Rice ppo2 enzyme mutants and their use in breeding ppo class herbicide-resistant plants

Abstract

The application discloses a rice PPO2 enzyme mutant and application of the rice PPO2 enzyme mutant in breeding of PPO herbicide-resistant plants, and relates to the field of biotechnology.The rice PPO2 enzyme mutant is obtained by mutating the 404th amino acid of a wild-type PPO2 enzyme derived from rice, the amino acid sequence of the wild-type PPO2 enzyme of the rice is shown as SEQ ID NO:1, and the amino acid after mutation of the 404th amino acid is selected from C, F, I, L, M, W, V or Y.Through the mutation, the rice and other plants can obtain PPO herbicide resistance suitable for commercial application, and the PPO2 enzyme maintains normal enzyme catalytic activity, so that the normal growth and development requirements of the plants can be met.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to rice PPO2 enzyme mutants and their application in the cultivation of PPO-resistant herbicides. Background Technology

[0002] In agricultural production, weeds and cultivated crops compete significantly for resources such as light, water, nutrients, and growing space. This competition severely restricts crop yield and quality improvement. Currently, chemical weeding remains the core method of agricultural weed control. However, long-term, single-use application of specific herbicides can induce herbicide resistance in weed populations and may also pose a risk of herbicide damage to crops. Developing herbicide-resistant crop varieties is considered an effective strategy to address the evolution of weed resistance and mitigate herbicide damage to crops. Protoporphyrinogen IX oxidase (PPOX / PPX / PPO; EC 1.3.3.4), as a key target enzyme, has significant theoretical value and application prospects in the development of herbicide-resistant crops.

[0003] PPO enzymes are widely distributed in organisms such as animals, plants, fungi, and bacteria. Their function is to catalyze the oxidation of protoporphyrinogen IX to photosensitive protoporphyrin IX in the presence of molecular oxygen. This enzyme is a key terminal enzyme in the chlorophyll and heme biosynthesis pathways. Higher plants typically encode at least two PPO gene subtypes (PPO1 and PPO2), with PPO1 mainly located in the chloroplast stroma and PPO2 mainly distributed in the mitochondria. In plant physiology, PPO enzymes are important molecular targets for herbicides. PPO inhibitor herbicides specifically inhibit this enzyme activity, leading to the abnormal accumulation of protoporphyrinogen IX in chloroplasts and its extravasation into the cytoplasm, where it is rapidly oxidized to form protoporphyrin IX. Under light conditions, the latter generates reactive oxygen species through photodynamic action, inducing a chain reaction of lipid peroxidation in the cell membrane, ultimately causing programmed cell death in plant cells. Based on this unique mechanism of action, this class of herbicides is classified as light-dependent herbicides.

[0004] PPO inhibitor herbicides possess significant contact killing properties, a short residual period in the soil environment, high safety for crop rotation, and broad-spectrum herbicidal activity, effectively controlling a variety of monocot and dicot weeds. Since the 1960s, PPO inhibitors have been successfully applied for selective control of weeds in farmland. Currently commercially available PPO inhibitors include structural types such as pyrimisulfuron, diphenyl ethers, triazolinones, triazineones, thiadiazoles, and oxazolidinones. It is noteworthy that with the long-term use of these herbicides, several PPO-resistant weed populations have emerged globally. For example, a deletion of glycine at position 210 (ΔG210) in the PPO2L gene of Amaranthustuberculatus produces resistance to the herbicide sulfadiazine (Lactofen); a mutation of arginine at position 98 of the PPO2 gene of Amaranthuspalmeri to glycine or methionine (R98G, R98M) produces resistance to the herbicide flumetsulam (Fomesafen).

[0005] Given public concerns about the safety of exogenous genes in genetically modified crops, products of chemical mutagenesis and gene editing technologies are gaining increasing acceptance. In particular, gene editing technologies such as CRISPR, with their high efficiency and site specificity, have become an emerging direction in the development of glyphosate-resistant crops. By precisely introducing mutations at a few key sites, it is possible to obtain target crop varieties that possess both ideal agronomic traits and high commercial value. There are already cases where mutations at position 422 (leucine to methionine, L422M) and position 442 (phenylalanine to methionine, F422M) of the PPO2 gene in *Oryzasativa Japonica* have resulted in resistance to the herbicide fluroxypyr.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to provide rice PPO2 enzyme mutants and their application in the cultivation of PPO-resistant herbicides, thereby enabling the mutant plants to have resistance to PPO herbicides.

[0008] This invention is implemented as follows: In a first aspect, the present invention provides a rice PPO2 enzyme mutant, which is obtained by mutating the 404th amino acid of wild-type PPO2 enzyme derived from rice. The amino acid sequence of wild-type PPO2 enzyme of rice is shown in SEQ ID NO: 1, and the amino acid after the mutation of the 404th amino acid is selected from C, F, I, L, M, W, V or Y.

[0009] Secondly, the present invention also provides a nucleic acid molecule that encodes a rice PPO2 enzyme mutant of any of the above.

[0010] Thirdly, the present invention also provides an expression cassette comprising the aforementioned nucleic acid molecules.

[0011] Fourthly, the present invention also provides a carrier comprising the above-described nucleic acid molecule or the above-described expression cassette.

[0012] Fifthly, the present invention also provides a recombinant bacterium or recombinant cell, comprising: the above-mentioned nucleic acid molecule, the above-mentioned expression cassette or the above-mentioned vector, wherein the recombinant cell is not a plant cell.

[0013] In a sixth aspect, the present invention also provides the application of rice PPO2 enzyme mutants, nucleic acid molecules, expression cassettes, vectors, or the above-mentioned recombinant bacteria or recombinant cells in the cultivation of PPO-resistant herbicides.

[0014] In a seventh aspect, the present invention also provides a method for cultivating plants resistant to PPO herbicides, comprising any one of the following methods: (1) Deliver the above-mentioned nucleic acid molecules or expression cassettes into the target plant cells; (2) Transform the above-mentioned vector into the target plant; (3) Introduce the above-mentioned recombinant bacteria or recombinant cells into the target plant; (4) Edit the endogenous PPO2 gene in the target plant cells to encode the rice PPO2 enzyme mutant mentioned above.

[0015] (5) Mutagenesis and screening of plant cells, tissues, individuals or populations to encode the rice PPO2 mutant.

[0016] The present invention has the following beneficial effects: This invention provides a rice PPO2 enzyme mutant resistant to PPO herbicides. Compared to the wild-type rice PPO2 enzyme, a mutation has been made at amino acid position 404, with the mutated amino acid selected from C, F, I, L, M, W, V, or Y. The PPO2 enzyme mutant provided by this invention is derived from rice and is more readily accepted by consumers. By modifying the wild-type rice PPO2 gene at specific sites, rice resistant to PPO herbicides can be obtained.

[0017] Plants transformed with this PPO2 enzyme mutant not only possess resistance to PPO herbicides suitable for commercial application, but also maintain normal enzyme catalytic activity of the PPO2 enzyme, thus meeting the normal growth and development needs of the plant. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 OsWT vector map; Figure 2 Figure showing the results of the bensulfuron-methyl resistance test for OsWT and its mutants; Figure 3 The figure shows the results of the bensulfuron-methyl resistance test for OsWT and its mutants. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0021] As used herein, the term "vector" refers to a nucleic acid molecule capable of delivering a target gene into a specific host cell and enabling that gene to replicate and be expressed (transcribed and translated) within the cell. This term includes vectors that are self-replicating nucleic acid molecule structures as well as vectors that bind to the genome of the host cell into which they have been introduced. Some vectors can direct the expression of nucleic acid molecules operatively linked to them. Such vectors are referred to herein as "expression vectors."

[0022] The term "cell" refers to a cell into which foreign nucleic acid molecules have been introduced, including the progeny of such cells. It is capable of expressing foreign nucleic acid molecules inside the cell or on the cell membrane, or releasing them extracellularly.

[0023] In a first aspect, the present invention provides a rice PPO2 enzyme mutant, comprising the following mutations: It was obtained by mutating the 404th amino acid of wild-type PPO2 enzyme derived from rice. The amino acid sequence of wild-type PPO2 enzyme from rice is shown in SEQ ID NO: 1. The amino acid after the mutation at the 404th amino acid position is selected from C, F, I, L, M, W, V, or Y. C is cysteine, F is phenylalanine, I is isoleucine, L is leucine, M is methionine, V is valine, W is tryptophan, and Y is tyrosine.

[0024] The inventors discovered that by mutating a specific amino acid at position 404 of the wild-type PPO2 enzyme in rice, rice can acquire resistance to PPO herbicides (especially sulfadiazine and sulfadiazine) while maintaining its own enzyme activity, thereby maintaining the normal growth and development of rice.

[0025] In a preferred embodiment of the present invention, the amino acid after mutation at position 404 is selected from C, I, L, M, V, or W. C is cysteine, I is isoleucine, L is leucine, M is methionine, V is valine, and W is tryptophan. Mutating the 404th amino acid to any of the above-mentioned amino acids enables the recombinant bacteria or recombinant cells carrying the mutant gene to possess good resistance to the herbicides sulfadiazine and sulfadiazine.

[0026] In a preferred embodiment of the present invention, the amino acid after the mutation at position 404 is selected from C, I, L, M, or V. The mutation at position 404 to any one of these amino acids enables recombinant bacteria or recombinant cells carrying the mutant gene to further enhance their resistance to pyrimethanil.

[0027] PPO inhibitor herbicides are selected from at least one of the following: diphenyl ether herbicides, triazoline herbicides, triazine ketone herbicides, thiadiazole herbicides, oxazolidinone herbicides, uridine herbicides, pyrimidine dione herbicides, and N-benzoimide herbicides. Uriazine derivatives are selected from pyrimisulfuron, flupropargyl, bispyribac-methyl, or pyrimisulfuron.

[0028] Secondly, the present invention also provides a nucleic acid molecule that encodes a rice PPO2 enzyme mutant of any of the above.

[0029] The term "nucleic acid molecule encoding any of the above-mentioned PPO2 enzyme mutants with resistance to PPO herbicides" can be a polynucleotide that includes encoding the mutant protein of the present invention, or it can also include a polynucleotide that includes additional coding and / or non-coding sequences.

[0030] With the amino acid sequence provided in this invention, those skilled in the art can easily obtain the nucleic acid sequence encoding the above-mentioned plant PPO2 enzyme mutant based on codon degeneracy. For example, a corresponding nucleotide mutation can be made in the nucleic acid sequence encoding the wild-type plant PPO2 enzyme to obtain the nucleic acid sequence encoding the above-mentioned plant PPO2 enzyme mutant. This is easily achievable by those skilled in the art.

[0031] In one alternative implementation, those skilled in the art can optimize the codon sequence based on the codon preference of PPO2 enzymes in different crops.

[0032] Thirdly, the present invention also provides an expression cassette comprising the aforementioned nucleic acid molecules; In a preferred embodiment of the present invention, the expression box further includes a promoter and a terminator.

[0033] Fourthly, the present invention also provides a carrier comprising the above-described nucleic acid molecule or the above-described expression cassette.

[0034] The carrier includes, but is not limited to, expression carriers, shuttle carriers, etc. An expression carrier is preferred.

[0035] The term "expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well-known in the art. Any plasmid and vector can be used as long as it can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational control elements.

[0036] In a preferred embodiment of the present invention, the vector further includes a screening marker gene and a regulatory element. In some embodiments, the regulatory element may comprise a leader sequence, a polyadenylated sequence, a propeptide sequence, a signal sequence, or any combination thereof, without limitation. In one embodiment, a promoter and a transcription terminator may also be classified as regulatory elements.

[0037] Fifthly, the present invention also provides a recombinant bacterium or recombinant cell, comprising: the above-mentioned nucleic acid molecule, the above-mentioned expression cassette or the above-mentioned vector, wherein the recombinant cell is not a plant cell; In a preferred embodiment of the present invention, the recombinant bacteria or recombinant cells are bacteria, fungi, mammalian cells or insect cells.

[0038] In a preferred embodiment of the present invention, the bacteria are Agrobacterium or Escherichia coli; the fungus is yeast.

[0039] Recombinant cells can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher non-plant eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces, Salmonella typhimurium bacterial cells, and fungal cells such as yeast.

[0040] The aforementioned recombinant bacteria (or genetically engineered bacteria) are prepared by transforming a recombinant expression vector into a host microorganism using conventional methods in the art. The host microorganism can be any conventional host microorganism in the art, as long as it satisfies the requirement that the recombinant expression vector can stably replicate on its own and that the foreign gene it carries can be effectively expressed. The host microorganism can be bacteria or fungi.

[0041] In a sixth aspect, the present invention also provides the application of rice PPO2 enzyme mutants, nucleic acid molecules, expression cassettes, vectors, or the above-mentioned recombinant bacteria or recombinant cells in the cultivation of PPO-resistant herbicides. In a preferred embodiment of the present invention, the application includes at least one of the following application methods: (1) Delivering nucleic acid molecules or expression cassettes into the target plant cells; (2) Transform the vector into the target plant; (3) Introduce recombinant bacteria or recombinant cells into the target plant; (4) Edit the endogenous PPO2 gene in the target plant cells to encode a rice PPO2 enzyme mutant; (5) Mutagenesis and screening of plant cells, tissues, individuals or populations to encode the rice PPO2 mutant.

[0042] In a preferred embodiment of the present invention, the target plant is selected from rice, corn, wheat, soybean, peanut, cotton, sorghum, rapeseed, barley, pea, potato, sunflower, sugarcane or tobacco. In a preferred embodiment of the present invention, the target plant is selected from rice.

[0043] In one alternative implementation, the method introduced is selected from genetic transformation methods, genome editing methods, or gene mutation methods.

[0044] The above-mentioned genetic transformation methods include, but are not limited to: producing individuals with PPO herbicide resistance by self-pollination of parent plants carrying the gene of a PPO2 mutant plant resistant to PPO herbicides or by hybridization with other plant individuals.

[0045] In other embodiments, the transformation methods described above include, but are not limited to, Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube pathway transformation. Gene editing methods include, but are not limited to, at least one of the following: LEAPER technology, CRISPR / Cas gene editing technology, zinc-finger nucleases (ZFN) mediated by artificial nucleases, transceripation activator-like effector nucleases (TALEN), and Cre-loxp gene knockout technology.

[0046] LEAPER technology is a technique that introduces an RNA (arRNA) sequence complementary to the target site into the cell, recruiting ADAR proteins to edit the RNA at the target site. The RNA used in this technique, complementary to the target site sequence, can stimulate highly efficient RNA editing at the target site without any modification.

[0047] In a preferred embodiment of the present invention, the editing tool used in the CRISPR / Cas gene editing technology is selected from any one of CRISPR / Cas9, CRISPR / Cas13, CRISPR / Cas12, and CRISPR / Cas14.

[0048] In one implementation, the PPO2 enzyme-encoding gene in the target plant cell is edited using CRISPR / Cas9 technology to give it the gene encoding the PPO2 enzyme mutant described above, thereby obtaining a new plant variety resistant to PPO herbicides and capable of normal growth and development. Gene mutation methods include, but are not limited to, mismatch PCR, site-directed mutagenesis PCR, geneshuffling PCR, or mutation breeding (such as chemical or radiation-induced mutagenesis).

[0049] In a preferred embodiment of the present invention, the PPO inhibitor herbicide is selected from at least one of diphenyl ether herbicides, triazoline herbicides, triazine ketone herbicides, thiadiazole herbicides, oxazolidinone herbicides, uracil herbicides, pyrimidine dione herbicides, and N-benzoimide herbicides.

[0050] Diphenyl ether herbicides include, but are not limited to: ethoxyflufenican, ethoxyflufenican, flufenoxuron, flufenoxuron, flufenoxuron, flufenoxuron, bensulfuron-methyl, and flufenoxuron. Triazoline ketones include, but are not limited to: mesotrione, bensulfuron-methyl, sulfadiazine, cyclosulfonyl, and benzoxazole-fluoxetine; Triazinones include, but are not limited to: hexaazinone and metribuzin. Thiadiazoles include, but are not limited to: bentazon; Pyrimidine diones include, but are not limited to: bispyribac-sodium; N-Benzimides include, but are not limited to, benzobicycloketones.

[0051] In a preferred embodiment of the present invention, the uridine derivatives are selected from pyrimisulfuron, flupropargyl, bispyribac-sodium, or pyrimisulfuron.

[0052] The structural formula of Saflufenacil is as follows: .

[0053] The structural formula of isoxafenacil is as follows: .

[0054] In a seventh aspect, the present invention also provides a method for cultivating plants resistant to PPO herbicides, comprising any one of the following methods: (1) Deliver the above-mentioned nucleic acid molecules or expression cassettes into the target plant cells; (2) Transform the above-mentioned vector into the target plant; (3) Introduce the above-mentioned recombinant bacteria or recombinant cells into the target plant; (4) Edit the endogenous PPO2 gene in the target plant cells to encode the rice PPO2 enzyme mutant mentioned above.

[0055] (5) Mutagenesis and screening of plant cells, tissues, individuals or populations to encode the rice PPO2 mutant.

[0056] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0057] Example 1 This embodiment provides a method for obtaining rice PPO2 enzyme (OsPPO2) mutants, and the experimental method is as follows: 1. Construct a mutant library of the OsPPO2 gene. (1) Using conventional methods to separate wild-type rice ( Oryzasativa The RNA was reverse-engineered into cDNA, and primers were designed and synthesized based on the cDNA sequence and the sequence of the vector pADV7. An expression vector encoding the wild-type rice PPO2 gene was successfully constructed using conventional PCR and recombination methods. The vector was named OsWT, and its structure is shown below. Figure 1 As shown in SEQ ID NO: 1, the amino acid sequence of wild-type rice PPO2 is shown in SEQ ID NO: 2, and the base sequence of its encoding gene is shown in SEQ ID NO: 1.

[0058] (2) Using forward primer P1 and reverse primer P2, mismatch PCR was performed with the OsWT vector as a template. The base sequences of the primers used are as follows: P1:ATGATTACGCCTGCAGCTTAATTAATGCTCTCTCCTGC; P2: CGCGAAGGCAAATCCTGCAGGCTAATTGTCCTGATC.

[0059] PCR reaction system (20ul): 10ul 2X T5 Super PCR Mix, 1ul 10uM P1, 1ul 10uM P2, 0.1ul plasmid, 1ul 20X MnCl2, 6.9ul water.

[0060] PCR reaction program: 94℃, 2 min; 94℃, 15 s; 64℃, 15 s; 72℃, 100 s; 25 cycles. The PCR product was treated with 1 μL of DpnI enzyme at 37℃ for 1 h and then subjected to 1% agarose gel electrophoresis. The electrophoresis results showed a band of approximately 1.7 kb. The target band was then excised, and the gel was recovered for later use.

[0061] (3) The gel-recovered product was ligated to the pADV7 vector, which had been digested with Pac I and Sbf I, using a homologous recombinase to obtain the recombinant product. The homologous recombinase used was Abclonal's 2X MultiF Seamless AssemblyMix, and the specific homologous recombination reaction system is as follows: 2X MultiF Seamless Assembly Mix2.5ul 0.5 μL of pADV7 vector after double enzyme digestion 2ul of mismatched PCR product After the system is mixed, react at 50°C for 30 min.

[0062] (4) Transform the above recombinant product into PPO-deficient Escherichia coli (knockout) hemG Among the top 10 E. coli genes (ΔhemG), HemG The gene encodes E. coli's own protoporphyrinogen oxidase (PPO), which is responsible for the conversion of protoporphyrinogen IX to protoporphyrin IX in the heme synthesis pathway. Knockout HemG Subsequently, the strain itself was unable to synthesize heme, and its growth was severely inhibited. It had to rely on the exogenous PPO gene to grow normally, thus constructing a "positive selection" system.

[0063] Transform the recombinant product into knockout hemG After thoroughly mixing the E. coli TOP10 gene-derived cells, place them on ice for 30 min; heat shock at 42℃ for 90 s, then incubate on ice for 5 min, and add 500 μL of LB liquid medium; culture at 37℃ and 150 rpm for 90 min with shaking.

[0064] After this step, the pADV7 vector carrying the OsPPO2 mutant gene is transformed into ΔhemG competent cells to obtain the transformation product, which is the OsPPO2 gene mutant library.

[0065] 2. Resistance screening After centrifuging the above-mentioned transformation products at low speed, the excess culture medium was removed, and the cells were resuspended in 100 μL of liquid culture medium. The cells were then inoculated onto selection medium containing different concentrations of phenylsulfuron-methyl and cultured at 37°C.

[0066] The screening medium was LB solid medium, with the addition of a certain concentration of kanamycin and different concentrations of sulfadiazine herbicide.

[0067] 3. Sequencing and sequence alignment analysis (1) Select single clones that grow on the selection medium, shake them in LBK liquid medium (i.e., LB medium with added kanamycin), and then detect the bacterial culture using primers M13 F-47 and M13 R-48. The clones with a band of approximately 1.9 kb were sent for sequencing. The successfully sequenced clones contained the OsPPO2 mutant gene, which encodes the OsPPO2 enzyme mutant, named OsMV.

[0068] (2) The amino acid sequence of the OsPPO2 enzyme mutant obtained above was compared with that of the wild-type OsPPO2 enzyme. The results showed that, compared with the wild-type OsPPO2 enzyme, the 404th amino acid residue of OsMV is V, that is, the 404th amino acid of the wild-type OsPPO2 enzyme was mutated from A to V, and a new mutant OsMV was obtained.

[0069] Example 2 This embodiment provides 18 OsPPO2 mutants.

[0070] Design primers to perform a saturation mutation on amino acid position 404 of the wild-type OsPPO2 enzyme. The primers are as follows: 404C-F:AGGATTTGGTTGTTTGATACCCTATAAGGAACAGC; 404D-F:AGGATTTGGTGACTTGATACCCTATAAGGAACAGC; 404E-F: AGGATTTGGTGaaTTGATACCCTATAAGGAACAGC; 404F-F: AGGATTTGGTttCTTGATACCCTATAAGGAACAGC; 404G-F: AGGATTTGGTGgCTTGATACCCTATAAGGAACAGC; 404H-F: AGGATTTGGTGaCTTGATACCCTATAAGGAACAGC; 404I-F: AGGATTTGGTatCTTGATACCCTATAAGGAACAGC; 404K-F: AGGATTTGGTaagTTGATACCCTATAAGGAACAGC; 404L-F: AGGATTTGGTttgTTGATACCCTATAAGGAACAGC; 404M-F: AGGATTTGGTatgTTGATACCCTATAAGGAACAGC; 404N-F: AGGATTTGGTaaCTTGATACCCTATAAGGAACAGC; 404P-F: AGGATTTGGTcCCTTGATACCCTATAAGGAACAGC; 404Q-F: AGGATTTGGTcaaTTGATACCCTATAAGGAACAGC; 404R-F: AGGATTTGGTcgCTTGATACCCTATAAGGAACAGC; 404S-F: AGGATTTGGTtCCTTGATACCCTATAAGGAACAGC; 404T-F: AGGATTTGGTaCCTTGATACCCTATAAGGAACAGC; 404W-F: AGGATTTGGTtggTTGATACCCTATAAGGAACAGC; 404Y-F: AGGATTTGGTtaCTTGATACCCTATAAGGAACAGC; 404-R: ACCAAATCCTTCCAATGGTTTTTTGACATCTTCCTTC.

[0071] PCR test case TOYOBO code FX, your PCR test case (50ul): 2X PCR Buffer for CODE FX25ul 2mM dNTPs5ul Detergent 1ul Detergent 1ul OsWT solution 0.1ul CODE FX DNA Polymerase0.5ul ddH2O17.4ul PCR reaction program: 94℃, 2 min; 98℃, 15 s; 62℃, 15 s; 68℃, 2 min 30 s; 25 cycles; 68℃, 5 min. PCR products were treated with 1 μL of DpnI enzyme at 37℃ for 1 h. 2 μL of each sample was taken and subjected to 1% agarose gel electrophoresis. The electrophoresis results showed a target band of approximately 4.5 kb. The remaining PCR products were purified using a Sangon Biotech purification kit.

[0072] 5 μL of each of the above purified products were transformed into competent E. coli T1 cells, thoroughly mixed, and placed on ice for 30 min; then heat-shocked at 42°C for 90 s, followed by an ice bath for 5 min, and then 500 μL of LB liquid medium was added; the cells were incubated at 37°C with shaking at 150 rpm for 90 min. After centrifugation of the transformation products at low speed, excess medium was removed, and the cells were resuspended in 100 μL of liquid medium and inoculated onto LBK (LB + kanamycin) medium, and incubated overnight at 37°C.

[0073] Five clones were picked from each plate, and after shaking with LBK, PCR was performed using M13F-47 and M13R-48 primers. Two clones with the target band from each primer were selected for sequencing using M13F-47 and M13R-48 primers. Based on the sequencing results, the correct clones were renamed as follows: OsMC, OsMD, OsME, OsMF, OsMG, OsMH, OsMI, OsMK, OsML, OsMM, OsMN, OsMP, OsMQ, OsMR, OsMS, OsMT, OsMW, and OsMY.

[0074] Example 3 The monoclonal bacteria obtained in Example 2 were cultured again, and plasmids OsMC, OsMD, OsME, OsMF, OsMG, OsMH, OsMI, OsMK, OsML, OsMM, OsMN, OsMP, OsMQ, OsMR, OsMS, OsMT, OsMV, OsMW, and OsMY were extracted and transformed into competent cells of ΔhemG bacteria. ΔhemG bacteria transformed with the OsWT plasmid were used as a negative control group. After thorough mixing, the cultures were placed on ice for 30 min; followed by heat shock at 42°C for 90 s, ice bath for 5 min, and then 500 μL of LB liquid medium was added; the cultures were then incubated at 37°C with shaking at 150 rpm for 90 min. 50 μL of bacterial culture from each transformation tube was plated onto LBK medium and incubated at 37°C for two days.

[0075] Three clones were picked from each plate and inoculated into 500 μL of LBK medium, and incubated overnight at 37°C. 1 μL of each sample was then inoculated onto LBK plates containing 0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM, and 0.25 mM concentrations of bensulfuron-methyl (from BASF (China) Co., Ltd., pesticide registration number PD20131930), and placed in a light incubator at 37°C and 5000 Lux. Colony growth was observed in each group. Initial resistance tests showed that the mutants OsMC, OsMI, OsML, OsMM, OsMV, and OsMW exhibited stronger resistance to bensulfuron-methyl than OsWT. The specific mutation types corresponding to the OsMC, OsMI, OsML, OsMM, OsMV, and OsMW mutants are A404C (the 404th amino acid of the OsPPO enzyme is changed from A to C), A404I (the 404th amino acid of the OsPPO enzyme is changed from A to I), A404L (the 404th amino acid of the OsPPO enzyme is changed from A to L), A404M (the 404th amino acid of the OsPPO enzyme is changed from A to M), A404V (the 404th amino acid of the OsPPO enzyme is changed from A to V), and A404W (the 404th amino acid of the OsPPO enzyme is changed from A to W).

[0076] One clone from each of the plasmid transformation plates of the mutants OsMC, OsMI, OsML, OsMM, OsMV, and OsMW was picked, and a wild-type OsPPO clone was added to each. The clones were then inoculated into 500 μL of LBK medium and incubated overnight at 37°C. 1 μL of each sample was inoculated onto LBK plates containing 0 mM, 0.1 mM, 0.15 mM, 0.2 mM, and 0.25 mM bensulfuron-methyl ammonium sulfate, and placed in a light incubator at 37°C and 5000 Lux. Colony growth was photographed and recorded after 48 hours. Detailed results are shown in [link to results]. Figure 2 .

[0077] from Figure 2 As can be seen, under the laboratory conditions provided in this embodiment, all mutants grew normally on LBK plates containing 0 mM bensulfuron-methyl, and their growth was not significantly different from that of OsWT, indicating that the basic enzyme activities of these mutants were not affected. On resistance plates containing 0.1 mM bensulfuron-methyl, OsWT and the mutants OsMC, OsMI, OsML, OsMM, OsMV, and OsMW all grew, but the growth of OsMC, OsMI, OsML, OsMM, OsMV, and OsMW mutants was slightly better than that of OsWT.

[0078] On plates with higher concentrations of bensulfuron-methyl, such as 0.15 mM bensulfuron-methyl plates, the OsMC, OsMI, OsML, OsMM, OsMV, and OsMW mutants all showed obvious bacterial growth, while OsWT showed no obvious bacterial growth. This indicates that the recombinant bacteria of these mutants exhibited superior bensulfuron-methyl resistance compared to the wild-type OsPPO2.

[0079] On 0.2 mM bensulfuron-methyl resistance plates, the OsMC, OsMI, OsML, OsMM, OsMV, and OsMW mutants all showed obvious plaque growth, indicating that the bensulfuron-methyl resistance of these mutants was significantly higher than that of the wild-type OsPPO2. The above experimental procedure was repeated twice, and the results were consistent.

[0080] The above results indicate that the mutants OsMC, OsMI, OsML, OsMM, OsMV, and OsMW obtained by mutating the 404th amino acid of the PPO2 enzyme in wild-type rice have the ability to resist the herbicide phenylsulfuron-methyl.

[0081] Example 4 Three clones were picked from each of the OsMC, OsMD, OsME, OsMF, OsMG, OsMH, OsMI, OsMK, OsML, OsMM, OsMN, OsMP, OsMQ, OsMR, OsMS, OsMT, OsMV, OsMW, and OsMY plates from Example 3, and inoculated into 500 μL of LBK medium and incubated overnight at 37°C. 1 μL of each sample was inoculated onto LBK plates containing 0 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, and 0.8 mM concentrations of pyrimethanil, and placed in a light incubator at 37°C and 5000 Lux light intensity. The colony growth of each group was observed. Initial resistance tests showed that the mutants OsMC, OsMF, OsMI, OsML, OsMM, OsMV, OsMW, and OsMY had stronger resistance to pyrimethanil than OsWT. The specific mutation types corresponding to the OsMC, OsMF, OsMI, OsML, OsMM, OsMV, OsMW, and OsMY mutants are A404C (the 404th amino acid of the OsPPO enzyme is changed from A to C), A404F (the 404th amino acid of the OsPPO enzyme is changed from A to F), A404I (the 404th amino acid of the OsPPO enzyme is changed from A to I), A404L (the 404th amino acid of the OsPPO enzyme is changed from A to L), A404M (the 404th amino acid of the OsPPO enzyme is changed from A to M), A404V (the 404th amino acid of the OsPPO enzyme is changed from A to V), A404W (the 404th amino acid of the OsPPO enzyme is changed from A to W), and A404Y (the 404th amino acid of the OsPPO enzyme is changed from A to Y).

[0082] One clone from each of the plasmid transformation plates of the mutants OsMC, OsMF, OsMI, OsML, OsMM, OsMV, OsMW, and OsMY was picked and inoculated into 500 μL of LBK medium and incubated overnight at 37°C. 1 μL of each sample was then inoculated onto LBK plates containing 0 mM, 0.3 mM, 0.6 mM, and 0.8 mM concentrations of pyrimethanil, and placed in a light incubator at 37°C and 5000 Lux. Colony growth was photographed and recorded after 48 hours. Specific results are shown in [link to results]. Figure 3 .from Figure 3It was found that under the conditions of this laboratory, all mutants grew normally on LBK plates containing 0 mM pyrimethanil, showing no significant difference in growth compared to OsWT, indicating that the basic enzyme activities of these mutants were not affected. On resistant plates containing 0.3 mM pyrimethanil, OsWT showed almost no plaque growth, while OsMC, OsMF, OsMI, OsML, OsMM, OsMV, OsMW, and OsMY mutants showed significant plaque growth at their corresponding positions, exhibiting pyrimethanil resistance. On plates with higher pyrimethanil concentrations, such as 0.6 mM pyrimethanil, significant plaque growth was still observed at the corresponding positions of OsMC, OsMI, OsML, OsMM, and OsMV mutants, indicating that the recombinant bacteria containing OsMC, OsMI, OsML, OsMM, and OsMV mutants had at least 0.6 mM pyrimethanil resistance, higher than that of wild-type OsWT. This result indicates that the mutants OsMC, OsMF, OsMI, OsML, OsMM, OsMV, OsMW, and OsMY all possess the ability to resist the herbicide pyrimethanil.

[0083] Based on the results of all the resistance tests above, it can be concluded that a mutation at position 404 of the amino acid in OsPPO enzyme can confer resistance to PPO herbicides without affecting the basic enzyme activity. Specific mutation types are A404C (the 404th amino acid of OsPPO enzyme is changed from A to C), A404F (the 404th amino acid of OsPPO enzyme is changed from A to F), and A404I (the 404th amino acid of OsPPO enzyme is changed from A to F). The four amino acids at position 404 of the OsPPO enzyme are: I (from mutant A), L (from mutant A), M (from mutant A), V (from mutant A), W (from mutant A), and Y (from mutant A).

[0084] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A rice PPO2 enzyme mutant, characterized in that, It is obtained by mutating the 404th amino acid of wild-type PPO2 enzyme derived from rice. The amino acid sequence of wild-type PPO2 enzyme from rice is shown in SEQ ID NO:

1. The amino acid after the mutation at the 404th amino acid position is selected from C, F, I, L, M, W, V or Y.

2. The rice PPO2 enzyme mutant according to claim 1, characterized in that, The amino acid resulting from the mutation at position 404 is selected from C, I, L, M, V, or W.

3. The rice PPO2 enzyme mutant according to claim 1 or 2, characterized in that, The amino acid resulting from the mutation at position 404 is selected from C, I, L, M, or V.

4. A nucleic acid molecule, characterized in that, It encodes the rice PPO2 enzyme mutant according to any one of claims 1-3.

5. An expression box, characterized in that, It includes the nucleic acid molecule as described in claim 4; Preferably, the expression box further includes a promoter and a terminator.

6. A carrier, characterized in that, It includes the nucleic acid molecule of claim 4 or the expression cassette of claim 5; Preferably, the vector further includes a screening marker gene and a regulatory element.

7. A recombinant bacterium or recombinant cell, characterized in that, It includes: The nucleic acid molecule of claim 4, the expression cassette of claim 5, or the vector of claim 6, wherein the recombinant cell is not a plant cell; Preferably, the recombinant bacteria or recombinant cells are bacteria, fungi, mammalian cells or insect cells.

8. The application of the rice PPO2 enzyme mutant as described in any one of claims 1-3, the nucleic acid molecule as described in claim 4, the expression cassette as described in claim 5, the vector as described in claim 6, or the recombinant bacteria or recombinant cells as described in claim 7 in the cultivation of plants resistant to PPO herbicides; Preferably, the application includes at least one of the following application methods: (1) Deliver the nucleic acid molecule or the expression cassette into the target plant cell; (2) Transform the target plant using the vector; (3) Introduce the recombinant bacteria or recombinant cells into the target plant; (4) Edit the endogenous PPO2 gene in the target plant cells to encode the rice PPO2 enzyme mutant; (5) Mutagenesis and screening of plant cells, tissues, individuals or populations to encode the rice PPO2 mutant; Preferably, the target plant is selected from rice, corn, wheat, soybean, peanut, cotton, sorghum, rapeseed, barley, pea, potato, sunflower, sugarcane or tobacco; Preferably, the target plant is selected from rice.

9. The application according to claim 8, characterized in that, The PPO inhibitor herbicide is selected from at least one of diphenyl ether herbicides, triazoline herbicides, triazine ketone herbicides, thiadiazole herbicides, oxazolidinone herbicides, uridine herbicides, pyrimidine dione herbicides, and N-benzoimide herbicides. Preferably, the uracil is selected from pyrimisulfuron, flupropargyl, bispyribac-methyl, or pyrimisulfuron.

10. A method for cultivating plants resistant to PPO herbicides, characterized in that, It includes any of the following methods: (1) Deliver the nucleic acid molecule of claim 4 or the expression cassette of claim 5 into the target plant cell; (2) Transform the target plant using the vector described in claim 6; (3) Introducing the recombinant bacteria or recombinant cells as described in claim 7 into the target plant; (4) Edit the endogenous PPO2 gene in the target plant cells to encode the rice PPO2 enzyme mutant as described in any one of claims 1-3; (5) Mutagenesis and screening of plant cells, tissues, individuals or populations to encode the rice PPO2 mutant as described in any one of claims 1-3.

Images