18 H 32 O 15 (CAS: 41263-94-9); or

[0020] (6) 3-Fucosyllactose (3-FL, chemical formula: C 18 H 32 O 15 CAS: 41312-47-4)

[0021] Preferably, when the human milk oligosaccharide is 2'-fucosyllactose as described in (5) above, the composition also contains difucosyllactose (DFL, molecular formula: C 24 H 42 O 19 CAS: 34852-43-2.

[0022] Preferably, the yeast gene-modified cell contains the nucleic acid sequence of delta-12 desaturase.

[0023] Preferably, the yeast gene-modified cells are gene-modified cells with the activity of synthesizing human milk oligosaccharides and fatty acids, including but not limited to gene-modified cells of the genera *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp.

[0024] Preferably, the genetically modified cells include, but are not limited to, genetically modified cells of Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichiapastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides.

[0025] In one embodiment, the human milk oligosaccharide is a lactose-N-trisaccharide, and the genetically modified yeast cell is a genetically modified cell with activities for synthesizing lactose-N-trisaccharides and fatty acids. Preferably, the genetically modified yeast cell contains heterologous nucleic acid sequences of β-N-acetylglucosaminyltransferase and delta-12 desaturase with activities for synthesizing lactose-N-trisaccharides. The β-acetylglucosaminyltransferase is derived from, but is not limited to, the β-acetylglucosaminyltransferases of *Neisseria meningitidis*, *Helicobacter pylori*, or *Salmonella enterica* described in Chinese Patent 202211453172.5 (Invention Title: Recombinant Yeast and Its Application).

[0026] In one embodiment, the human milk oligosaccharide is a lactose-N-tetrasaccharide, and the yeast gene-modified cell is a gene-modified cell with activity in synthesizing lactose-N-tetrasaccharides and fatty acids. Preferably, the yeast gene-modified cell contains nucleic acid sequences of a galactosyltransferase and a delta-12 desaturase with LNT synthesis activity. Preferably, the yeast gene-modified cell includes, but is not limited to, the yeast cell or its gene-modified cell described in Chinese Patent 202510546686.2 (Invention Title: Polypeptide for Synthesizing Tetrasaccharides and Gene-Modified Cell Containing the Gene of the Polypeptide). Preferably, it is a gene-modified Yeast Rice YL-B0 to YL-B9 or YL-B0-J to YL-B9-J; or, as described in Patent ZL202211449962.6 (Invention Title: Mature Polypeptide Sequence for Synthesizing Oligosaccharides and its Application), a nucleic acid sequence of a mature polypeptide with LNT synthesis activity.

[0027] In one embodiment, the human milk oligosaccharide is a lactose-N-neotetrasaccharide, and the genetically modified yeast cell is a genetically modified cell with activity in synthesizing lactose-N-neotetrasaccharide and fatty acid synthesis. Preferably, the genetically modified yeast cell contains nucleic acid sequences of a galactosyltransferase and a delta-12 desaturase with LNnT synthesis activity, including but not limited to the yeast cell or its genetically modified cell described in Chinese Patent 202510546666.5 (Invention Title: Polypeptide for Synthesizing Neotetrasaccharide and Genetically Modified Cell Containing the Gene of the Polypeptide), preferably any one of Yersinia lipolytica YL-A0 to YL-A9 or YL-A0-J to YL-A9-J.

[0028] In one embodiment, the human milk oligosaccharide is lactose-N-tetrasaccharide and lactose-N-neotetrasaccharide, and the yeast genetically modified cell is a genetically modified cell with activities for synthesizing lactose-N-tetrasaccharide and lactose-N-neotetrasaccharide and fatty acid activity. Preferably, the yeast genetically modified cell contains a nucleic acid sequence of a galactosyltransferase with simultaneous LNT and LNnT synthesis activities and a nucleic acid sequence of a delta-12 desaturase. The yeast genetically modified cell includes, but is not limited to, those described in Chinese patents.

[0029] Yeast cells or their gene-modified cells as described in 202510533839.X (Invention Title: Polypeptide for Synthesizing HMOs and Genetically Modified Cells Containing the Gene of the Polypeptide) include any one of Yeast YL-M0 to YL-M8 or YL-M0-J to YL-M8-J, or yeast gene-modified cells containing a heterologous nucleic acid sequence of any mature polypeptide with LNT and LNnT synthesis activity as described in Chinese Patent ZL202211473306X (Invention Title: Mature Polypeptide Sequence for Synthesizing HMOs and its Application) or ZL202211451076.7 (Invention Title: A Mature Polypeptide for Synthesizing Oligosaccharides).

[0030] In one embodiment, the human milk oligosaccharide is 2'-fucosylated lactose, and the yeast gene-modified cell is a yeast gene-modified cell with 2'-fucosylated lactose synthesis activity and fatty acid synthesis activity. Preferably, the yeast gene-modified cell contains the nucleic acid sequences of GDP-fucose synthase, GDP-mannose-dehydrase, α-1,2-fucosyltransferase polypeptide (with α-1,2-fucosyltransfer activity), and delta-12 desaturase. When using α-1,2-fucosyltransferase polypeptides from different sources, such as α-1,2-fucosyltransferase polypeptides from Helicobacter pylori, the product also contains difucosylated lactose. The GDP-fucose synthase includes, but is not limited to, the polypeptide with GDP-fucose synthase activity as described in Chinese Patent Application 202311635360.4 (Invention Title: GDP-fucose synthase polypeptide and its application), the GDP-mannose dehydrating enzyme includes, but is not limited to, the polypeptide with GDP-mannose-4,6-dehydrating enzyme activity as described in Chinese Patent Application 202311640201.3 (Invention Title: A GDP-mannose dehydrating enzyme polypeptide and its application), and the α-1,2-fucosyltransferase includes, but is not limited to, the α-1,2-fucosyltransferase polypeptide with 2'-fucosyllactose synthesis activity as described in 202311372479.7 (Invention Title: A fucosyltransferase polypeptide and its application).

[0031] In one embodiment, the human milk oligosaccharide is 3-fucosyllactose, and the yeast gene-modified cell is a yeast gene-modified cell with activity in synthesizing 3-fucosyllactose and fatty acids. Preferably, the yeast contains heterologous nucleic acid sequences of GDP-fucose synthase, GDP-mannose-4,6-dehydrase, α-1,3-fucosyltransferase polypeptide, and delta-12 desaturase nucleic acid sequence. The GDP-fucose synthase includes, but is not limited to, the polypeptide with GDP-fucose synthase activity as described in Chinese Patent Application 202311635360.4 (Invention Title: GDP-fucose synthase polypeptide and its application), the GDP-mannose dehydrating enzyme includes, but is not limited to, the polypeptide with GDP-mannose-4,6-dehydrating enzyme activity as described in Chinese Patent Application 202311640201.3 (Invention Title: A GDP-mannose dehydrating enzyme polypeptide and its application), and the α-1,3-fucosyltransferase includes, but is not limited to, the α-1,3-fucosyltransferase polypeptide with 3-fucosyllactose synthesis activity as described in 202410206745.7 (Invention Title: Fucosyltransferase polypeptide and its application).

[0032] Preferably, the yeast gene-modified cells synthesized as described above, containing at least one human milk oligosaccharide, fatty acid, and yeast gene-modified cell composition, contain the nucleic acid sequence of delta-12 desaturase, preferably Yeast lipolytica gene-modified cells, or other yeast gene-modified cells incorporating the delta-12 desaturase nucleic acid sequence.

[0033] Preferably, the yeast gene-modified cells are gene-modified cells with the activity of synthesizing human milk oligosaccharides and fatty acids, including but not limited to gene-modified cells of the genera *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc.

[0034] Preferably, the genetically modified cells include, but are not limited to, genetically modified cells of Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichiapastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides.

[0035] Preferably, the yeast gene-modified cell contains nucleic acid sequences for synthesizing target human milk oligosaccharides and fatty acids.

[0036] Preferably, the yeast gene-modified cells are selected from Saccharomyces cerevisiae and Yarrowia lipolytica, which contain a heterologous nucleic acid sequence of lactose transporter (Lac12).

[0037] The lactose transporter protein is responsible for transferring lactose from the extracellular space to the intracellular space. In some embodiments, the sources of the lactose transporter protein include, but are not limited to, Neurospora crassa, Kluyveromyces lactis, Kluyveromyces marxianus, Helicobacter pylori, Magnaphothe oryzae, Phialophora attae, Rhizobium meliloti, Zymomonas mobilis, or Escherichia coli.

[0038] A second aspect of this application provides a novel delta-12 desaturase, which is a peptide derived from the polypeptide with the amino acid sequence shown in SEQ ID NO:1. The microbial source of the polypeptide shown in SEQ ID NO:1 is Yarrowialipolytica ATCC 20460, GenBank accession no. CR382128.

[0039] Preferably, the derived peptide has an amino acid sequence that is at least 70% identical to SEQ ID NO:1 and has the activity of synthesizing fatty acids and linoleic acid.

[0040] Preferably, the derivative peptide of the polypeptide shown in SEQ ID NO:1 is selected from any of the following mutation modes:

[0041] (1) Insert SALPKQNPALRRTVT between the 4th and 5th amino acids of the polypeptide whose amino acid sequence is as shown in SEQ ID NO:1 to obtain polypeptide C1.

[0042] (2) Insert DSPRH between amino acids 19 and 20 of polypeptide C1 to obtain polypeptide C2.

[0043] (3) Insert DIAKPKSEYGV3 between amino acids 32 and 33 of polypeptide C1 to obtain polypeptide C3.

[0044] (4) Inserting PE between amino acids 90 and 91 of polypeptide C3 yields polypeptide C4.

[0045] (5) Inserting KM between the 186th and 187th amino groups of polypeptide C4 yields polypeptide C5.

[0046] (6) Insert EGRGKGKHNGLG between amino acids 231-232 of polypeptide C5 to obtain polypeptide C6.

[0047] (7) Inserting GPRG between amino acids 378 and 379 of polypeptide C6 yields polypeptide C7.

[0048] (8) PSA is inserted between amino acids 394 and 395 of polypeptide C7 to obtain polypeptide C8.

[0049] (9) Insert GAGK between amino acids 378 and 379 of polypeptide C8 to obtain polypeptide C9.

[0050] A third aspect of this application provides a polynucleotide encoding any one of the derivative polypeptides C1-C9 as described above.

[0051] Polynucleotides encoding derived polypeptides C1-C9 can be prepared using recombinant DNA techniques known in the art. These methods include, but are not limited to, cloning, recombination, in vitro synthesis, and in vitro amplification.

[0052] A fourth aspect of this application provides a nucleic acid construct comprising the polynucleotides described above.

[0053] The nucleic acid construct, preferably, further contains one or more regulatory sequences operatively linked to the polynucleotide, the regulatory sequences guiding the production of the polypeptide in a suitable expression host.

[0054] A fifth aspect of this application provides an expression vector comprising a polynucleotide as described in the third aspect above, or a nucleic acid construct as described in the fourth aspect above.

[0055] A sixth aspect of this application provides a transformed host cell that has been transformed with the nucleic acid sequence of the delta-12 desaturase as described in claim 1.

[0056] Preferably, the transformed host cell contains the polynucleotide described in the third aspect, or the nucleic acid construct described in the fourth aspect, or the expression vector described in the fifth aspect.

[0057] Preferably, the transformed host cells include, but are not limited to, natural strains or genetically modified strains such as bacteria, yeast, and mold;

[0058] More preferably, the transformed host cells include, but are not limited to, strains of *Escherichia coli*, *Bacillus*, *Kluyveromyces*, *Rhodosporidium*, and *Yarrowia*.

[0059] More preferably, the transformed host cells include, but are not limited to, strains such as *Saccharomyces cerevisiae*, *Kluyveromyces marxianus*, *Kluyveromyces lactis*, *Yarrowia lipolytica*, and *Rhodosporidium toruloides*.

[0060] More preferably, the host cell for the transformation is the genetically engineered Escherichia coli E.coli BL21(DE3).

[0061] A seventh aspect of this application provides a method for expressing the derived polypeptide described in the second aspect, comprising:

[0062] (1) The transformed host cells are cultured under conditions suitable for expression of the derived polypeptide; the transformed host cells are as described in aspect six above; and

[0063] (2) The polypeptide is recovered.

[0064] In a specific implementation, step (1) includes: firstly, introducing a nucleic acid construct or recombinant expression vector containing the derivative polypeptide encoded as described in the second aspect above into a host cell to construct an engineered host cell expressing the derivative polypeptide; then, culturing the engineered host cell and inducing it to express the derivative polypeptide.

[0065] In a specific implementation, step (2) includes the steps of separating and purifying the derived polypeptide from the culture.

[0066] Host cells can be cultured in nutrient media suitable for peptide production using methods known in the art. For example, cells can be cultured by shake-flask culture or by small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, feed-feed fermentation, or solid-state fermentation) in a laboratory or industrial fermenter in a suitable medium and under conditions that allow for the expression and / or isolation of the derived peptide. The culture occurs using procedures known in the art in a suitable medium containing carbon and nitrogen sources and inorganic salts. Suitable media can be purchased commercially or prepared according to publicly available compositions.

[0067] The polypeptide can be recovered from the culture using methods known in the art. For example, variants can be recovered from nutrient media through a variety of routine procedures, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0068] Furthermore, the derived peptides can be purified by a variety of procedures known in the art to obtain substantially pure derived peptides, including but not limited to chromatographic methods (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography), electrophoretic procedures (e.g., preparative isoelectric point focusing), differential solubility methods (e.g., ammonium sulfate precipitation), SDS-PAGE, salting out, and combinations thereof; more preferably, purification can be performed by Ni column affinity chromatography.

[0069] The eighth aspect of this application provides a yeast gene-modified cell, the yeast gene-modified cell comprising a nucleic acid sequence of a polypeptide having at least 70% or more of the same amino acid sequence as the derived polypeptides C1-C9 described in the second aspect, and having high activity for synthesizing linoleic acid.

[0070] Preferably, the yeast gene-modified cell contains a heterologous nucleic acid sequence of any one of the derivative polypeptides C1-C9 described in the second aspect.

[0071] Preferably, the yeast gene-modified cell is a gene-modified cell with the activity of synthesizing human milk oligosaccharides and fatty acids, including but not limited to gene-modified cells of the genera *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp.

[0072] Preferably, the genetically modified cells include, but are not limited to, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichiapastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides, with Yarrowia lipolytica genetically modified cells being the most preferred.

[0073] Preferably, the yeast gene-modified cell contains nucleic acid sequences for synthesizing target human milk oligosaccharides and fatty acids.

[0074] Preferably, the yeast gene-modified cells are selected from Saccharomyces cerevisiae and Yarrowia lipolytica, which contain a heterologous nucleic acid sequence of lactose transporter (Lac12).

[0075] The method for preparing yeast gene-modified cells includes the following steps:

[0076] (1) Cultivate the starting strain.

[0077] (2) Construct an expression cassette by introducing a heterologous nucleic acid sequence of any one of the derivative polypeptides C1-C9 described in the second aspect into the starting strain.

[0078] (3) Check the nucleic acid sequence contained in the starting strain and introduce the nucleic acid sequence necessary for the synthesis of the target human milk oligosaccharide as needed.

[0079] Optional, (4) construct a molecular marker expression cassette and introduce the marker gene into the starting strain.

[0080] (5) The step of recovering the genetically modified cells.

[0081] A ninth aspect of this application provides the use of the host cells transformed as described in the sixth aspect and the yeast gene-modified cells as described in the eighth aspect in the synthesis of human milk oligosaccharides and fatty acids. Preferably, the fatty acids contain linoleic acid.

[0082] In one embodiment, the composition of the first aspect is a fermentation broth from yeast genetically modified cells that synthesizes human milk oligosaccharides and fatty acids de novo. Preferably, the fatty acids contain linoleic acid.

[0083] A tenth aspect of this application provides a method for preparing the composition described in the first aspect. The method includes the following steps:

[0084] a. Cultivate yeast cells capable of producing one or more human milk oligosaccharides and fatty acids.

[0085] Preferably, the yeast cells are selected from the host cells transformed as described in the sixth aspect above or the yeast gene-modified cells with human milk oligosaccharide and fatty acid activity as described in the eighth aspect, preferably Yarrowia lipolytica gene-modified cells;

[0086] Preferably, the one or more human milk oligosaccharides are as described in the first aspect.

[0087] Preferably, the fatty acid contains linoleic acid.

[0088] b. Culturing the yeast cells from step (a) in a suitable culture medium to synthesize the one or more human milk oligosaccharides, fatty acids, and linoleic acid, wherein the one or more human milk oligosaccharides are as described in the first aspect; and

[0089] c. Optionally, purify the one or more human milk oligosaccharides, fatty acids, and linoleic acid.

[0090] Preferably, in the preparation method, the culture medium contains glucose and lactose.

[0091] Preferably, in the preparation method, the suitable fermentation temperature is 15-40℃ and the solution pH value is in the range of 5-9.

[0092] In an eleventh aspect, this application provides a solid composition comprising human milk oligosaccharides, fatty acids, and linoleic acid.

[0093] Preferably, the composition contains at least 65% (by weight) human lactose oligosaccharides, fatty acids, and linoleic acid.

[0094] The composition can be used to recover human milk oligosaccharides, fatty acids and linoleic acid from the fermentation broth of the first aspect according to methods known in the art.

[0095] The method for preparing the solid composition allows for the separation of the fermentation broth containing human milk oligosaccharides, fatty acids, and linoleic acid using conventional methods. Preferably, the mixture containing human milk oligosaccharides, fatty acids, and linoleic acid is purified using conventional methods such as cell disruption, centrifugation, activated carbon decolorization, ultrafiltration, ion exchange resin, or electrodialysis.

[0096] Human milk oligosaccharides, fatty acids, and linoleic acid are further separated from the reaction mixture using purification steps employing techniques known in the art, such as chromatography, evaporation, lyophilization, crystallization, precipitation, and / or drying, and spray drying.

[0097] Beneficial effects:

[0098] This application provides a composition containing at least one human milk oligosaccharide, fatty acid, linoleic acid, and yeast gene-modified cells. This application also provides the use of yeast gene-modified cells in the synthesis of human milk oligosaccharides, fatty acids, and linoleic acid, and further provides yeast gene-modified cells capable of improving the efficiency of linoleic acid synthesis. Detailed Implementation

[0099] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; all materials and reagents are commercially available unless otherwise specified.

[0100] The present invention will be further described in detail below through embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Modifications or substitutions to the details and form of the technical solution without departing from the structural concept and scope of use of the present invention shall fall within the protection scope of the present invention.

[0101] In the following examples, the products obtained from the polypeptide catalytic reaction were analyzed or identified using HPLC, mass spectrometry, and ion chromatography. The HPLC detection conditions were as follows:

[0102] Column type: Cosmosil Sugar-D amino column (nacalaitesque, INC.), detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 1.0 mL / min, column temperature: 30 ℃, mobile phase: acetonitrile:water = 70:30.

[0103] LC-MS analysis conditions: Column type: Cosmosil Sugar-D amino column (nacalaitesque, INC.), detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 1.0 mL / min, column temperature: 30 ℃, mobile phase: acetonitrile:water = 70:30; H-ESI mode, molecular weight scan range 260–800.

[0104] The ion chromatography analysis conditions were as follows: column: MetroSep Carb2 (4.0 mm × 250 mm), eluent: 140 mM NaOH / 20 mM NaAc, isocratic elution, flow rate: 0.500 mL / min, amperometric detector, column temperature: 40 ℃, injection volume: 20 μL, run time: 50 min.

[0105] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations of the present invention.

[0106] In the following examples, the starting strain for the Kluyveromyces lactis gene-modified cells was K. lacticDSM70799, the starting strain for the Kluyveromyces marxianus gene-modified cells was K. marxianusDMKU3-1042, the starting strain for the Pichia pastoris gene-modified cells was Pichia pastoris GS115, and the starting strain for the Yersinia lipolytica gene-modified cells was Yersinia lipolytica ATCC 20460.

[0107] In the following examples, the lactose transporter (lac12) involved is derived from Kluyveromyces lactis, and its amino acid sequence is shown in the figure, and its nucleotide sequence is shown in SEQ ID NO:4.

[0108] Example 1. Synthesis of a composition of lactose-N-tetrasaccharide and fatty acid.

[0109] Yeast was cultured using glucose as the carbon source. Genetically modified *Yarrowia lipolytica* strains YL-B0-J to YL-B9-J, as described in patent application number 202511884623.4 (Invention title: Synthetic tetrasaccharide polypeptide and gene-modified cells containing the polypeptide gene), were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of each colony was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, lactose and 3% (w / v) glucose were added to a final concentration of 10 g / L, and the mixture was cultured at 30℃ with shaking at 200 rpm for a total fermentation time of 96 h. After 96 h of fermentation, samples were taken and boiled for 10 min. The contents of LNT and LA in the fermentation broth and their percentages in total fatty acids were determined. The LNT content was determined by ion chromatography, and the percentage and content of linoleic acid in total fatty acids were determined and calculated according to the method (hydrolysis extraction method) specified in GB5009.168—2016, "Determination of Fatty Acids in Food". The results are recorded in Table 1.

[0110] Table 1. Synthesis of LNT and fatty acid compositions in genetically modified Yersinia lipolytica cells YL-B0-J to YL-B9-J

[0111]

[0112] The fermentation broth obtained by YL-B6-J was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis. After rotary evaporation and vacuum drying, a solid powder was obtained. HPLC analysis showed that the purity of LNT in the solid powder was 85.76%, the purity of LA was 4.34%, and the percentage of LA (C18:2n6c) in the total fatty acids was 35.97%.

[0113] Example 2. Synthesis of a composition of lactose-N-neotetrasaccharide and fatty acid.

[0114] Yeast was cultured using glucose as the carbon source. YL-A0-J to YL-A10-J gene-modified cells, as described in patent application number 202510546666.5, were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (dose elapsed).600 =1, lactose and glucose were added to a final concentration of 10 g / L and 3% (w / v) glucose, and the mixture was cultured at 30℃ and 200 rpm for a total fermentation time of 96 h. After 96 h of fermentation, samples were taken and boiled for 10 min. The contents of LNnT and LA in the fermentation broth and their percentage of total fatty acids were determined, and the results are recorded in Table 2.

[0115] Table 2. Synthesis of LNnT and fatty acid compositions in genetically modified Yersinia lipolytica cells YL-A0-J to YL-A10-J.

[0116]

[0117] The fermentation broth obtained by YL-A8-J was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis, rotary evaporation and vacuum drying to obtain solid powder. HPLC analysis showed that the purity of LNnT in the obtained solid powder was 85.34%, the purity of LA was 5.04%, and LA (C18:2n6c) accounted for 36.67% of the total fatty acids.

[0118] Example 3. Synthesis of a composition of lactose-N-tetrasaccharide, lactose-N-neotetrasaccharide, and fatty acid.

[0119] Yeast was cultured using glucose as the carbon source. YL-M0-J to YL-M8-J gene-modified *Yeastra lipolytica* cells, as described in patent application number 202510533839.X, were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (occurrence limit) was reached. 600 =1, lactose and glucose were added to a final concentration of 10 g / L and 3% (w / v) glucose, and the mixture was cultured at 30℃ and 200 rpm for a total fermentation time of 96 h. After 96 h of fermentation, samples were taken and boiled for 10 min. The contents of LNT, LNnT and LA in the fermentation broth and their percentages of total fatty acids were measured, and the results are recorded in Table 3.

[0120] Table 3. Synthesis of LNT, LNnT, and fatty acid compositions in genetically modified Yersinia lipolytica cells YL-M0-J to YL-M8-J

[0121]

[0122] The fermentation broth obtained from YL-M6-J was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis. After rotary evaporation and vacuum drying, a solid powder was obtained. HPLC analysis showed that the purity of LNnT in the solid powder was 7.67%, the purity of LNT was 65.23%, the purity of LA was 4.74%, and the percentage of LA (C18:2n6c) in the total fatty acids was 38.34%.

[0123] Example 4. The gene-modified cells YL-B6-J, YL-A5-J, and YL-M6-J described above were further genetically modified by introducing the genes for the polypeptides C1-C9 described in the second aspect of this application to enhance the activity of LA synthesis. The specific steps are as follows:

[0124] (1) Construction of Yeast Expression Kits for Yeast Lipid-Altering: Construction of expression kits from YL-ΔG6P::C0, YL-ΔG6P::C1 to YL-ΔG6P::C9. Glucosamine-6-phosphate isomerase, G6P.

[0125] Using the *Yarrowia lipolyticis* YL-B6-J genome as a template, the upstream and downstream homologous arm sequences G6P-up and G6P-do, the promoter sequence FBAp, and the terminator sequence pex16t were amplified. The target gene sequence was amplified using the synthesized C0 to C9 sequences as templates. The URA3 sequence was amplified using the synthesized URA3 gene as a template, and the promoter EXPp was amplified using the *Yarrowia lipolyticis* YL-B6-J genome as a template. The expression cassette C0 / C9-URA3 was obtained by sequentially fusing two fragments, FBA1p, any one of C0-C9, pex16t, EXPp, URA3, and XPRt, using the fusion PCR system as a template and G6P-uF and G6P-dR as primers (see Table 4). The expression cassettes YL-ΔG6P::C0, YL-ΔG6P::C1 to YL-G6P::C9 were amplified by PCR.

[0126] Table 4

[0127] Primer Sequence G6P-uF CCGAGGCCTATCTTAACATATTT G6P-dR CAAATATAGCATACGAACATGCC

[0128] (2) The correspondence between recombinant strains and their genotypes is shown in Tables 5-7. To verify the correctness of the strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, the strain was considered a false positive.

[0129] Table 5. Genetically modified cells of Yersinia lipolyticis YL-B6-J and their genotypes

[0130] Strain Genotype YL-B6-J wt1 YL-B6-J-C0 wt1; ΔG6P::C0 YL-B6-J-C1 wt1; ΔG6P::C1 YL-B6-J-C2 wt1; ΔG6P::C2 YL-B6-J-C3 wt1; ΔG6P::C3 YL-B6-J-C4 wt1; ΔG6P::C4 YL-B6-J-C5 wt1; ΔG6P::C5 YL-B6-J-C6 wt1; ΔG6P::C6 YL-B6-J-C7 wt1; ΔG6P::C7 YL-B6-J-C8 wt1; ΔG6P::C8 YL-B6-J-C9 wt1; ΔG6P::C9

[0131] Table 6. Genetically modified cells of Yersinia lipolyticis YL-A5-J and their genotypes

[0132] Strain Genotype YL-A5-J wt2 YL-A5-J-C0 wt2; ΔG6P::C0 YL-A5-J-C1 wt2; ΔG6P::C1 YL-A5-J-C2 wt2; ΔG6P::C2 YL-A5-J-C3 wt2; ΔG6P::C3 YL-A5-J-C4 wt2; ΔG6P::C4 YL-A5-J-C5 wt2; ΔG6P::C5 YL-A5-J-C6 wt2; ΔG6P::C6 YL-A5-J-C7 wt2; ΔG6P::C7 YL-A5-J-C8 wt2; ΔG6P::C8 YL-A5-J-C9 wt2; ΔG6P::C9

[0133] Table 7. Genetically modified cells of Yersinia lipolyticis YL-M6-J and their genotypes

[0134]

[0135]

[0136] Fermentation experiment: Yeast was cultured using glucose as the carbon source. Gene-modified cells of *Yarrowia lipolytica* (Tables 5-7) were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, add lactose to a final concentration of 10 g / L and 3% (w / v) glucose, and culture at 30℃ with shaking at 200 rpm for a total fermentation time of 96 h. After 96 h of fermentation, take samples and boil for 10 min, and determine the content of LNT or LNnT and LA in the fermentation broth and their percentage of total fatty acids. The results are recorded in Table 8-10.

[0137] Table 8. The LNT and fatty acid compositions synthesized by the gene-modified *Yarrowia lipolytica* cells described in Table 5.

[0138]

[0139] Table 9. The LNnT and fatty acid compositions synthesized by the gene-modified *Yarrowia lipolyticis* cells described in Table 6.

[0140]

[0141]

[0142] Table 10. The LNT, LNnT and fatty acid compositions synthesized by the gene-modified cells of *Yarrowia lipolytica* described in Table 7.

[0143]

[0144] Example 5.2' - Synthesis of a composition of fucoidan-lactose and fatty acids

[0145] Using *Yarrowia lipolyticis* ATCC 20460 as the starting strain, a heterologous nucleic acid sequence of lactose transporter (Lac12) was introduced, along with the genes M12 or M13 from the polypeptide with GDP-fucose synthase activity described in Chinese patent application 202311635360.4 (Invention title: GDP-fucose synthase polypeptide and its application), the genes M10 or M11 from the polypeptide with GDP-mannose-4,6-dehydratase activity described in Chinese patent application 202311640201.3 (Invention title: A GDP-mannose dehydrating enzyme polypeptide and its application), and the genes M14 or M16 from the α-1,2-fucosyltransferase polypeptide with 2'-fucosyllactose synthesis activity described in Chinese patent application 202311372479.7 (Invention title: A fucosyltransferase polypeptide and its application), to obtain gene-modified cells that synthesize 2'-fucosyllactose and LA.

[0146] The correspondence between the gene-modified cells of Yeast lipolyticis and the introduced genes, as described above, is shown in Table 11.

[0147] Table 11. Genetically modified cells of Yeast Rice and the introduced genes

[0148]

[0149]

[0150] Fermentation experiment: Yeast was cultured using glucose as the carbon source. YL-1 and YL-2 gene-modified *Yeastra lipolytica* cells were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and incubated at 30°C for 2-3 days. Single colonies were then inoculated into 1.5 mL of YPD liquid medium and incubated overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and incubated at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, lactose and 3% (w / v) glucose were added to a final concentration of 10 g / L, and the mixture was cultured at 30℃ and 200 rpm for a total fermentation time of 96 h. After 96 h of fermentation, samples were taken and boiled for 10 min. The contents of '-fucosylated lactose (2'-FL) and linoleic acid (LA) in the fermentation broth and their percentages in total fatty acids were determined. The results are recorded in Table 12.

[0151] Table 12. Synthesis of 2'-fucosylated lactose and fatty acid compositions in YL-1 and YL-2 gene-modified Yersinia lipolytica cells

[0152]

[0153] Example 6.3 - Synthesis of a composition of fucoidan-lactose and fatty acids

[0154] Using Yersinia lipolyticis ATCC 20460 as the starting strain, a heterologous nucleic acid sequence of lactose transporter (Lac12) was introduced, along with the genes of M12 or M13 from the polypeptide with GDP-fucose synthase activity described in Chinese patent application 202311635360.4 (Invention title: GDP-fucose synthase polypeptide and its application), the genes of M10 or M11 from the polypeptide with GDP-mannose-4,6-dehydratase activity described in Chinese patent application 202311640201.3 (Invention title: A GDP-mannose dehydrating enzyme polypeptide and its application), and the genes of M16 or M17 from the α-1,3-fucosyltransferase polypeptide with 3-fucosyllactose synthesis activity described in Chinese patent application 202410206745.7 (Invention title: Fucosyltransferase polypeptide and its application).

[0155] The correspondence between gene-modified cells of Yeast lipolyticis and the introduced genes is shown in Table 13.

[0156] Table 13. Genetically modified cells of Yeast Extract and introduced genes

[0157]

[0158]

[0159] Fermentation experiment: Yeast was cultured using glucose as the carbon source. YL-3 and YL-4 *Yersinia lipolytica* gene-modified cells were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and incubated at 30°C for 2-3 days. Single colonies were then inoculated into 1.5 mL of YPD liquid medium and incubated overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and incubated at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, lactose and 3% (w / v) glucose were added to a final concentration of 10 g / L, and the mixture was cultured at 30℃ and 200 rpm with shaking for a total fermentation time of 96 h. After 96 h of fermentation, samples were taken and boiled for 10 min. The contents of 3-fucosylated lactose (3-FL) and linoleic acid (LA) in the fermentation broth and their percentage of total fatty acids were determined. The results are recorded in Table 14.

[0160] Table 14. Synthesis of 3-FL and fatty acid compositions in YL-3 and YL-4 gene-modified Yersinia lipolytica cells

[0161]

[0162] Example 7. Using YL-2 from Example 5 and YL-3 from Example 6 as starting strains, the gene of any one of the polypeptides C1-C9 described in the second aspect of this application was introduced according to the gene modification method described in Example 4. The correspondence between the recombinant strains and their genotypes is shown in Tables 15 and 16.

[0163] Table 15. Genetically modified cells and genotypes of Yersinia lipolytica strain YL-2

[0164] Strain Genotype YL-2 wt4 YL-2-C0 wt4; ΔG6P::C0 YL-2-C1 wt4; ΔG6P::C1 YL-2-C2 wt4; ΔG6P::C2 YL-2-C3 wt4; ΔG6P::C3 YL-2-C4 wt4; ΔG6P::C4 YL-2-C5 wt4; ΔG6P::C5 YL-2-C6 wt4; ΔG6P::C6 YL-2-C7 wt4; ΔG6P::C7 YL-2-C8 wt4; ΔG6P::C8 YL-2-C9 wt4; ΔG6P::C9

[0165] Table 16. Genetically modified cells and genotypes of Yersinia lipophila strain YL-3

[0166] Strain Genotype YL-3 wt5 YL-3-C0 wt5; ΔG6P::C0 YL-3-C1 wt5; ΔG6P::C1 YL-3-C2 wt5; ΔG6P::C2 YL-3-C3 wt5; ΔG6P::C3 YL-3-C4 wt5; ΔG6P::C4 YL-3-C5 wt5; ΔG6P::C5 YL-3-C6 wt5; ΔG6P::C6 YL-3-C7 wt5; ΔG6P::C7 YL-3-C8 wt5; ΔG6P::C8 YL-3-C9 wt5; ΔG6P::C9

[0167] Fermentation experiment: Yeast was cultured using glucose as the carbon source. Gene-modified *Yarrowia lipolytica* cells (as described in Tables 15-16) were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YPD and cultured at 30°C for 2-3 days. Single colonies were then inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (dose elapsed). 600 =1, lactose and 3% (w / v) glucose were added to a final concentration of 10 g / L, and the mixture was cultured at 30℃ and 200 rpm for a total fermentation time of 96 h. After 96 h of fermentation, samples were taken and boiled for 10 min. The contents of fucoidan lactose and linoleic acid in the fermentation broth and their percentage of total fatty acids were determined. The results are recorded in Tables 17-18.

[0168] Table 17. The 2'-FL and fatty acid compositions synthesized by the genetically modified *Yarrowia lipolytica* cells described in Table 15.

[0169]

[0170] Table 18. The 3-FL and fatty acid compositions synthesized by genetically modified *Yarrowia lipolytica* cells described in Table 16.

[0171]

[0172] Example 8.5L Fermenter Validation Experiment

[0173] YL-B6-J-C7, YL-B6-J-C9, YL-A5-J-C7, YL-A5-J-C9, YL-M6-J-C7, YL-M6-J-C9, YL-2-C7, YL-2-C9, YL-3-C7, and YL-3-C9 were taken and streaked onto solid media such as YPD. After incubation at 30°C for 2-3 days, single colonies were picked and inoculated into 1.5 mL of YPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of each colony was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD reached. 600 =1, and 2% of each culture medium was inoculated into 1L of YPD medium (10g / L yeast extract, 20g / L peptone, 20g / L glucose) (5L fermenter). After 6-7 hours of cultivation, glucose (50% mother liquor concentration) was added at a flow rate of 8mL / h. At the same time, lactose (40% mother liquor concentration) was added to maintain a final lactose concentration of 15g / L. The total fermentation time was 96 hours. After 96 hours of fermentation, the contents of human milk oligosaccharides and linoleic acid in the fermentation broth and their percentage of total fatty acids were determined. The results are recorded in Tables 19-23.

[0174] Table 19. Study on LNT and fatty acid synthesis in genetically modified *Yarrowia lipolyticis* cells (5L fermenter)

[0175]

[0176] The fermentation broth obtained from YL-B6-J-C9 was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis. After rotary evaporation and vacuum drying, a solid powder was obtained. The purity of LNT in the obtained solid powder was 70.73%, the purity of LA was 9.07%, and the percentage of LA (C18:2n6c) in the total fatty acids was 88.43% by HPLC.

[0177] Table 20. Study on the synthesis of LNnT and fatty acids in genetically modified *Yarrowia lipolyticis* cells (5L fermenter)

[0178]

[0179] The fermentation broth obtained from YL-A5-J-C9 was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis, rotary evaporation and vacuum drying to obtain a solid powder. The purity of LNnT in the obtained solid powder was determined by HPLC to be 69.83%, the purity of LA was 13.28%, and the percentage of LA (C18:2n6c) in the total fatty acids was 89.06%.

[0180] Table 21. Study on the synthesis of LNT, LNnT and LA in genetically modified Yeast Extract cells (5L fermenter)

[0181]

[0182] The fermentation broth obtained from YL-M6-J-C9 was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis. After rotary evaporation and vacuum drying, a solid powder was obtained. The purity of LNnT in the obtained solid powder was determined by HPLC or ion chromatography to be 64.88%, the purity of LNT was 8.13%, the purity of LA was 13.52%, and the percentage of LA (C18:2n6c) in the total fatty acids was 87.88%.

[0183] Table 22. Study on the synthesis of 2'-FL and fatty acids in genetically modified *Yarrowia lipolyticis* cells (5L fermenter)

[0184]

[0185] The fermentation broth obtained from YL-2-C9 was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis, rotary evaporation and vacuum drying to obtain a solid powder. The purity of 2'-FL in the obtained solid powder was determined by HPLC to be 70.98%, the purity of LA was 16.73%, and the percentage of LA (C18:2n6c) in the total fatty acids was 85.06%.

[0186] Table 23. Study on the synthesis of 3-FL and fatty acids in genetically modified *Yarrowia lipolytica* cells (5L fermenter)

[0187]

[0188]

[0189] The fermentation broth obtained from YL-3-C9 was purified by conventional methods such as activated carbon decolorization, ultrafiltration, ion exchange resin or electrodialysis. After rotary evaporation and vacuum drying, a solid powder was obtained. The purity of 3-FL in the obtained solid powder was 72.48%, the purity of LA was 16.9%, and the percentage of LA (C18:2n6c) in the total fatty acids was 84.83% by HPLC.

[0190] While the invention has been described in considerable detail by way of illustration and example for purposes of clarity, it will be apparent to those skilled in the art that any equivalent aspects or modifications may be made. Therefore, this specification and the embodiments should not be construed as limiting the scope of the invention.

Claims

1. A composition, characterized in that, Contains at least one human milk oligosaccharide, fatty acid, and yeast gene-modified cells. Preferably, the human milk oligosaccharide is selected from one or more of the following: (1) Lactose-N-trisaccharide; or (2) Lactose-N-tetrasaccharide, lactose-N-trisaccharide; or (3) Lactose-N-neotetrasaccharide, lactose-N-trisaccharide; or (4) Lactose-N-tetrasaccharide, lactose-N-neotetrasaccharide, lactose-N-trisaccharide; or (5) 2'-fucosylated lactose; or (6) 3-Fucose-based lactose, Preferably, the composition is obtained by fermentation of yeast gene-modified cells. Preferably, the composition is a solid composition obtained from a fermentation broth containing human milk oligosaccharides, fatty acids, and linoleic acid through conventional purification methods such as cell disruption, centrifugation, activated carbon decolorization, ultrafiltration, ion exchange resin, or electrodialysis. Preferably, the fatty acid contains linoleic acid. Preferably, when the human milk oligosaccharide is 2'-fucosylated lactose as described in (5) above, the composition also contains difucosylated lactose. Preferably, the yeast gene-modified cells contain the nucleic acid sequence of delta-12 desaturase. Preferably, the yeast gene-modified cells are gene-modified cells with the activity of synthesizing human milk oligosaccharides and fatty acids, including but not limited to gene-modified cells of the genera *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc. Preferably, the genetically modified cells include, but are not limited to, genetically modified cells of Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides. Preferably, the yeast gene-modified cell contains nucleic acid sequences for synthesizing target human milk oligosaccharides and fatty acids. Preferably, the yeast gene-modified cells are selected from Saccharomyces cerevisiae and Yarrowia lipolytica, which contain a heterologous nucleic acid sequence of lactose transporter (Lac12).

2. The composition according to claim 1, characterized in that, The human milk oligosaccharide is lactose-N-trisaccharide, and the yeast gene-modified cell is a yeast gene-modified cell with activity in synthesizing lactose-N-trisaccharide and fatty acids, or The human milk oligosaccharide is lactose-N-tetrasaccharide, and the yeast gene-modified cell is a yeast gene-modified cell with activity in synthesizing lactose-N-tetrasaccharide and fatty acids, or The human milk oligosaccharide is lactose-N-neotetrasaccharide, and the yeast gene-modified cell is a yeast gene-modified cell with activity in synthesizing lactose-N-neotetrasaccharide and fatty acid, or The human milk oligosaccharides are lactose-N-tetrasaccharides and lactose-N-neotetrasaccharides, and the yeast gene-modified cells are yeast gene-modified cells with the activity of synthesizing lactose-N-tetrasaccharides and lactose-N-neotetrasaccharides and fatty acid activity, or The human milk oligosaccharide is 2'-fucosylated lactose, and the yeast gene-modified cell is a yeast gene-modified cell with the activity of synthesizing 2'-fucosylated lactose and fatty acids, or The human milk oligosaccharide is 3-fucosyllactose, and the yeast gene-modified cell is a yeast gene-modified cell with the activity of synthesizing 3-fucosyllactose and fatty acids.

3. A peptide derived from a polypeptide with the amino acid sequence shown in SEQ ID NO:1, wherein the peptide is selected from any of the following mutation modes: (1) Insert SALPKQNPALRRTVT between the 4th and 5th amino acids of the polypeptide whose amino acid sequence is as shown in SEQ ID NO:1 to obtain polypeptide C1. (2) Insert DSPRH between amino acids 19 and 20 of polypeptide C1 to obtain polypeptide C2. (3) Insert DIAKPKSEYGV3 between amino acids 32 and 33 of polypeptide C1 to obtain polypeptide C3. (4) Inserting PE between amino acids 90 and 91 of polypeptide C3 yields polypeptide C4. (5) Inserting KM between the 186th and 187th amino groups of polypeptide C4 yields polypeptide C5. (6) Insert EGRGKGKHNGLG between amino acids 231-232 of polypeptide C5 to obtain polypeptide C6. (7) Inserting GPRG between amino acids 378 and 379 of polypeptide C6 yields polypeptide C7. (8) PSA is inserted between amino acids 394 and 395 of polypeptide C7 to obtain polypeptide C8. (9) Insert GAGK between amino acids 378 and 379 of polypeptide C8 to obtain polypeptide C9.

4. A polynucleotide encoding any one of the derivative polypeptides C1-C9 of claim 3.

5. A nucleic acid construct comprising the polynucleotide of claim 4.

6. A transformed host cell, having been transformed with the nucleic acid sequence of the delta-12 desaturase of claim 1, Preferably, the transformed host cell is transformed with the polynucleotide of claim 4 or the nucleic acid construct of claim 5. Preferably, the transformed host cells include, but are not limited to, natural strains or genetically modified strains such as bacteria, yeast, and mold; More preferably, the transformed host cells include, but are not limited to, strains of Escherichia sp., Bacillus sp., Kluyveromyces sp., Rhodosporidium sp., and Yarrowia sp. More preferably, the transformed host cells include, but are not limited to, strains such as *Saccharomyces cerevisiae*, *Kluyveromyces marxianus*, *Kluyveromyces lactis*, *Yarrowia lipolytica*, and *Rhodosporidium toruloides*. More preferably, the host cell for the transformation is the genetically engineered Escherichia coli E.coli BL21(DE3).

7. A yeast gene-modified cell containing the nucleic acid sequence of any one of the derivative polypeptides C1-C9 of claim 3. Preferably, the yeast gene-modified cells are gene-modified cells with the activity of synthesizing human milk oligosaccharides and fatty acids, including but not limited to *Kluyveromyces* sp., *Pichia* sp., *Saccharomyces* sp., *Schizosaccharomyces* sp., *Rhodosporidium* sp., and *Yarrowia* sp., etc. Preferably, the genetically modified cells include, but are not limited to, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces yarrowii, Pichia pastoris, Schizosaccharomyces pombe, and Rhodosporidium toruloides. Preferably, the yeast gene-modified cell contains nucleic acid sequences for synthesizing target human milk oligosaccharides and fatty acids. Preferably, the yeast gene-modified cells are selected from Saccharomyces cerevisiae and Yarrowia lipolytica, which contain a heterologous nucleic acid sequence of lactose transporter (Lac12).

8. The use of the transformed host cell of claim 6 or the yeast gene-modified cell of claim 7 in the synthesis of the composition of claim 1.

9. The composition according to claim 1, characterized in that, The composition is a fermentation broth from which human milk oligosaccharides and fatty acids are synthesized de novo using the host cells transformed according to claim 6 or the yeast gene-modified cells according to claim 7. Preferably, the fatty acid contains linoleic acid.

10. A method for preparing the composition according to claim 1, characterized in that, Includes the following steps: a. Cultivate genetically modified yeast cells capable of producing one or more human milk oligosaccharides and fatty acids. Preferably, the yeast gene-modified cell is selected from the host cell transformed according to claim 6 or the yeast gene-modified cell according to claim 7; Preferably, the fatty acid contains linoleic acid. b. Culture the cells according to step (a) in a suitable culture medium to synthesize the one or more human milk oligosaccharides and fatty acids, the one or more human milk oligosaccharides as described in claim 1; and c. Optionally, purify the one or more human milk oligosaccharides, fatty acids, and linoleic acid. Preferably, in the preparation method, the culture medium contains glucose and lactose. Preferably, in the preparation method, the suitable fermentation temperature is 15-40℃ and the solution pH value is in the range of 5-9.

Images