Pseudomonas mediterranea CS95 with broad-spectrum antibacterial activity and application thereof in preventing and treating citrus canker

Abstract

The application discloses a Pseudomonas mediterranea CS95 with broad-spectrum antibacterial activity and application thereof in preventing and treating citrus canker. The preservation number of the Pseudomonas mediterranea CS95 is CCTCC NO. M20261044, and the strain and culture solution thereof exhibit significant antagonistic activity to various plant pathogenic fungi and bacteria. The application further discloses that the Pseudomonas mediterranea can efficiently prevent and treat citrus canker through the dual effects of direct bacteriostasis and plant immune induction. The preparation method of the biocontrol preparation prepared by using the Pseudomonas mediterranea CS95 provided by the application is simple, the obtained preparation is environment-friendly, and a new microbial resource and technical scheme are provided for green prevention and control of the citrus canker.

Description

Technical Field

[0001] This invention belongs to the field of microbial pesticide technology, specifically relating to a strain of Pseudomonas thaliana CS95 with broad-spectrum antibacterial activity and its application in the prevention and control of citrus canker. Background Technology

[0002] Plant diseases caused by pathogenic bacteria and fungi are a major cause of reduced crop yields and lower quality worldwide. Citrus canker, a typical highly damaging bacterial disease, is caused by Xanthomonas citrus (…). Xanthomonas citri This disease is caused by infection with *Citrus citri* (Xcc). The pathogen can enter the plant through stomata or wounds, forming typical ulcerous spots on the surface of leaves and fruits, leading to leaf and fruit drop, and a decline in fruit quality. According to data from the Food and Agriculture Organization of the United Nations (FAO), this disease causes an average annual yield loss of 20%–30% in major citrus-producing regions of Asia and the Americas, and there is currently no cure. For a long time, chemical pesticides (such as copper-based fungicides) and antibiotics (such as streptomycin) have been the main control measures and have been widely used. However, long-term use of single-drug therapy has led to a vicious cycle of increased pathogen resistance, decreased efficacy, and escalating pesticide use.

[0003] Biological control has become an ideal alternative due to its environmentally friendly characteristics, and the development of safe and efficient biological control strategies has become a research hotspot and an urgent need. Among the many biocontrol microorganisms, *Pseudomonas* spp. (…) Pseudomonas *Pseudomonas thaliana* sp. has attracted much attention due to its rapid reproduction, vigorous metabolism, and ability to produce various antagonistic metabolites (such as antibiotics, siderophores, and extracellular enzymes). Among them, *Pseudomonas thaliana* (…) Pseudomonas mediterraneaIt has been proven to have good rhizosphere colonization ability and biocontrol potential. Existing research shows that some strains can inhibit a variety of pathogenic fungi and bacteria by producing diffusible antimicrobial compounds and volatile substances. For example, strain S58 (Yilin Gu, Jing Wang, Zhenyuan Xia, Hai-Lei Wei. Characterization of a Versatile Plant Growth-Promoting Rhizobacterium Pseudomonas mediterranea Strain S58. Microorganisms 2020, 8, 334) can control wheat sheath blight and tobacco wildfire and has growth-promoting properties; the lipopeptide compounds produced by strain B21-060 (accession number SAMN23038870) have a significant inhibitory effect on fungi such as Sclerotinia sclerotiorum and Botrytis cinerea. However, it should be noted that these bacteria only have a preventive effect on plant bacterial diseases and have no curative effect. Although pre-inoculation can trigger plant PTI and local immunity and reduce the incidence of bacterial diseases, it cannot control the spread of disease in already infected plants. Meanwhile, some strains can cause necrosis of the tomato pith, posing a risk of disease. Therefore, safe and non-toxic strains should be prioritized for screening during production.

[0004] Currently reported strains of *Pseudomonas thaliana* are mostly single-function and have a narrow antibacterial spectrum. Excellent strains with both highly effective antifungal and antibacterial activities are extremely rare, and there is currently no publicly available information on whether *Pseudomonas thaliana* has good preventative and therapeutic effects against citrus canker. Therefore, screening for safe, highly effective, broad-spectrum, and stable new strains of *Pseudomonas thaliana* can effectively avoid the shortcomings of chemical control and existing biocontrol products, expand the application scenarios of biocontrol bacteria, and provide high-quality strain resources for the development of novel biological pesticides. This has significant theoretical and practical value for the green and sustainable development of agriculture. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, this invention provides a strain of Pseudomonas thaliana CS95 with broad-spectrum antibacterial activity and enhanced plant immunity. Pseudomonas mediterranea This invention relates to CS95 (accession number CCTCC NO.M20261044, accession date May 21, 2026, depositary institution: CCTCC - China Center for Type Culture Collection) and its application in the control of citrus canker. The invention demonstrates, through antagonistic activity assays against pathogens, that *Pseudomonas thuringiensis* CS95 can significantly inhibit the growth of various pathogenic fungi and citrus canker pathogens, forming an inhibition zone; simultaneously, *Pseudomonas thuringiensis* CS95 can activate the plant's own immune response, effectively preventing and inhibiting the occurrence of citrus canker.

[0006] The first objective of this invention is to provide a strain of Pseudomonas thaliana ( Pseudomonas mediterranea CS95, with accession number CCTCC NO. M20261044.

[0007] A second objective of this invention is to provide a biological agent containing a culture of the aforementioned Pseudomonas cerevisiae CS95 as an active ingredient.

[0008] Preferably, the concentration of the culture of *Pseudomonas thaliana* CS95 is OD0.05. 600 =1.0.

[0009] Preferably, the preparation method of the culture of Pseudomonas thaliana CS95 is as follows: Pseudomonas thaliana CS95 is inoculated into LB liquid medium and cultured at 28°C and 200 rpm.

[0010] A third objective of this invention is to provide the application of the aforementioned Pseudomonas thaliana in the preparation of biological agents for the prevention and treatment of citrus canker.

[0011] A fourth object of the present invention is to provide the use of the aforementioned *Pseudomonas thaliana* CS95 or any of the formulations described herein in any of the following aspects: (1) Prevention and control of plant diseases, the plant diseases mentioned are peach brown rot, citrus blue mold, citrus sour rot, pear black spot, pepper bacterial wilt or citrus canker; (2) Enhance plant immune response.

[0012] The fifth object of the present invention is to provide a method for preventing and controlling citrus canker, comprising the following steps: applying the aforementioned Pseudomonas thaliana CS95 or any of the preparations described herein to citrus plants.

[0013] Preferably, the *Pseudomonas thaliana* CS95 or any of the preparations described herein prevents citrus canker by inhibiting the reproduction of the pathogen and / or promoting the immune response of citrus plants.

[0014] Preferably, the application method is spraying.

[0015] The present invention has the following beneficial effects: The Mediterranean Pseudomonas obtained by screening in this invention ( Pseudomonas mediterranea CS95 (CCTCC NO. M20261044) exhibits significant antagonistic activity against a variety of plant pathogenic fungi and bacteria. In vitro antagonistic experiments show that the culture medium of Pseudomonas thaliana CS95 can form a distinct inhibition zone, with a broad-spectrum and stable inhibitory effect, overcoming the technical shortcomings of existing biocontrol strains, such as narrow inhibitory spectrum and high functional specificity.

[0016] This invention marks the first application of *Pseudomonas thuringiensis* CS95 to the biological control of citrus canker. Citrus canker is caused by *Xanthomonas citrus* subsp. *citrus* (…). Xanthomonas citri subsp. citri Citrus canker is a serious bacterial disease that currently relies mainly on chemical pesticides such as copper-based agents for control. This invention demonstrates through experiments that the *Pseudomonas thuringiensis* CS95 strain and its culture medium can effectively prevent and inhibit the occurrence of citrus canker, providing a novel microbial resource and technical solution for the green control of this disease.

[0017] The *Pseudomonas thaliana* CS95 strain not only directly inhibits the growth of pathogens by secreting antibacterial active substances, but also activates the plant's own immune system, achieving a dual synergistic disease prevention effect of "external pathogen suppression and internal immune promotion." This mechanism enhances the persistence and systemic nature of the control effect, reduces the risk of pathogens developing drug resistance, and has significant biological advantages.

[0018] Biocontrol agents prepared using Pseudomonas thaliana CS95 or its culture solution can be applied to the control of fungal or bacterial diseases in plants, thereby achieving the goal of not relying on chemically synthesized pesticides. Moreover, the biocontrol agents produced have no toxic or harmful residues, are environmentally friendly, and safe for humans and animals. This aligns with the strategic direction of green and sustainable development in modern agriculture and can be widely applied in organic agriculture and integrated disease management systems. Attached Figure Description

[0019] The present invention relates to *Pseudomonas thaliana* CS95 ( Pseudomonas mediterranea CS95 was deposited on May 21, 2026 at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO. M20261044, at Wuhan University, Wuhan, China. Figure 1 This is a graph showing the results of antagonistic bacteria screening. In it, A represents the antagonistic strains initially screened against the pathogen. Xcc The antagonistic effect diagram shows that strain B represents the effect of strain CS95 on the pathogen. Xcc The antagonistic effect diagram. Figure 2 The homology analysis was based on the 16S rRNA (A) and housekeeping gene protein sequence (B) of Pseudomonas thaliana CS95. Figure 3 The colony morphology (A) and Gram staining analysis (B) of Pseudomonas thaliana CS95 are shown. Figure 4 This is an analysis of the antibacterial spectrum of Pseudomonas thaliana CS95. Figure 5This study describes the application of Pseudomonas thaliana CS95 in the prevention of citrus canker. A shows the phenotype of the entire branch after 15 days of treatment; B shows the leaf phenotype after 15 days of treatment with Pseudomonas thaliana CS95; and C shows the leaf phenotype after 30 days of treatment with Pseudomonas thaliana CS95. Figure 6 This study describes the application of Pseudomonas thaliana CS95 in the treatment of citrus canker. A shows the phenotype of the entire branch after 15 days of treatment; B shows the leaf phenotype after 15 days of treatment with Pseudomonas thaliana CS95; and C shows the leaf phenotype after 30 days of treatment with Pseudomonas thaliana CS95. Figure 7 The study investigated the immune response induced by Pseudomonas thuringiensis CS95 in citrus fruits. A represents the phenotype of Newhall navel orange leaves 3 days after injection with Pseudomonas thuringiensis CS95, and B represents the expression level of immune-related genes in Newhall navel orange leaves 3 days after injection with Pseudomonas thuringiensis CS95. * and *** indicate significant differences at p<0.05 and p<0.001, respectively. Detailed Implementation

[0020] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0021] Example 1: Screening and isolation of strains Citrus rhizosphere soil was placed in sterile water in a clean bench, shaken thoroughly, diluted 1000 times, and 100 μL of the suspension was pipetted and evenly spread onto LB solid medium. This was repeated three times, and the mixture was incubated at 28°C for 1 day. Results were observed and recorded. Based on colony color and morphology, different bacterial strains were activated in LB liquid medium, and the resulting bacterial suspensions were stored in [a specific location - missing from original text]. Keep at 80℃ for later use.

[0022] Example 2: Screening and identification of antagonistic bacteria against citrus canker In the clean bench, 100 μL of activated material with a concentration of 1.0 × 10⁻⁶ was taken. 6 cfu / mL of Xanthomonas citrus subsp. Xcc (It can cause citrus canker.) The bacterial suspension was evenly spread on LB solid medium, dried, and then a nine-square grid was drawn on the bottom of the plate. The different strains isolated in Example 1 were inoculated into LB liquid medium and incubated at 28°C and 200 rpm for 24-36 h to obtain the bacterial suspensions of the different strains in Example 1. The bacterial suspension concentration was uniformly diluted to 10. 8 cfu / mL; pipette 2 μL of each sample into a separate grid, air dry, and incubate at 28℃ for 1-2 days to screen for 9 strains that may be effective against Xanthomonas citrus subsp. citrus. XccThe antagonistic bacteria with inhibition zones are CS108, CS98, CS97, CS93, CS95, CS69, CS192, CS183, and CS143.

[0023] 16S rDNA identification: The bacterial cultures of the above 9 antagonistic bacteria were used as templates for 16S rDNA amplification, using universal primers for 16S rDNA (27F: 5'). AGAGTTTGATCCTGGCTCAG 3', SEQ ID NO.3; 1492: 5' TACGGCTACCTTGTTACGACTT 3' (SEQ ID NO. 4) PCR was performed using a 2×Taq PCR premixed reagent kit II (KT211, Tiangen Biotech (Beijing) Co., Ltd.) to identify the 16S rDNA of the above 9 antagonistic bacteria. The PCR reaction system (total 50 μL) was as follows: ddH2O 25 μL, 2×Taq PCR MasterMix II 19 μL, primers 27F and 1492 2 μL each, and bacterial template 2 μL. The reaction conditions were 98℃ for 3 min; 98℃ for 10 s, 55℃ for 15 s, 72℃ for 20 s, for 45 cycles. After PCR amplification, 1.0% agarose gel electrophoresis was performed at 120 V for 25 min, and the amplified fragment length was approximately 1500 bp. The PCR product of the target band was sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing.

[0024] Based on the 16S rDNA sequencing results, homology analysis was performed between the obtained strain sequences and the nucleic acid sequence library on NCBI. The results showed that all nine strains were *Pseudomonas thaliana*. Pseudomonas mediterranea ).

[0025] Further point-to-point plate confrontation experiments were conducted to verify that these 9 strains were effective against Xanthomonas citrus subsp. citrus. Xcc The antagonistic ability of the strains was further investigated. Further plate confrontation results showed that only CS95 and CS98 among the nine strains showed resistance to *Xanthomonas citrus* subsp. *citrus*. Xcc They exhibit distinct inhibition zones, with CS95 exhibiting the largest inhibition zone against Xanthomonas citrus subsp. citrus. Xcc The bacteria showed better inhibitory effects, indicating that it has a strong control ability against citrus canker pathogens. Figure 1 (A in the text). Therefore, Pseudomonas thaliana CS95 was subsequently used as the experimental subject.

[0026] Homology comparison analysis: Genomic DNA of *Pseudomonas thaliana* CS95 was extracted using the QIAGEN Bacterial Genomic DNA Extraction Kit (DP302-02). After quality control using a fluorometer and spectrophotometer, the DNA was fragmented to 8-10 kb, and an SMRTBell library was constructed. Single-molecule real-time sequencing was performed using the PacBio Sequel II platform to construct the whole genome of CS95. 16S rRNA (its nucleotide sequence is shown in SEQ ID NO.1) and housekeeping gene protein sequence (SEQ ID NO.2) were extracted and homology compared. The results showed that *Pseudomonas thaliana* CS95 had the highest similarity to *Pseudomonas thaliana* 'E_mediterranea|GCF_000774145.1', ​​with 16S rRNA and housekeeping gene protein sequences showing similarities of 98.83% and 99.38%, respectively. Figure 2 A significant difference is that *Pseudomonas_E_mediterranea|GCF_000774145.1* was isolated from tomato plants, while *Pseudomonas cerevisiae* CS95 originated from citrus soil, and no studies have been found on *Pseudomonas_E_mediterranea|GCF_000774145.1* as an antagonistic bacterium.

[0027] Morphological identification: The *Pseudomonas thaliana* CS95 strain obtained from the above screening was placed alone in a 1.0 × 10⁻⁶ m² spray. 6 On LB plates containing Xcc bacterial suspension at cfu / mL, after incubation at 28°C, a distinct inhibition zone was observed. Figure 1 (B in the text). The growth morphology of colonies on LB plates is as follows: Figure 3 As shown in Figure A: Single colonies are pale yellow with irregular edges, and are translucent and mucous-like. Colonies grown by spotting show distinct layers and concentric rings from the inside out. Gram staining results show that *Pseudomonas thaliana* CS95 strain can be stained red (…). Figure 3 The B in the figure indicates that the CS95 strain of Pseudomonas thaliana is a Gram-negative bacterium, which is consistent with the characteristics of Pseudomonas thaliana.

[0028] In summary, the results of confrontation experiments, morphological identification, 16S rDNA and housekeeping gene homology comparison analysis confirmed that Pseudomonas thaliana CS95 ( Pseudomonas mediterranea CS95 is a strain with strong antibacterial activity against Xcc. As a novel *Pseudomonas meliticus* strain, it has significant application potential in the control of plant diseases.

[0029] Example 3: Antagonism of other plant fungal and bacterial diseases by Pseudomonas thaliana CS95 The antibacterial spectrum of *Pseudomonas thaliana* CS95 was analyzed using the plate confrontation method. The fungi used included *Prunus cerevisiae*, the pathogen of peach brown rot. Monilinia fructicola ), citrus Penicillium pathogen ( Penicillium digitatum ), Citrus acid rot pathogen ( Geotrichum citri-aurantii ) and pear black spot pathogen ( Alternaria alternata A 5 mm diameter mycelial block was collected from the edge of the pathogen colony. This mycelial block was placed in the center of a blank PDA plate. At four points 25 mm from the center of the plate, *Pseudomonas thaliana* CS95 bacterial suspension was inoculated in a cross pattern. Specifically, 10 μL of 10% concentration was inoculated at each point. 8 A suspension of *Pseudomonas thaliana* CS95 at cfu / mL was incubated upside down in a 26°C incubator. A control was prepared by inoculating only the pathogen onto a PDA plate. The growth of the pathogen was observed after 7 days of incubation.

[0030] The bacteria used were selected from *Rhizoctonia solani*, the bacterial wilt pathogen of pepper (… Ralstonia solanacearum Take 100 μL of activated Ralstonia solanacearum and spread it evenly on LB agar. After drying, inoculate Pseudomonas thuringiensis CS95 bacterial suspension at four points in a cross pattern, 25 mm from the center of the plate. Specifically, inoculate 10 μL of 10% thiocyanate solution at each point. 8 The bacterial suspension of Pseudomonas thaliana CS95 at cfu / mL was dried and then incubated at 28°C. The growth of the pathogen was observed after 2 days of incubation.

[0031] The results are as follows Figure 4 As shown, Pseudomonas thaliana CS95 has an antagonistic effect on the pathogens of peach brown rot, pear black spot, citrus blue mold, citrus sour rot and pepper wilt.

[0032] Example 4: Application of Pseudomonas thaliana CS95 in the prevention and control of citrus canker To test the preventive effect of Pseudomonas thuringiensis CS95 on citrus canker in the field, potted citrus seedlings (3 years old, 1.2 m tall, 2 cm in diameter at ground level) were selected as the plant material. 1.0 × 10⁶ seedlings were prepared. 6 CFU / mL of Xanthomonas citrus subsp. Xcc bacterial suspension and OD 600 The CS95 bacterial solution with a concentration of 1.0 was used as the treatment agent, and the inoculation method was leaf spraying.

[0033] 1. Prevention of citrus canker by Pseudomonas thaliana CS95 Two different branches of the same Newhall navel orange tree were selected for treatment. Wounds were made on all the leaves using a needle. Figure 5 The branches of the control group to the left of A were first treated with sterile water. Figure 5 The branch of the right-hand treatment group of A in the diagram is represented by OD.600 Spray with a 1.0 × 10⁻⁶ solution of *Pseudomonas thuringiensis* CS95, and allow to air dry for 3-5 hours until completely dry. After drying, use a 1.0 × 10⁻⁶ solution... 6 The entire plant was sprayed with Xcc bacterial solution at cfu / mL, and the whole plant was covered with a black plastic bag and cultured in the dark at room temperature for 1-2 days. Then it was moved outdoors and cultured for another 15-30 days. The disease situation was observed every day, and the preventive effect was observed at 15 days and 30 days of culture.

[0034] Figure 5 Figure B shows that after 15 days of treatment, the control group leaves had yellow halos or callus protrusions around the wounds, indicating that Xanthomonas citrinum subsp. citrinum Xcc solution could successfully infect Newhall navel orange leaves in this experiment; while the leaves of the treatment group, which were sprayed with Pseudomonas thaliana CS95 solution and then with Xanthomonas citrinum subsp. citrinum Xcc solution, did not have yellow halos or callus protrusions, the leaf tissue did not have obvious canker symptoms, and there was obvious immune necrosis reaction at the wound site. Figure 5 The C-value in the study showed that after 30 days of treatment, the canker symptoms in the control group were significantly aggravated, and the leaves turned yellow overall. In contrast, the canker symptoms in the treatment group sprayed with *Pseudomonas thuringiensis* CS95 were not obvious, and the leaves remained in relatively good condition. These results indicate that the bacterial solution containing *Pseudomonas thuringiensis* CS95 can effectively prevent the occurrence of citrus canker.

[0035] 2. Treatment of citrus canker with Pseudomonas thaliana CS95 Two different branches of the same Newhall navel orange tree were selected for treatment. Wounds were made on all the leaves using a needle. First, a 1.0×10... 6 Spray the entire plant with a CFU / mL Xcc bacterial solution, then allow it to air dry for 3-5 hours until completely dry. After drying, [the solution will contain...] Figure 6 In Figure A, the branches of the control group on the left were treated with sterile water by spraying, while the branches of the experimental treatment group on the right were treated with OD. 600 Spray the plant with a CS95 bacterial solution of 1.0, cover the entire plant with a black plastic bag, and incubate in the dark at room temperature for 1-2 days. Then move the plant outdoors to continue incubation for 15-30 days. Observe the disease situation daily, and observe the treatment effect at 15 days and 30 days of incubation.

[0036] At 15 days post-treatment, the control group showed yellow halos or callus protrusions around the wounds on the leaves, indicating that *Xanthomonas citrinum* subsp. *citrinum* Xcc suspension could successfully infect Newhall navel orange leaves in this experiment. However, Newhall navel orange leaves inoculated with *Xanthomonas citrinum* subsp. *citrinum* Xcc suspension, when subsequently sprayed with *Pseudomonas thaliana* CS95 suspension, did not show yellow halos or callus protrusions, and the leaf tissue showed no obvious symptoms of canker disease. A significant immune necrosis reaction was observed at the wound site. Figure 6 (B in the text). Similarly, at 30 days of treatment, the leaf canker symptoms in the control group were further aggravated, significantly more severe than those in the treatment group. Figure 6 (C in the text). The results showed that bacterial suspension containing Pseudomonas thaliana CS95 could effectively inhibit and treat citrus canker.

[0037] Example 5: *Pseudomonas thaliana* CS95 induces an immune response in citrus fruits To investigate whether *Pseudomonas thuringiensis* CS95 exerts its disease resistance by inducing an immune response in citrus, the same Newcher navel orange leaf was selected. The left side was treated with water injection as a control (CK), while the right side was treated with OD injection. 600 =1.0% of the bacterial suspension of *Pseudomonas thaliana* CS95. After three days of normal culture at room temperature, the phenotype of the leaves was observed, and quantitative PCR was further performed to detect the expression of immune-related genes on both sides of the leaves.

[0038] Figure 7 A in the image shows that a significant hypersensitive necrosis reaction occurred on the right side of the leaf after injection of Pseudomonas thaliana CS95 bacterial solution, and immune-related genes were also observed. CsPR1 , CsPR2 and CsPAL Significantly induced expression ( Figure 7 (B in the text) indicates that treatment with Pseudomonas thaliana CS95 can induce an immune response in plants, thereby enabling plants to control pathogens.

Claims

1. A strain of Pseudomonas meliticum ( Pseudomonas mediterranea CS95, characterized in that, Its accession number is CCTCC NO. M20261044.

2. A biological agent, characterized in that, The active ingredient is a culture containing the Pseudomonas natans CS95 as described in claim 1.

3. The formulation according to claim 2, characterized in that, The concentration of the culture of *Pseudomonas thaliana* CS95 was OD. 600 =1.

0.

4. The formulation according to claim 2, characterized in that, The preparation method of the culture of Pseudomonas thaliana CS95 is as follows: Pseudomonas thaliana CS95 is inoculated into LB liquid medium and cultured at 28°C and 200 rpm.

5. The use of the *Pseudomonas thaliana* as described in claim 1 in the preparation of biological agents for the prevention and treatment of citrus canker.

6. The use of the *Pseudomonas thaliana* CS95 according to claim 1 or the formulation according to any one of claims 2-4 in any of the following aspects: (1) Prevention and control of plant diseases, the plant diseases mentioned are peach brown rot, citrus blue mold, citrus sour rot, pear black spot, pepper bacterial wilt or citrus canker; (2) Enhance plant immune response.

7. A method for preventing and controlling citrus canker, characterized in that, The procedure includes the following steps: applying the Mediterranean Pseudomonas CS95 of claim 1 or the preparation of any one of claims 2-4 to citrus plants.

8. The method according to claim 7, characterized in that, The Mediterranean Pseudomonas CS95 of claim 1 or the preparation of any one of claims 2-4 prevents and controls citrus canker by inhibiting the reproduction of citrus canker pathogens and / or promoting the immune response of citrus plants.

9. The application according to claim 7, characterized in that, The method of application is spraying.

Images