Integrated purification and measurement of DNA methylation in automated reaction cartridges and co-measurement of mutations and / or mRNA expression levels

Abstract

In various embodiments, methods of assaying methylation of DNA are provided. In one illustrative, but non-limiting, embodiment, the method comprises: i) contacting a biological sample comprising nucleic acids with a first matrix material comprising a first column or filter, wherein the matrix material binds and / or filters the nucleic acids in the sample, thereby purifying DNA; ii) eluting the bound DNA from the first matrix material and denaturing the DNA to produce eluted denatured DNA; iii) heating the eluted DNA in the presence of bisulfite ions to produce deaminated nucleic acids; iv) contacting the deaminated nucleic acids with a second matrix material comprising a second column to bind the deaminated nucleic acids to the second matrix material; v) desulfonating the bound deaminated nucleic acids and / or simultaneously eluting and desulfonating the deaminated nucleic acids by contacting the deaminated nucleic acids with an alkaline solution to produce bisulfite converted nucleic acids; vi) eluting the bisulfite converted nucleic acids from the second matrix material; and vii) performing methylation specific PCR and / or nucleic acid sequencing and / or high resolution melting analysis (HRM) on the bisulfite converted nucleic acids to assay methylation of the nucleic acids, wherein at least steps iv) to vi) are performed in a single reaction cartridge.

Description

[0001] This application is a divisional application. The original application was filed on June 14, 2016, with application number 201680048155.X (international application number PCT / US2016 / 037422), entitled "Integration purification and measurement of DNA methylation in an automated reaction cassette and co-measurement of mutation and / or mRNA expression levels".

[0002] Cross-references to related applications This application claims priority and benefit to USSN 62 / 175,916, filed June 15, 2015, the entire text of which is incorporated herein by reference for all purposes.

[0003] Government-supported statement [not applicable] Background Technology

[0004] The genomes of higher eukaryotes contain a modified 5-methylcytosine nucleoside (5-meC). This modification is typically present as part of a dinucleotide CpG, in which cytosine is converted to 5-methylcytosine in a reaction involving the flipping of the target cytosine out of the intact double helix and the transfer of a methyl group from S-adenosylmethionine via a methyltransferase (see, e.g., Klimasauskas et al. (1994) Cell 76: 357-369). This enzymatic conversion is a major epigenetic DNA modification known to be present in vertebrates and is essential for normal embryonic development (see, e.g., Bird (1992)). Cell 70: 5-8; Laird and Jaenisch (1994) Human Mol. Genet. 3: 1487-1495; and Li et al. (1992) Cell 69: 915-926).

[0005] In eukaryotic cells, DNA methylation regulates normal cellular processes such as genomic imprinting, chromosomal instability, and X chromosome inactivation. Typically, DNA methylation occurs at the fifth carbon of cytosine at the 5'-CpG-3' dinucleotide site (called a CpG island or shore) in or near gene promoters. Methylation controls gene expression by downregulating transcription (either through direct inhibition of transcriptional mechanisms or indirectly by recruiting chromatin remodeling proteins). Chromosomal methylation patterns change dynamically during embryonic development, and a correct methylation pattern must be maintained throughout an individual's life. Changes in methylation patterns are associated with aging, and errors in DNA methylation are among the earliest changes occurring during tumorigenesis. Therefore, the detection of methylation at gene promoters is important, especially for the diagnosis and / or monitoring of cancer patients. Epigenetic alterations, including DNA methylation, disrupt the DNA-RNA-protein axis, which describes how genetic information is transcribed into messenger RNA (mRNA). The correlation between genomic DNA variation, mRNA copy number, and protein levels can be described by DNA methylation levels. Therefore, co-measurement of DNA methylation levels and corresponding downstream mRNA levels is important for understanding the mechanisms of epigenetic cellular regulation.

[0006] Several methods have been developed to effectively and accurately detect and quantify methylation. The most commonly used technique is the bisulfite conversion method, which converts unmethylated cytosine into uracil. Once converted, the DNA methylation profile can be determined using standard PCR techniques, sequencing, and other methods.

[0007] Several DNA methylation kits suitable for bisulfite conversion and DNA removal exist (e.g., EZ DNA Methylation from ZymoResearch). TM (Kits). Most kits include several steps, reagents, and incubation cycles, and usually require DNA purification before transformation, although some kits can utilize tissue or plasma / serum as starting material.

[0008] Typically, the bisulfite conversion method requires at least four steps: 1) DNA denaturation; 2) bisulfite incubation; 3) DNA purification; and 4) desulfonation. The final desulfonation step can be performed on-column or in solution, followed by ethanol precipitation. Currently, no methylation kit allows users to complete the entire process in one step—DNA purification, bisulfite incubation, desulfonation, secondary DNA purification, and methylation-specific PCR. Summary of the Invention

[0009] The embodiments included herein may include, but are not limited to, one or more of the following embodiments: The embodiments included herein may include, but are not limited to, one or more of the following embodiments: Implementation Scheme 1: A method for determining the methylation status of nucleic acids, the method comprising: i) Contacting a biological sample containing nucleic acids with a first matrix material comprising a first column or filter, the matrix material binding and / or filtering the nucleic acids in the sample at the first column or filter, thereby purifying DNA.

[0010] ii) Elute the bound DNA from the first matrix material and denature the DNA to produce eluted denatured DNA; iii) Heating the eluted DNA in the presence of bisulfite reagent to produce deaminated nucleic acids; iv) Contact the deamination nucleic acid with a second matrix material containing the second column to bind the deamination nucleic acid to the second matrix material; v) Desulfonate the bound deamination nucleic acid and / or simultaneously elute and desulfonate the nucleic acid by contacting the deamination nucleic acid with an alkaline solution to produce transformed (e.g., bisulfite-converted) nucleic acid. vi) Elution of the bisulfite-converted nucleic acids from the second matrix material; and vii) Perform methylation-specific PCR and / or nucleic acid sequencing and / or high-resolution melting analysis (HRM) on the transformed nucleic acid to determine the methylation of the nucleic acid, wherein at least steps iv) to vi) are performed in a single reaction cassette.

[0011] Implementation Scheme 2: The method of Implementation Scheme 1, wherein at least steps iv) to vi) are carried out in a single reaction chamber.

[0012] Implementation Scheme 3: The method of Implementation Scheme 1, wherein at least steps iii) to vi) are carried out in a single reaction chamber.

[0013] Implementation Scheme 4: The method of Implementation Scheme 1, wherein at least steps ii) to vi) are carried out in a single reaction chamber.

[0014] Implementation Scheme 5: The method of Implementation Scheme 1, wherein at least steps i) to vi) are carried out in a single reaction chamber.

[0015] Implementation Scheme 6: The method of any one of Implementation Schemes 1-5, wherein step vii) is carried out in the same reaction chamber.

[0016] Implementation Scheme 7: The method of any one of Implementation Schemes 1-6, wherein the first matrix material and the second matrix material are the same material forming the same column.

[0017] Implementation Scheme 8: The method of any one of Implementation Schemes 1-7, wherein the first matrix material and the second matrix material form different columns.

[0018] Implementation Scheme 9: The method of any one of Implementation Schemes 1-8, wherein the methylation-specific PCR is performed in the cassette.

[0019] Implementation Scheme 10: The method of any one of Implementation Schemes 1-9, wherein when the nucleic acid sequencing is performed, it is performed in the cassette or in a device coupled to the cassette.

[0020] Implementation Scheme 11: The method of any one of Implementation Schemes 1-10, wherein the cartridge includes a column containing the first matrix material, a sample receiving chamber, a temperature-controlled channel or chamber, a plurality of chambers containing reagents and / or buffers, and at least one of the chambers contains a desulfonate / elution buffer when in use, and wherein the cartridge optionally includes a second column containing the second matrix material.

[0021] Implementation Scheme 12: The method of Implementation Scheme 11, wherein, when used, at least one of the chambers contains a reagent that provides bisulfite ions.

[0022] Implementation Scheme 13: The method of any one of Implementation Schemes 11-12, wherein the second column is absent.

[0023] Implementation Scheme 14: The method of any one of Implementation Schemes 11-13, wherein the second column is present.

[0024] Implementation Scheme 15: The method of any one of Implementation Schemes 11-14, wherein the box further includes a heat circulation channel or chamber in addition to the temperature control channel or chamber.

[0025] Implementation Scheme 16: The method of any one of Implementation Schemes 11-14, wherein the temperature-controlled channel or chamber is a heat circulation channel or chamber.

[0026] Implementation Scheme 17: The method of any one of Implementation Schemes 11-16, wherein the kit includes one or more chambers containing one or more reagents selected from methylation-specific PCR primers, methylation-specific PCR probes, PCR enzymes, and PCR reaction buffers.

[0027] Implementation Scheme 18: The method of Implementation Scheme 17, wherein the cartridge includes one or more chambers containing one or more primers and probes for detecting methylation of the forward strand of bisulfite-converted DNA.

[0028] Implementation Scheme 19: The method of any one of Implementation Schemes 17-18, wherein the cassette comprises one or more chambers containing one or more primers and probes for detecting methylation of the reverse strand of bisulfite-converted DNA.

[0029] Implementation Scheme 20: The method of any one of Implementation Schemes 11-19, wherein the sample receiving chamber, the column, the plurality of chambers, and, when present, the temperature-controlled channel or chamber and / or the thermal circulation channel or chamber, are selectively in fluid communication.

[0030] Implementation Scheme 21: The method of Implementation Scheme 20, wherein the sample receiving chamber, the column, the plurality of chambers, and, when present, the thermal circulation channel or chamber, are selectively in fluid communication via microfluidic channels and valves.

[0031] Implementation Scheme 22: The method of Implementation Scheme 20, wherein the sample receiving chamber, the column, the plurality of chambers, and, when present, the thermal circulation channel or chamber or the port into the thermal circulation channel or chamber, are arranged around a central valve and selectively in fluid communication with a channel in the central valve, wherein the central valve is configured to accommodate a plunger capable of introducing or drawing fluid into or out of the chamber in fluid communication with the central valve.

[0032] Implementation Scheme 23: The method of any one of Implementation Schemes 11-22, wherein the box, when in use, includes: The first chamber containing the sample; The second chamber contains a guanidine thiocyanate-ethanol (GTC-EtOH) solution; The third chamber contains the bisulfite reagent; The fourth compartment contains the buffer solution; The fifth chamber contains the rinsing solution; and The sixth chamber contains the elution / desulfonate grouping reagent.

[0033] Implementation Scheme 24: The method of Implementation Scheme 23, wherein the first chamber contains the sample in the GTC-EtOH-Tween extraction / precipitation reagent.

[0034] Implementation Scheme 25: The method of any one of Implementation Schemes 23-24, wherein GTC-ETOH-Tween buffer is added when or near the time when the sample is placed in the box.

[0035] Implementation Scheme 26: The method of any one of Implementation Schemes 23-25, wherein a bisulfite reagent is added when or near the time when the sample is placed in the box.

[0036] Implementation Scheme 27: The method of Implementation Scheme 23, wherein GTC-ETOH-Tween buffer is provided as a component of the kit.

[0037] Implementation Scheme 28: The method of any one of Implementation Schemes 23-25, wherein the bisulfite reagent is provided as a component of the kit.

[0038] Implementation Scheme 29: The method of any one of Implementation Schemes 11-28, wherein the cassette includes a seventh chamber containing PCR primers and / or probes and / or PCR enzymes.

[0039] Implementation Scheme 30: The method of any one of Implementation Schemes 11-29, wherein the cassette includes an eighth chamber that also contains PCR primers and / or probes and / or PCR enzymes.

[0040] Implementation Scheme 31: The method of Implementation Schemes 29-30, wherein the PCR primers and / or probes and / or enzymes are provided as beads.

[0041] Implementation Scheme 32: The method of any one of Implementation Schemes 1-31, wherein the biological sample comprises one or more samples selected from: cells, tissues and biological liquids containing nucleic acids.

[0042] Implementation Scheme 33: The method of Implementation Scheme 32, wherein the biological sample comprises a biological fluid selected from whole blood, plasma, serum, saliva, mucus, urine, sputum, pancreatic juice and cerebrospinal fluid.

[0043] Implementation Scheme 34: The method of Implementation Scheme 32, wherein the biological sample includes samples selected from: tissue samples, formalin-fixed paraffin-embedded (FFPE) tissue, fresh frozen tissue, fine needle aspirate (FNA) and tissue core biopsy.

[0044] Implementation Scheme 35: The method of any one of Implementation Schemes 1-34, wherein the method includes contacting the biological sample with a lysis solution.

[0045] Implementation Scheme 36: The method of Implementation Scheme 35, wherein the method includes providing the sample in the sample receiving chamber and contacting the sample with the extraction / precipitation solution.

[0046] Implementation Scheme 37: The method of any one of Implementation Schemes 1-36, wherein the matrix material comprises a column material selected from glass or silica, ion exchange resin, cellulose and hydroxyapatite.

[0047] Implementation Scheme 38: The method of Implementation Scheme 37, wherein the matrix material comprises glass.

[0048] Implementation Scheme 39: The method of any one of Implementation Schemes 1-38, wherein the bisulfite ion is provided as a compound selected from ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0049] Implementation Scheme 40: The method of Implementation Scheme 39, wherein the bisulfite ions are provided by ammonium bisulfite.

[0050] Implementation Scheme 41: The method of any one of Implementation Schemes 1-40, wherein the bisulfite is provided in a reagent mixture comprising a scavenger and / or catalyst to prevent oxidation of the bisulfite.

[0051] Implementation Scheme 42: The method of Implementation Scheme 41, wherein the bisulfite is provided in a reagent mixture comprising a scavenger selected from Trolox and hydroquinone.

[0052] Implementation Scheme 43: The method of any one of Implementation Schemes 41-42, wherein the bisulfite is provided in a reagent mixture comprising a polyamine as a catalyst.

[0053] Implementation Scheme 44: The method of any one of Implementation Schemes 1-43, wherein the eluted bound DNA comprises eluting with a low concentration of potassium hydroxide or other base and denaturing the DNA.

[0054] Implementation Scheme 45: The method of Implementation Scheme 44, wherein the eluted bound DNA comprises eluting and denaturing the DNA using an alkaline solution with a pH greater than about pH 10.5.

[0055] Implementation Scheme 46: The method of Implementation Scheme 44, wherein the eluted bound DNA comprises eluting and denaturing the DNA using an alkaline solution with a pH greater than about pH 12.

[0056] Implementation Scheme 47: The method of Implementation Schemes 45-46, wherein the alkaline solution is a 10-15 mM KOH solution.

[0057] Implementation Scheme 48: The method of any one of Implementation Schemes 1-47, wherein the DNA eluted by incubation with bisulfite ions to produce deaminated nucleic acids comprises incubating the DNA in an ammonium bisulfite solution with a concentration ranging from about 6 M to about 7 M.

[0058] Implementation Scheme 49: The method of Implementation Scheme 48, wherein the DNA eluted by incubation with bisulfite ions to produce deaminated nucleic acids comprises incubating the DNA in a solution of ammonium bisulfite at a concentration of about 6.5 M.

[0059] Implementation Scheme 50: The method of Implementation Scheme 49, wherein the incubation comprises transferring DNA from a concentrated bisulfite solution to a temperature-controlled channel or chamber in the box and heating the mixture.

[0060] Implementation Scheme 51: The method of Implementation Scheme 50, wherein the incubation comprises a concentrated bisulfite solution obtained by thermal cycling from a temperature of about 60°C to about 95°C.

[0061] Implementation Scheme 52: The method of any one of Implementation Schemes 1-51, wherein contacting the deaminated nucleic acid with the second matrix material comprises mixing a DNA-bisulfite solution with fresh GTC-EtOH and dispensing the solution onto the second matrix material.

[0062] Implementation Scheme 53: The method of Implementation Scheme 52, wherein the method includes washing the DNA in the second matrix material with fresh GTC-EtOH and then with a rinsing solution.

[0063] Implementation Scheme 54: The method of Implementation Scheme 53, wherein the rinsing solution comprises PEG200.

[0064] Implementation Scheme 55: The method of any one of Implementation Schemes 1-54, wherein the deaminoated nucleic acid to be bound comprises eluting DNA from the second column using a high pH desulfonate buffer and incubating the solution.

[0065] Implementation Scheme 56: The method of Implementation Scheme 55, wherein the incubation duration ranges from about 1 minute to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or about 15 minutes.

[0066] Implementation Scheme 57: The method of Implementation Schemes 55-56, wherein the high pH desulfonate / elution buffer comprises KOH.

[0067] Implementation Scheme 58: The method of any one of Implementation Schemes 55-57, wherein the incubation is performed in a chamber (e.g., chamber 10) previously containing the high pH desulfonate buffer.

[0068] Implementation Scheme 59: The method of any one of Implementation Schemes 1-58, wherein after incubation with bisulfite ions, the temperature-controlled channel or chamber is washed with buffer solution to remove residual bisulfite and neutralize the pH.

[0069] Implementation Scheme 60: The method of any one of Implementation Schemes 1-59, wherein the nucleic acid converted by the bisulfite is subjected to high-resolution melting analysis (HRM) to determine the methylation of the nucleic acid.

[0070] Implementation Scheme 61: The method of any one of Implementation Schemes 1-60, wherein nucleic acid sequencing of the nucleic acid converted by the bisulfite is performed to determine the methylation of the nucleic acid.

[0071] Implementation Scheme 62: The method of any one of Implementation Schemes 1-60, wherein methylation-specific PCR is performed to determine the methylation of the target nucleic acid sequence.

[0072] Implementation Scheme 63: The method of Implementation Scheme 62, wherein the methylation-specific PCR (MSP) is performed using primers specifically targeting methylated sequences and / or primers specifically targeting unmethylated sequences.

[0073] Implementation Scheme 64: The method of Implementation Scheme 62, wherein the methylation-specific PCR includes the MethyLight protocol.

[0074] Implementation Scheme 65: The method of Implementation Scheme 62, wherein a TaqMan PCR reaction is performed using primers specifically targeting methylated and / or unmethylated sequences of bisulfite conversion.

[0075] Implementation Scheme 66: The method of any one of Implementation Schemes 62-65, wherein the MSP uses one or more fluorescent probes that are markers of amplified methylated sequences and / or one or more fluorescent probes that are markers of amplified unmethylated sequences.

[0076] Implementation Scheme 67: The method of Implementation Scheme 66, wherein the fluorescent probe comprises a fluorescent reporter dye and a quencher dye, wherein the probe provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase.

[0077] Implementation Scheme 68: The method of any one of Implementation Schemes 66-67, wherein the methylation signal is determined by a combination of signals from multiple probes that are specifically targeted at different methylation regions in the target amplification region.

[0078] Implementation Scheme 69: The method of any one of Implementation Schemes 66-67, wherein the methylation signal is determined by multiple probes specifically targeting the same methylated region in the target amplification region.

[0079] Implementation Scheme 70: The method of any one of Implementation Schemes 66-67, wherein the plurality of probes includes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more probes.

[0080] Implementation Scheme 71: The method of any one of Implementation Schemes 66-67, wherein the methylation signal is determined by a single probe in the target amplification region.

[0081] Implementation Scheme 72: The method of any one of Implementation Schemes 66-71, wherein the probe operates in a single or multiple manner.

[0082] Implementation Scheme 73: The method of any one of Implementation Schemes 66-71, wherein the probe is operated in a multiplexed manner.

[0083] Implementation Scheme 74: The method of any one of Implementation Schemes 66-73, wherein the probe is run as a nested PCR reaction.

[0084] Implementation Scheme 75: The method of any one of Implementation Schemes 66-74, wherein the PCR reaction includes a bisulfite-contaminated control probe, and if bisulfite is present in the reaction, the probe undergoes bisulfite-mediated cleavage during the PCR process.

[0085] Implementation Scheme 76: The method of any one of Implementation Schemes 1-75, wherein PCR is performed on one or more mutated genes.

[0086] Implementation Scheme 77: The method of any one of Implementation Schemes 1-76, wherein PCR is performed on unconverted DNA as a control.

[0087] Implementation Scheme 78: The method of any one of Implementation Schemes 1-77, wherein PCR is performed on the transformed DNA used as a control.

[0088] Implementation Scheme 79: The method of Implementation Scheme 77, wherein PCR is performed on unconverted DNA, wherein the unconverted DNA is the target of the method.

[0089] Implementation Scheme 80: The method of any one of Implementation Schemes 1-79, wherein the bisulfite reaction and PCR reaction, or the desulfonate reaction and PCR reaction, or the bisulfite reaction, the desulfonate reaction and PCR reaction are all performed in the same reaction tube or chamber.

[0090] Implementation Scheme 81: The method of any one of Implementation Schemes 1-80, wherein contacting the biological sample containing nucleic acid with the first matrix material includes contacting the sample containing RNA with the first matrix material, wherein the matrix material binds the RNA, thereby purifying the RNA.

[0091] Implementation Scheme 82: The method of Implementation Scheme 81, wherein the method includes eluting the RNA from the matrix material, substantially independently of DNA.

[0092] Implementation Scheme 83: The method of Implementation Scheme 82, wherein RNA is eluted from the first matrix material using Tris buffer.

[0093] Implementation Scheme 84: The method of any one of claims 81-83, wherein the RNA is eluted and stored in a chamber.

[0094] Implementation Scheme 85: The method of any one of Implementation Schemes 81-84, wherein reverse transcription (RT) is performed on the RNA and qRT-PCR is performed to determine the level of the target RNA sequence.

[0095] Implementation Scheme 86: The method of any one of Implementation Schemes 82-85, wherein the RNA portion is used to elute bisulfite-converted nucleic acids from the second matrix material and mix with bisulfite-converted DNA, or to mix with eluted bisulfite-converted DNA.

[0096] Implementation Scheme 87: The method of Implementation Scheme 86, wherein the RNA is subjected to RT before or after binding with bisulfite-converted DNA.

[0097] Implementation Scheme 88: The method of any one of Implementation Schemes 86-87, wherein qRT-PCR is performed on the RT RNA in the mixture to determine the level of the target RNA sequence, and methylation-specific PCR is performed on the mixture to determine the methylation of the target DNA sequence.

[0098] Implementation Scheme 89: The method of any one of Implementation Schemes 1-88, wherein methylation of the promoter region of a gene selected from: MGMT. RASSF1A , ADAMTS1 , BNC1 , HIST1H3C , HOXB4 , RASGRF2 , TM6SF1 and AKR1B1 .

[0099] Implementation scheme 90: The method of any one of implementation schemes 81-89, wherein the RNA expression level of methyltransferase is determined.

[0100] Implementation Scheme 91: The method of Implementation Scheme 90, wherein the RNA expression level of methyltransferases selected from DNMT1, DNMT2, DNMT3A, DNMT3B and TNMT3L is determined.

[0101] Implementation Scheme 92: A cassette for determining the methylation state of nucleic acids, the cassette comprising: a column containing a first matrix material, a sample receiving chamber, a temperature-controlled channel or chamber, a plurality of chambers containing reagents and / or buffers, wherein at least one of the chambers contains a bisulfite reagent and at least one of the chambers contains a desulfonate / elution buffer, and wherein the cassette optionally includes a second column containing the second matrix material.

[0102] Implementation Scheme 93: The box of Implementation Scheme 92, wherein the box includes a chamber containing a reagent when in use, the reagent comprising guanidine thiocyanate ethanol (GTC-EtOH).

[0103] Implementation scheme 94: The box of any one of implementation schemes 92-93, wherein the second column is not present.

[0104] Implementation scheme 95: A box of any one of implementation schemes 92-93, wherein the second column is present.

[0105] Implementation Scheme 96: The box of any one of Implementation Schemes 92-95, wherein the temperature-controlled channel or chamber is a heat circulation channel or chamber.

[0106] Implementation Scheme 97: The box of any one of Implementation Schemes 92-96, wherein the box further includes a second heating channel or chamber.

[0107] Implementation Scheme 98: The kit of any one of Implementation Schemes 92-97, wherein the bisulfite reagent comprises a compound selected from ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0108] Implementation Scheme 99: The kit of Implementation Scheme 98, wherein the bisulfite reagent comprises ammonium bisulfite.

[0109] Implementation Scheme 100: A kit of any one of Implementation Schemes 92-99, wherein the bisulfite is provided in a reagent mixture comprising a scavenger and / or catalyst to prevent oxidation of the bisulfite.

[0110] Implementation Scheme 101: The kit of Implementation Scheme 100, wherein the bisulfite is provided in a reagent mixture comprising a scavenger selected from Trolox and hydroquinone.

[0111] Implementation Scheme 102: The sum of any one of Implementation Schemes 100-101, wherein the bisulfite is provided in a reagent mixture comprising a polyamine as a catalyst.

[0112] Implementation Scheme 103: A box of any one of Implementation Schemes 92-102, wherein when the first matrix material and / or the second matrix material are present, the first matrix material and / or the second matrix material comprises a material selected from glass or silica, ion exchange resin and hydroxyapatite.

[0113] Implementation Scheme 104: A kit of any one of Implementation Schemes 92-103, wherein the kit comprises one or more chambers containing one or more reagents selected from methylation-specific PCR primers, methylation-specific PCR probes, PCR enzymes, and PCR reaction buffers.

[0114] Implementation Scheme 105: The kit of Implementation Scheme 104, wherein the kit comprises at least two chambers, the chambers comprising one or more reagents selected from methylation-specific PCR primers, methylation-specific PCR probes, PCR enzymes and PCR reaction buffers.

[0115] Implementation Scheme 106: A box according to any one of Implementation Schemes 92-105, wherein the box comprises at least one chamber containing primers and probes for detecting methylation of the forward strand of transformed DNA.

[0116] Implementation Scheme 107: A box according to any one of Implementation Schemes 92-106, wherein the box comprises at least one chamber containing primers and probes for detecting methylation of the reverse strand of transformed DNA.

[0117] Implementation Scheme 108: A kit of any one of Implementation Schemes 104-107, wherein the PCR primers and / or probes and / or enzymes are provided as beads.

[0118] Implementation Scheme 109: A box of any one of Implementation Schemes 92-108, wherein the sample receiving chamber, the column, the plurality of chambers, and the temperature-controlled heating channel or chamber are selectively in fluid communication.

[0119] Implementation Scheme 110: The box of Implementation Scheme 109, wherein the sample receiving chamber, the column, the plurality of chambers, and the temperature-controlled channel or chamber are selectively in fluid communication via microfluidic channels and valves.

[0120] Implementation Scheme 111: The box of Implementation Scheme 109, wherein the sample receiving chamber, the column, the plurality of chambers, and the temperature-controlled channel or chamber or the port of entry into the temperature-controlled channel or chamber are arranged around a central valve and selectively in fluid communication with a channel in the central valve, wherein the central valve is configured to accommodate a plunger capable of introducing or drawing fluid into or out of the chamber in fluid communication with the central valve.

[0121] Implementation Scheme 112: A box according to any one of Implementation Schemes 92-111, wherein the box is configured such that, in use, the box includes: The first chamber containing the sample; The second chamber contains a guanidine thiocyanate-ethanol (GTC-EtOH) solution; The third chamber contains the bisulfite reagent; The fourth compartment contains the buffer solution; The fifth chamber contains the rinsing solution; and The sixth chamber contains the elution / desulfonate grouping reagent.

[0122] Implementation Scheme 113: The kit of Implementation Scheme 112, wherein the first chamber contains the sample in the GTC-EtOH-Tween extraction / precipitation reagent.

[0123] Implementation Scheme 114: A box according to any one of Implementation Schemes 92-113, wherein the box is configured for use with a bisulfite reagent to be added to the box when or near the time when the sample is placed in the box.

[0124] Implementation Scheme 115: A kit of any one of Implementation Schemes 92-113, wherein a bisulfite reagent is provided as a component of the kit.

[0125] Implementation Scheme 116: A box according to any one of Implementation Schemes 92-115, wherein the box is configured for adding GTC-ETOH-Tween buffer when or near the time when the sample is placed in the box.

[0126] Implementation Scheme 117: A kit of any one of Implementation Schemes 92-115, wherein GTC-ETOH-Tween buffer is provided as a component of the kit.

[0127] Implementation Scheme 118: A box according to any one of Implementation Schemes 92-117, wherein the box includes a seventh chamber containing PCR primers and / or probes and / or PCR enzymes.

[0128] Implementation Scheme 119: A box of any one of Implementation Schemes 92-118, wherein the box includes an eighth chamber that also contains PCR primers and / or probes and / or PCR enzymes.

[0129] Implementation Scheme 120: A box of any one of Implementation Schemes 92-119, wherein the box comprises one or more chambers containing primers specifically targeting methylated and / or unmethylated sequences of bisulfite conversion.

[0130] Implementation scheme 121: A kit of any one of implementation schemes 92-120, wherein the kit comprises one or more chambers containing TaqMan PCR reaction reagents.

[0131] Implementation Scheme 122: A box according to any one of Implementation Schemes 92-121, wherein the box comprises one or more chambers containing one or more fluorescent probes for amplified methylated sequence markers and / or one or more fluorescent probes for amplified unmethylated sequence markers.

[0132] Implementation Scheme 123: The kit of Implementation Scheme 122, wherein the probe comprises a fluorescent reporter dye and a quencher dye, wherein the probe provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase.

[0133] Implementation scheme 124: A box of any one of implementation schemes 122-123, wherein the box includes a plurality of probes, each probe specifically targeting a different methylation region in the target amplification region.

[0134] Implementation scheme 125: A box of any one of implementation schemes 122-123, wherein the box includes a single probe specifically targeting a methylated region in a target amplification region.

[0135] Implementation scheme 126: A box of any one of implementation schemes 122-123, wherein the box includes a plurality of probes, each probe specifically targeting the same methylated region in the target amplification region.

[0136] Implementation Scheme 127: A cassette of any one of Implementation Schemes 92-126, wherein the cassette contains primers and / or probes to determine methylation of promoter regions selected from the following genes: MGMT , RASSF1A , ADAMTS1 , BNC1 , HIST1H3C , HOXB4 , RASGRF2 , TM6SF1 and AKR1B1 .

[0137] Implementation scheme 128: A box of any one of implementation schemes 92-126, wherein the box contains one or more primers shown in Table 5, 9 or 10 and / or one or more probes shown in Table 5, 9 or 10.

[0138] Implementation Scheme 129: The kit of Implementation Scheme 128, wherein the kit contains the following for determining using nested PCR reaction. MGMT Methylation probes and primers: The outer forward primer (248b) contains the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263); The outer reverse primer (249b) contains the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265); The inner forward primer (250) contains the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266). The inner reverse primer (251) contains the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and The probe (252a) contains the nucleotide sequence: fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268).

[0139] Implementation Scheme 130: A kit according to any one of Implementation Schemes 128-129, wherein the kit contains the following probes and primers for determining ACTB methylation (e.g., as a control) using a nested PCR reaction: The outer forward primer (102) contains the nucleotide sequence: GTGTGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103); The outer reverse primer (10) contains the nucleotide sequence: CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104). The inner forward primer (148) contains the nucleotide sequence: GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149). The inner reverse primer (149) contains the nucleotide sequence: CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and The probe (178) contains the nucleotide sequence: fluorophore -CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO:179).

[0140] Implementation Scheme 131: A box according to any one of Implementation Schemes 92-130, wherein the box is configured for determining the RNA expression level of methyltransferase.

[0141] Implementation Scheme 132: The kit of Implementation Scheme 131, wherein the methyltransferase is selected from DNMT1, DNMT2, DNMT3A, DNMT3B and TNMT3L.

[0142] Implementation Scheme 133: A system for determining the methylation of nucleic acids in biological samples, the system comprising: an enclosure configured to include one or more sample processing modules, each sample processing module being configured to receive a removable cartridge of any one of Implementation Schemes 92-132; wherein the system is configured to operate the sample processing modules to process samples to determine the methylation of one or more target nucleic acids and optionally to determine the level of one or more target DNA sequences within a corresponding removable sample cartridge, wherein the processing of the sample within the corresponding removable sample cartridge is performed according to the method of any one of Implementation Schemes 1-91.

[0143] Implementation scheme 134: The system of implementation scheme 133, wherein the system is configured to include a sample processing module.

[0144] Implementation Scheme 135: The system of Implementation Scheme 133, wherein the system is configured to include at least two sample processing modules, or at least four sample processing modules, or at least eight sample processing modules, or at least 12 sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules.

[0145] Implementation Scheme 136: A system of any one of Implementation Schemes 133-135, wherein the module includes one or more heating plates to heat a temperature-controlled chamber or channel within the box.

[0146] Implementation Scheme 137: A system of any one of Implementation Schemes 133-136, wherein the module includes a fan configured to cool a temperature-controlled passage or chamber within the box.

[0147] Implementation Scheme 138: A system of any one of Implementation Schemes 133-137, wherein the module includes circuitry to transmit information (e.g., optical information) to a computer for analysis.

[0148] Implementation Scheme 139: A system of any one of Implementation Schemes 133-138, wherein the module includes an optical block to provide excitation and / or detection of optical signals generated by one or more reactions in the box.

[0149] Implementation scheme 140: A system of any one of implementation schemes 133-139, wherein the system is configured to operate the box to perform the method of any one of implementation schemes 1-91.

[0150] Implementation Scheme 141: A system of any one of Implementation Schemes 133-139, wherein the system is configured to operate the cartridge to: bind a sample to a column; elute DNA from the column and bind the DNA with a transformation reagent; heat the DNA / transformation reagent solution in a reaction chamber or tube to produce transformed DNA; bind the transformed DNA to the column; desulfonate the DNA from the column and elute the DNA; and perform PCR on the eluted desulfonated DNA in a reaction chamber or tube.

[0151] Implementation Scheme 142: The system of Implementation Scheme 141, wherein the PCR is performed in the same reaction chamber or tube, in which the DNA / conversion reagent solution is preheated.

[0152] Implementation Scheme 143: A cartridge for sample preparation, the cartridge comprising: a conduit or chamber containing an affinity matrix for binding DNA; a plurality of chambers arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chambers in fluid communication with the central valve, wherein the plurality of chambers includes: a chamber configured to receive up to about 5 mL or up to about 4 mL of sample solution; a chamber containing PEG; a chamber containing GTC-EtOH; a chamber containing an alkaline solution; and a chamber containing a buffer solution.

[0153] Implementation scheme 144: The box of implementation scheme 143, wherein the plurality of chambers further includes a chamber containing a bisulfite reagent.

[0154] Implementation Scheme 145: A box of any one of Implementation Schemes 143-144, wherein the plurality of chambers includes a chamber containing a GTC-ethanol washing solution.

[0155] Implementation Scheme 146: The kit of Implementation Scheme 145, wherein the GTC-ethanol washing solution comprises 1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0 and 50% ethanol.

[0156] Implementation Scheme 147: A box of any one of Implementation Schemes 143-146, wherein the PEG includes PEG200.

[0157] Implementation Scheme 148: The box of any one of Implementation Schemes 143-147, wherein the alkaline solution comprises KOH.

[0158] Implementation scheme 149: A box of any one of implementation schemes 143-148, wherein the buffer solution comprises Tris.

[0159] Implementation scheme 150: A box of any one of implementation schemes 143-149, wherein the plurality of chambers includes a chamber containing beads, the beads containing one or more PCR primers and / or probes.

[0160] Implementation scheme 151: A box of any one of implementation schemes 143-150, wherein the PEG-containing chamber contains about 1 mL of PEG.

[0161] Implementation Scheme 152: A box of any one of Implementation Schemes 143-151, wherein the chamber containing the alkaline solution contains about 500 µL of solution.

[0162] Implementation Scheme 153: A box of any one of Implementation Schemes 143-152, wherein the chamber containing GTC-EtOH contains about 2 mL of GTC-EtOH.

[0163] Implementation scheme 154: A box of any one of implementation schemes 143-153, wherein the buffer chamber contains about 2 mL of buffer.

[0164] Implementation Scheme 155: High-Volume Sample Preparation (HVSP), the cartridge comprising: channels or chambers containing an affinity matrix for binding DNA; a plurality of chambers arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chambers in fluid communication with the central valve, wherein the plurality of chambers comprises: at least two distinct chambers, each configured to receive up to 4.5 mL of sample solution; a chamber containing PEG; a chamber containing an alkaline solution; and a chamber containing a buffer solution.

[0165] Implementation Scheme 156: The box of Implementation Scheme 155, wherein the plurality of chambers includes at least three different chambers, each configured to receive up to 4 mL of sample solution.

[0166] Implementation Scheme 157: A box of any one of Implementation Schemes 155-156, wherein the PEG includes PEG200.

[0167] Implementation Scheme 158: The box of any one of Implementation Schemes 155-157, wherein the alkaline solution comprises KOH.

[0168] Implementation scheme 159: A box of any one of implementation schemes 155-158, wherein the buffer solution comprises Tris.

[0169] Implementation Scheme 160: The box of any one of Implementation Schemes 155-159, wherein the plurality of chambers includes a chamber containing a washing solution.

[0170] Implementation Scheme 161: The chamber of Implementation Scheme 160, wherein the washing solution comprises 1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0 and 50% ethanol.

[0171] Implementation scheme 162: A box of any one of implementation schemes 155-161, wherein the box includes a chamber configured to remove the treated sample.

[0172] Implementation Scheme 163: A kit of any one of Implementation Schemes 155-162, wherein the sample chamber contains a sample solution, GTC and isopropanol when in use.

[0173] Implementation Scheme 164: The kit of Implementation Scheme 163, wherein the sample chamber contains substantially equal volumes of sample solution, GTC and isopropanol when in use.

[0174] Implementation Scheme 165: A kit of any one of Implementation Schemes 155-164, wherein the kit contains 4 mL of sample solution when in use, the sample solution being disposed in each of the chambers configured to receive the sample.

[0175] Implementation Scheme 166: A kit of any one of Implementation Schemes 155-165, wherein the kit provides DNA or RNA recovery that is substantially linear with respect to a sample volume of 0.5 mL to about 4 mL.

[0176] Implementation Scheme 167: A box of any one of Implementation Schemes 155-166, wherein the box contains or is configured to receive a conversion reagent.

[0177] Implementation scheme 168: The box of implementation scheme 167, wherein the box is used to perform DNA sulfite conversion.

[0178] Implementation Scheme 169: A lysis solution for preparing DNA samples from serum or plasma, said lysis solution comprising: GTC, buffer, detergent and optional defoamer.

[0179] Implementation Scheme 170: The lysis solution of Implementation Scheme 169, wherein the lysis solution for serum or plasma comprises GTC, Tris pH 7.0, Tween 20 and defoamer SE15.

[0180] Implementation Scheme 171: The lysis solution of Implementation Scheme 170, wherein the lysis solution for serum or plasma comprises about 4.5 M GTC, about 45 mM Tris pH 7.0, about 1% Tween20 and about 0.01% defoamer SE15.

[0181] Implementation scheme 172: a lysis solution for preparing DNA samples from FFPE samples.

[0182] Implementation Scheme 173: The lysis solution of Implementation Scheme 172, wherein the lysis solution for FFPE samples comprises buffer, detergent, NaCl, MgCl2, chelating agent, defoamer SE15 and sodium azide.

[0183] Implementation Scheme 174: The lysis solution of Implementation Scheme 173, wherein the lysis solution for the FFPE sample comprises about 1% Tween 20, about 400 mM NaCl, about 25 mM EDTA, about 10 mM MgCl2, about 50 mM HEPES pH 7.2, about 0.01% defoamer SE15 and about 0.01% sodium azide.

[0184] Implementation Scheme 175: A kit for determining DNA methylation, the kit comprising: a container containing a cassette for determining nucleic acid methylation status according to any one of Implementation Schemes 92-136.

[0185] Implementation scheme 176: The kit of implementation scheme 175, wherein the kit further includes a container containing a lysis solution.

[0186] Implementation Scheme 177: The kit of Implementation Scheme 176, wherein the lysis solution is a lysis solution for serum or plasma of any one of Implementation Schemes 169-171.

[0187] Implementation Scheme 178: The kit of Implementation Scheme 176, wherein the lysis solution is the lysis solution for FFPE samples of any one of Implementation Schemes 172-174.

[0188] Implementation Scheme 179: A kit according to any one of Implementation Schemes 175-178, wherein the kit includes a container containing proteinase K.

[0189] Implementation Scheme 180: A kit according to any one of Implementation Schemes 175-179, wherein the kit comprises a conversion reagent in the kit or in a separate container from the kit.

[0190] Implementation Scheme 181: The kit of Implementation Scheme 180, wherein the kit includes the conversion reagent in a separate container from the kit.

[0191] Implementation Scheme 182: The kit of Implementation Scheme 180, wherein the kit includes the conversion reagent provided in the chamber of the kit.

[0192] Implementation Scheme 183: A kit according to any one of Implementation Schemes 180-182, wherein the conversion reagent comprises a compound selected from sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and DABSO.

[0193] Implementation scheme 184: The kit of implementation scheme 183, wherein the conversion reagent comprises ammonium bisulfite.

[0194] Implementation Scheme 185: A kit according to any one of Implementation Schemes 175-184, wherein the kit includes a container containing sample processing reagents.

[0195] Implementation scheme 186: The kit of implementation scheme 185, wherein the sample processing reagent comprises guanidine thiocyanate.

[0196] Implementation scheme 187: A kit according to any one of implementation schemes 185-186, wherein the sample processing reagent includes ethanol.

[0197] Implementation Scheme 188: A kit according to any one of Implementation Schemes 175-187, wherein the kit includes a container containing a cassette for sample preparation according to any one of Implementation Schemes 155-166.

[0198] Implementation scheme 189: A kit according to any one of implementation schemes 175-188, wherein the kit contains instructional material teaching how to use the kit to determine DNA methylation.

[0199] Implementation Scheme 190: A cassette for detecting methylation markers of cancer, the cassette comprising: a plurality of chambers and a thermal circulation channel or chamber, wherein the plurality of chambers and ports into the thermal circulation channel or chamber are arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chambers or ports in fluid communication with the central valve, wherein the plurality of chambers include: a sample receiving chamber; a chamber containing or configured to receive a bisulfite reagent; a chamber containing a washing solution; a chamber containing a Tris buffer; a chamber containing an alkaline solution comprising KOH; a chamber containing beads providing a PCR master mixture; and a chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters, the methylation state of the gene promoters being a marker of cancer.

[0200] Implementation Scheme 191: The box of Implementation Scheme 190, wherein the plurality of chambers includes a chamber configured to receive waste liquid.

[0201] Implementation Scheme 192: The kit of any one of Implementation Schemes 190-191, wherein the bisulfite reagent comprises a compound selected from sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and DABSO.

[0202] Implementation Scheme 193: The kit of Implementation Scheme 192, wherein the bisulfite reagent comprises ammonium bisulfite.

[0203] Implementation Scheme 194: A kit of any one of Implementation Schemes 190-193, wherein the washing solution comprises 1.25 M M TC, 25 mM Tris pH 7.0 and 50% ethanol.

[0204] Implementation Scheme 195: A box of any one of Implementation Schemes 190-194, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, the methylation status of which is a marker selected from the following cancers: breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

[0205] Implementation Scheme 196: The box of Implementation Scheme 195, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains such beads that they provide PCR primers and probes for nested PCR reactions.

[0206] Implementation Scheme 197: The kit of Implementation Scheme 196, wherein the nested PCR includes a first PCR reaction specifically targeting the transformed DNA and a second PCR reaction specifically targeting methylated CpG.

[0207] Implementation Scheme 198: A box of any one of Implementation Schemes 190-197, wherein the chamber containing beads providing PCR primers and probes comprises beads that provide PCR primers and probes for detecting methylation of the forward strand of transformed DNA.

[0208] Implementation Scheme 199: A box of any one of Implementation Schemes 190-198, wherein the chamber containing beads providing PCR primers and probes comprises beads that provide PCR primers and probes for detecting methylation of the reverse strand of transformed DNA.

[0209] Implementation Scheme 200: A box according to any one of Implementation Schemes 190-199, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, said genes being selected from RASSF1A , AKR1B1 , HOXB4 , HIST1H3C , RASGRF2 , TM6SF1 , BRCA1 , BNC1 , ADAMTS1 , CDO1 , SOX17 , TAC1 , HOXA7 and MGMT .

[0210] Implementation Scheme 201: A box of any one of Implementation Schemes 190-200, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, the methylation state of said gene promoters being a marker of pancreatic cancer.

[0211] Implementation Scheme 202: The box of Implementation Scheme 201, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains such beads that they provide PCR primers and probes for detecting... ADAMTS1 and / or BNC1 Methylation of the promoter.

[0212] Implementation Scheme 203: The box of Implementation Scheme 202, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains such beads that they provide PCR primers and probes for detecting... ADAMTS1 Methylation of the promoter.

[0213] Implementation Scheme 204: A box according to any one of Implementation Schemes 202-203, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... BNC1 Methylation of the promoter.

[0214] Implementation Scheme 205: The box of Implementation Scheme 202, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains such beads as those provided in Table 5 or 10 for... ADAMTS1 and / or BNC1 One or more PCR primers and / or probes.

[0215] Implementation Scheme 206: A box of any one of Implementation Schemes 190-200, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, the methylation state of said gene promoters being a marker of breast cancer.

[0216] Implementation Scheme 207: The box of Implementation Scheme 206, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of promoters selected from one, two, three, four, five, or all of the following genes: BRCA1 , RASSF1A , AKR1B1 , HOXB4 , HIST1H3C , RASGRF2 and TM6SF1 .

[0217] Implementation Scheme 208: The box of Implementation Scheme 207, comprising a chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, wherein the chamber contains such beads that provide PCR primers and probes for detecting... BRCA1 Methylation of the promoter.

[0218] Implementation Scheme 209: A box according to any one of Implementation Schemes 207-208, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... RASSF1A Methylation of the promoter.

[0219] Implementation Scheme 210: A box according to any one of Implementation Schemes 207-209, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... AKR1B1 Methylation of the promoter.

[0220] Implementation Scheme 211: A box according to any one of Implementation Schemes 207-210, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... HOXB4 Methylation of the promoter.

[0221] Implementation Scheme 212: A box according to any one of Implementation Schemes 207-211, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... HIST1H3C Methylation of the promoter.

[0222] Implementation Scheme 213: A box according to any one of Implementation Schemes 207-212, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... RASGRF2 Methylation of the promoter.

[0223] Implementation Scheme 214: A box according to any one of Implementation Schemes 207-213, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... TM6SF1 Methylation of the promoter.

[0224] Implementation Scheme 215: A box of any of Implementation Schemes 207-214, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide one or more PCR primers and / or one or more PCR probes as shown in Table 5 or 9.

[0225] Implementation Scheme 216: The box of Implementation Scheme 206, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains such beads that they provide PCR primers and probes for detecting... BRCA1 Methylation of the promoter.

[0226] Implementation Scheme 217: A box of any one of Implementation Schemes 190-200, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, the methylation state of said gene promoters being a marker of lung cancer.

[0227] Implementation Scheme 218: The box of Implementation Scheme 217, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters. CDO1 , SOX17 , TAC1 and HOXA7 Methylation of the promoters of one, two, three, or all genes.

[0228] Implementation Scheme 219: The box of Implementation Scheme 218, comprising a chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, wherein the chamber contains such beads that provide PCR primers and probes for detecting... CDO1 Methylation of the promoter.

[0229] Implementation Scheme 220: A box according to any one of Implementation Schemes 218-219, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... SOX17 Methylation of the promoter.

[0230] Implementation Scheme 221: A box according to any one of Implementation Schemes 218-220, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... TAC1 Methylation of the promoter.

[0231] Implementation Scheme 222: A box according to any one of Implementation Schemes 218-221, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... HOXA7 Methylation of the promoter.

[0232] Implementation Scheme 223: A box of any one of Implementation Schemes 190-200, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, the methylation state of said gene promoters being a marker of brain cancer.

[0233] Implementation Scheme 224: The box of any of Implementation Scheme 223, wherein the chamber containing beads providing PCR primers and probes for detecting methylation of one or more gene promoters contains beads that provide PCR primers and probes for detecting... MGMT Methylation of the promoter.

[0234] Implementation Scheme 225: The box of Implementation Scheme 224, wherein the chamber containing beads that provide PCR primers and probes for detecting methylation of one or more gene promoters contains such beads that they provide one or more PCR primers and / or probes for MGMT as shown in Table 5 or 10.

[0235] Implementation Scheme 226: The kit of Implementation Scheme 225, wherein the kit contains the following probes and primers for determining using nested PCR reaction. MGMT Methylation: The outer forward primer (248b) contains the nucleotide sequence: GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263); The outer reverse primer (249b) contains the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265); The inner forward primer (250) contains the nucleotide sequence: TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266). The inner reverse primer (251) contains the nucleotide sequence: GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and The probe (252a) contains the nucleotide sequence: fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268).

[0236] Implementation Scheme 227: A kit according to any one of Implementation Schemes 225-226, wherein the kit contains the following probes and primers for determining the methylation of ACTB (e.g., as a control) using a nested PCR reaction: The outer forward primer (102) contains the nucleotide sequence: GTGTGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103); The outer reverse primer (103) contains the nucleotide sequence: CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104). The inner forward primer (148) contains the nucleotide sequence: GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149). The inner reverse primer (149) contains the nucleotide sequence: CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and The probe (178) contains the nucleotide sequence: fluorophore -CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO:179).

[0237] Implementation Scheme 228: A method for preparing cfDNA samples from serum or plasma, the method comprising: A proteinase K-treated serum or plasma sample is combined with a lysis solution and an alcohol according to any of embodiments 169-171 to form a sample solution; The sample solution is added to the sample receiving chamber of the box in any one of embodiments 143-154, or to the sample receiving chamber of the box in any one of embodiments 155-168; and The cassette is operated to bind DNA from the sample to the affinity matrix, and then the DNA is washed and released from the matrix.

[0238] Implementation Scheme 229: The method of Implementation Scheme 228, wherein the serum or plasma sample treated with proteinase K comprises the sample, lysis solution and alcohol in proportions corresponding to the following: about 1.3 mL of proteinase K treated serum or plasma, 2.2 mL of lysis solution and about 1.5 mL of alcohol.

[0239] Implementation Scheme 230: The method of any one of Implementation Schemes 228-229, wherein the alcohol includes isopropanol.

[0240] Implementation scheme 231: The method of any one of implementation schemes 228-230, wherein the sample comprises serum.

[0241] Implementation scheme 232: The method of any one of implementation schemes 228-231, wherein the sample comprises plasma.

[0242] Implementation scheme 233: The method of any one of implementation schemes 228-232, wherein the sample comprises serum.

[0243] Implementation scheme 234: The method of any one of implementation schemes 228-233, wherein operating the box includes introducing the box into a sample processing module in any one of implementation schemes 133-139.

[0244] Implementation Scheme 235: The method of any one of Implementation Schemes 228-234, wherein the method further comprises operating the cassette to convert the DNA for methylation detection.

[0245] Implementation Scheme 236: The method of any one of Implementation Schemes 228-235, wherein the method further comprises operating the cassette to perform one or more PCR reactions using the DNA or transformed DNA as a template.

[0246] Implementation Scheme 237: The method of any one of Implementation Schemes 228-234, wherein the sample addition includes loading the sample solution into one or more sample receiving chambers in a cassette of any one of Implementation Schemes 155-165.

[0247] Implementation Scheme 238: The method of Implementation Scheme 237, wherein the method further includes transferring the released DNA to a second box for methylation detection and / or PCR.

[0248] Implementation Scheme 239: The method of Implementation Scheme 238, wherein the second box is the box of any one of Implementation Schemes 92-132.

[0249] Implementation Scheme 240: The method of any one of Implementation Schemes 238-239, wherein the method further comprises operating the second box to convert the DNA for methylation detection.

[0250] Implementation Scheme 241: The method of any one of Implementation Schemes 238-240, wherein the method further comprises operating the second box to perform one or more PCR reactions using the DNA or transformed DNA as a template.

[0251] Implementation Scheme 242: The method of any one of Implementation Schemes 238-241, wherein operating the second box includes introducing the second box into a sample processing module in any one of Implementation Schemes 133-139.

[0252] Implementation Scheme 243: A method for preparing DNA from an FFPE sample, the method comprising: The formalin-fixed paraffin-embedded sample is combined with the lysis solution of any one of embodiments 172-174; Heating the lysis solution containing the sample; adding alcohol to the sample to form a sample solution; adding the sample solution to the sample receiving chamber of the box in any one of embodiments 143-154, or to the sample receiving chamber of the box in any one of embodiments 155-168; and The cassette is operated to bind DNA in the sample to an affinity matrix, and then the DNA is washed from the matrix and released.

[0253] Implementation Scheme 244: The method of Implementation Scheme 243, wherein the heating comprises adding proteinase K to the sample and heating the sample.

[0254] Implementation Scheme 245: The method of Implementation Scheme 244, wherein the heating comprises adding about 50 µL of proteinase K to about 1.2 mL of FFPE lysis solution containing the FFPE sample.

[0255] Implementation Scheme 246: The method of any one of Implementation Schemes 243-245, wherein the heating comprises heating the pyrolysis solution to a temperature of about 50°C to about 60°C.

[0256] Implementation Scheme 247: The method of Implementation Scheme 246, wherein the heating includes heating the pyrolysis solution to a temperature of about 56°C.

[0257] Implementation scheme 248: The method of any one of implementation schemes 243-247, wherein the heating lasts for a maximum of about 4 hours, or a maximum of about 5 hours, or a maximum of about 6 hours.

[0258] Implementation Scheme 249: The method of Implementation Scheme 248, wherein the heating lasts for approximately 4 hours.

[0259] Implementation Scheme 250: The method of any one of Implementation Schemes 243-249, wherein the alcohol includes ethanol.

[0260] Implementation Scheme 251: The method of any one of Implementation Schemes 243-250, wherein the method comprises adding alcohol to the pyrolysis solution at a volume ratio of about 1:1 pyrolysis solution: alcohol.

[0261] Implementation Scheme 252: The method of any one of Implementation Schemes 243-251, wherein operating the box includes introducing the box into a sample processing module in any one of Implementation Schemes 133-139.

[0262] Implementation Scheme 253: The method of any one of Implementation Schemes 243-252, wherein the method further comprises operating the cassette to convert the DNA for methylation detection.

[0263] Implementation Scheme 254: The method of any one of Implementation Schemes 243-253, wherein the method further comprises operating the cassette to perform one or more PCR reactions using the DNA or transformed DNA as a template.

[0264] Implementation Scheme 255: The method of any one of Implementation Schemes 243-251, wherein the sample addition comprises adding the sample solution to one or more sample receiving chambers in a box of any one of Implementation Schemes 155-165.

[0265] Implementation Scheme 256: The method of Implementation Scheme 255, wherein the method further includes transferring the released DNA to a second box for methylation detection and / or PCR.

[0266] Implementation Scheme 257: The method of Implementation Scheme 256, wherein the second box is the box of any one of Implementation Schemes 92-132.

[0267] Implementation Scheme 258: The method of any one of Implementation Schemes 256-257, wherein the method further comprises operating the second box to convert the DNA for methylation detection.

[0268] Implementation Scheme 259: The method of any one of Implementation Schemes 256-258, wherein the method further comprises operating the second box to perform one or more PCR reactions using the DNA or transformed DNA as a template.

[0269] Implementation Scheme 260: The method of any one of Implementation Schemes 256-259, wherein operating the second box includes introducing the second box into a sample processing module in the system of any one of Implementation Schemes 133-139.

[0270] Implementation Scheme 261: A method for detecting cancer and / or stage of cancer and / or detecting cancer susceptibility in subjects, said method comprising: Provide a biological sample from the subject, wherein the biological sample contains DNA; The methylation of one or more gene promoters in the DNA is detected using a kit of any of embodiments 190-225, wherein the methylation status of the gene promoters is a cancer marker, and wherein an increase in the methylation of the one or more gene promoters indicates the presence of cancer or cancer susceptibility or a stage of cancer or precancerous disease.

[0271] Implementation scheme 262: The method of implementation scheme 261, wherein the subject is a human.

[0272] Implementation Scheme 263: The method of any one of Implementation Schemes 261-262, wherein the cancer is selected from the following cancers: breast cancer, pancreatic cancer, prostate cancer, brain cancer, lung cancer, B-cell lymphoma, bronchial cancer, colorectal cancer, gastric cancer, ovarian cancer, bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, melanoma, uterine or endometrial cancer, oral or pharyngeal cancer, liver cancer, kidney cancer, biliary tract cancer, small intestine or appendix cancer, salivary gland cancer, thyroid cancer, adrenal cancer, osteosarcoma, chondrosarcoma, liposarcoma, testicular cancer, and malignant fibrous histiocytoma.

[0273] Implementation Scheme 264: The method of any one of Implementation Schemes 261-262, wherein the cancer is selected from breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

[0274] Implementation Scheme 265: The method of any one of Implementation Schemes 261-264, wherein the sample comprises a sample from serum or plasma.

[0275] Implementation scheme 266: The method of any one of implementation schemes 261-264, wherein the sample includes an FFPE sample.

[0276] Implementation Scheme 267: The method of any one of Implementation Schemes 261-266, wherein the one or more gene promoters comprise one or more selected from RASSF1A , AKR1B1 , HOXB4 , HIST1H3C , RASGRF2 , TM6SF1 , BRCA1 , BNC1 , ADAMTS1 , CDO1 , SOX17 , TAC1 , HOXA7 and MGMT The promoter.

[0277] Implementation Scheme 268: The method of any one of Implementation Schemes 261-266, wherein the cancer is pancreatic cancer and the one or more gene promoters comprise selected from... ADAMTS1 and BNC1 Promoters of one, two, three or four genes.

[0278] Implementation Scheme 269: The method of Implementation Scheme 268, wherein the one or more gene promoters include ADAMTS1 The promoter.

[0279] Implementation Scheme 270: The method of any one of Implementation Schemes 268-269, wherein the one or more gene promoters include BNC1 The promoter.

[0280] Implementation Scheme 271: The method of any one of Implementation Schemes 261-266, wherein the cancer is breast cancer and the one or more gene promoters comprise selected from... BRCA1 , RASSF1A , AKR1B1 , HOXB4 , HIST1H3C , RASGRF2 and TM6SF1 Promoters of one, two, three, four, five or all genes.

[0281] Implementation Scheme 272: The method of Implementation Scheme 271, wherein the one or more gene promoters include BRCA1 The promoter.

[0282] Implementation Scheme 273: The method of any one of Implementation Schemes 271-272, wherein the one or more gene promoters include RASSF1A The promoter.

[0283] Implementation Scheme 274: The method of any one of Implementation Schemes 271-273, wherein the one or more gene promoters include AKR1B1 The promoter.

[0284] Implementation Scheme 275: The method of any one of Implementation Schemes 271-274, wherein the one or more gene promoters include HOXB4 The promoter.

[0285] Implementation Scheme 276: The method of any one of Implementation Schemes 271-275, wherein the one or more gene promoters include HIST1H3C The promoter.

[0286] Implementation Scheme 277: The method of any one of Implementation Schemes 271-276, wherein the one or more gene promoters include RASGRF2 The promoter.

[0287] Implementation Scheme 278: The method of any one of Implementation Schemes 271-277, wherein the one or more gene promoters include TM6SF1 The promoter.

[0288] Implementation Scheme 279: The method of any one of Implementation Schemes 261-266, wherein the one or more gene promoters include BRCA1 The promoter.

[0289] Implementation Scheme 280: The method of any one of Implementation Schemes 261-266, wherein the cancer is lung cancer and the one or more gene promoters comprise a subset of... CDO1 , SOX17 , TAC1 and HOXA7 Promoters of one, two, three or all genes.

[0290] Implementation Scheme 281: The method of Implementation Scheme 280, wherein the one or more gene promoters include CDO1 The promoter.

[0291] Implementation Scheme 282: The method of any one of Implementation Schemes 280-281, wherein the one or more gene promoters include SOX17 The promoter.

[0292] Implementation Scheme 283: The method of any one of Implementation Schemes 280-282, wherein the one or more gene promoters include TAC1 The promoter.

[0293] Implementation Scheme 284: The method of any one of Implementation Schemes 280-283, wherein the one or more gene promoters include HOXA7 The promoter.

[0294] Implementation Scheme 285: The method of any one of Implementation Schemes 261-266, wherein the cancer is a brain cancer and the one or more promoters include MGMT The promoter.

[0295] Implementation Scheme 286: A method for converting cytosine residues in DNA to uracil while leaving 5-methylcytosine residues substantially unaffected, the method comprising: The sample containing DNA is contacted with DABSO to transform the DNA; The transformed DNA is desulfonated to produce DNA, in which cytosine residues are converted to uracil, but 5-methylcytosine residues are essentially unaffected.

[0296] Implementation Scheme 287: The method of Implementation Scheme 286, wherein the contact comprises contacting the DNA with DABSO at a concentration ranging from 2 M to up to about 5 M.

[0297] Implementation Scheme 288: The method of Implementation Scheme 286, wherein the contact comprises contacting the DNA with DABSO at a concentration of about 2.5 M.

[0298] Implementation Scheme 289: The method of any one of Implementation Schemes 286-288, wherein the DABSO is dissolved in an alkaline aqueous solution.

[0299] Implementation Scheme 290: The method of Implementation Scheme 289, wherein the DABSO is dissolved in a solution containing KOH.

[0300] Implementation Scheme 291: The method of any one of Implementation Schemes 286-290, wherein the contact comprises heating the DABSO / DNA solution to a temperature range from about 55°C to about 90°C.

[0301] Implementation scheme 292: The method of any one of implementation schemes 286-291, wherein the DABSO is reacted with DNA for a period of about 15 minutes to a maximum of about 90 minutes.

[0302] Implementation Scheme 293: The method of any one of Implementation Schemes 286-292, wherein the desulfonation comprises contacting the transformed DNA with an alkaline reagent.

[0303] Implementation Scheme 294: The method of Implementation Scheme 293, wherein the alkaline reagent comprises KOH.

[0304] Implementation Scheme 295: The method of any one of Implementation Schemes 286-294, wherein the transformation and / or desulfonation is performed on DNA bound to the column.

[0305] Implementation Scheme 296: The method of any one of Implementation Schemes 286-294, wherein the transformation and / or desulfonation is performed on DNA in solution.

[0306] Implementation Scheme 297: A method for analyzing DNA methylation, the method comprising: Provide DNA samples; Transform the DNA in the sample according to the method of any one of embodiments 286-296; and The transformed nucleic acids were subjected to methylation-specific PCR and / or nucleic acid sequencing and / or high-resolution melting analysis (HRM) to determine the methylation of the nucleic acids.

[0307] Implementation Scheme 298: The method of Implementation Scheme 297, wherein providing the DNA sample comprises preparing the sample according to any one of Implementation Schemes 228-234 or according to any one of Implementation Schemes 243-252.

[0308] Implementation Scheme 299: A kit for detecting DNA methylation status, the kit comprising: A container containing a conversion reagent, said conversion reagent including DABSO; and A container containing a desulfonate reagent.

[0309] Implementation scheme 300: The kit of implementation scheme 299, wherein the kit includes a column containing an affinity matrix.

[0310] Implementation scheme 301: A kit according to any one of implementation schemes 299-300, wherein the kit includes a container containing a binding buffer.

[0311] Implementation scheme 302: A kit according to any one of implementation schemes 299-301, wherein the kit includes a container containing elution buffer.

[0312] Implementation scheme 303: A kit according to any one of implementation schemes 299-302, wherein the kit includes a container containing a washing buffer.

[0313] Implementation Scheme 304: A kit according to any one of Implementation Schemes 299-303, wherein the kit includes a container containing a lysis solution of any one of Implementation Schemes 169-171, and / or a container containing a lysis solution of any one of Implementation Schemes 172-174.

[0314] Implementation scheme 305: A kit of any one of implementation schemes 299-304, wherein the kit comprises a kit of any one of implementation schemes 143-155 and / or a kit of any one of implementation schemes 155-166.

[0315] Implementation scheme 306: A kit according to any one of implementation schemes 299-305, said kit comprising instructional material teaching how to use said kit to convert nucleic acids to determine the methylation status of said nucleic acids.

[0316] Implementation Scheme 307: For use in determining nested PCR reactions MGMT A set of primers and probes for methylation, said set comprising the following primers and probes: The outer forward primer contains the nucleotide sequence: GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263); The outer reverse primer contains the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265). The inner forward primer contains the nucleotide sequence: TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266). The inner reverse primer contains the nucleotide sequence: GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and The probe contains the nucleotide sequence: fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268).

[0317] Implementation Scheme 308: For use in determining nested PCR reactions ACTB (For example, as a control) A set of primers and probes for methylation, said set comprising the following primers and probes: The outer forward primer (102) contains the nucleotide sequence: GTGTGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103); The outer reverse primer (103) contains the nucleotide sequence: CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104). The inner forward primer (148) contains the nucleotide sequence: GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149). The inner reverse primer (149) contains the nucleotide sequence: CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and The probe (178) contains the nucleotide sequence: fluorophore -CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO:179).

[0318] Implementation Scheme 309: For use in determining nested PCR reactions MGMT The primer and probe set for methylation and determination of ACTB methylation as a control includes the primers and probes of embodiment 307 and embodiment 308.

[0319] Implementation Plan 310: Using methylation-specific PCR to determine MGMT A method for methylation, the method comprising: Provides transformed (e.g., bisulfite-converted) DNA, which contains MGMT The promoter region of a gene; Nested PCR was used to target MGMT Methylation-specific PCR, which includes the following primers and probes: The outer forward primer contains the nucleotide sequence: GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263); The outer reverse primer contains the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265). The inner forward primer contains the nucleotide sequence: TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266). The inner reverse primer contains the nucleotide sequence: GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and The probe contains the nucleotide sequence: fluorophore - CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268); and Detection and / or quantitative PCR amplification products to determine the... MGMT Gene methylation.

[0320] Implementation Scheme 311: The method of Implementation Scheme 310, wherein the method further includes: Provides transformed (e.g., bisulfite-converted) DNA, which contains ACTB Promoter regions of genes (e.g., as controls); Nested PCR was used to target ACTB Methylation-specific PCR, which includes the following primers and probes: The outer forward primer contains the nucleotide sequence: GTGTGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103). The outer reverse primer contains the nucleotide sequence: CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 104). The inner forward primer contains the nucleotide sequence: GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO:149). The inner reverse primer contains the nucleotide sequence: CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and The probe contains the nucleotide sequence: fluorophore - CCACCACCCAACACA(N*)CAA(T*)AACAAACAC-blocker (SEQ ID NO:179); and Detection and / or quantitative PCR amplification products to determine the... ACTB Gene methylation.

[0321] Implementation Scheme 312: The method of any one of Implementation Schemes 310-311, wherein the method is for MGMT methylation-specific PCR and the target ACTB Methylation-specific PCR is performed in a single multiplex PCR reaction.

[0322] Implementation Scheme 313: The method of any one of Implementation Schemes 310-312, wherein the methylation-specific PCR is performed using the kit of any one of Implementation Schemes 92-132.

[0323] Implementation Scheme 314: The method of Implementation Scheme 313, wherein the provision includes MGMT The DNA transformed from the promoter region of a gene includes: MGMT Unconverted DNA from the promoter region of a gene is introduced into the cassette and the cassette is operated to convert the DNA in the cassette using a conversion reagent; and / or the provision containing ACTB The DNA transformed from the promoter region of a gene includes: ACTBUnconverted DNA from the promoter region of a gene is introduced into the cassette and the cassette is manipulated to convert the DNA in the cassette using a conversion reagent.

[0324] Implementation Scheme 315: The method of Implementation Scheme 314, wherein the conversion reagent comprises a compound selected from ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and DABSO.

[0325] Implementation Scheme 316: The method of any one of Implementation Schemes 313-315, wherein the operation of the cassette includes heating the DNA and the transformation reagent in a thermal cycling channel or chamber, the thermal cycling channel or chamber being subsequently used for the nested PCR reaction.

[0326] In some embodiments, the method and / or cassette explicitly exclude magnetic materials, including magnetic glass, magnetic hydroxyapatite, and magnetic matrix materials. In some embodiments, the method and / or cassette explicitly exclude magnetic materials used for DNA separation. Attached Figure Description

[0327] Figure 1A The main components of a box (e.g., a GENEXPERT® box) suitable for use with the methods described herein are explained. Figure 1B A top view of the box is shown, illustrating the chambers arranged around the central valve. Figure 1C An illustrative flowchart is shown for determining DNA methylation using the aforementioned reaction cassette.

[0328] Figure 2 Section AC describes one implementation of the GENEXPERT® kit suitable for DNA methylation assays as described herein.

[0329] Figures 3A-3C Exemplary but non-limiting embodiments of modules and systems (e.g., processing units) for DNA methylation assays are shown. Figure 3A This describes the modules used to operate the GENEXPERT® box. Figure 3B This describes some components of one implementation of a module used to operate the kit for DNA methylation analysis. Figure 3C This describes a system that integrates multiple modules (e.g., a processing unit).

[0330] Figures 4A-4D This paper describes several strategies for using the MethyLight protocol to detect / quantify DNA phosphorylation. Figure 4A (Improved from Eads et al. 92000) Nucleic Acids. Res.The diagram illustrates the MethyLight technique. DNA is modified with sodium bisulfite to produce methylation-dependent sequence differences, for example, at CpG dinucleotides by converting unmethylated cytosine residues (located by white circles) to uracil, while methylated cytosine residues (located by black circles) remain cytosine. Fluorescence-based PCR is then performed using primers that may or may not overlap with any methylation site. Sequence differentiation can occur at the level of PCR amplification (box D), at the level of probe hybridization (box B), or both (box D). Sequence differentiation at the PCR amplification level utilizes both primers and probes (box D), or only primers (box C) to overlap with possible methylation sites (e.g., CpG dinucleotides). Only two of the many theoretical methylation arrangements (fully methylated (M) and fully unmethylated (U)) are shown. MethyLight assays can also be designed so that sequence differentiation does not occur at the PCR amplification level. If neither the probe nor the primer overlaps with a methylation site (e.g., CpG dinucleotide) (box A), then non-methylation-dependent sequence differentiation occurs at the PCR amplification or probe hybridization level. This reaction represents the amplification of unconverted genomic DNA without bias towards a methylated state, and can serve as a control for the amount of input DNA. When only the probe overlaps with a methylation site (box B), sequence differentiation can occur via probe hybridization. Figure 4B The MethyLight method is described using a single (e.g., methylation-specific) probe (PR3) along with methylation-specific forward primers (FW) and reverse primers (RV). Figure 4C The MethyLight method, which uses multiple probes (PR1...PR5) that target different regions, is described. Figure 4D The MethyLight method describes the use of multiple probes (PR1…PR5) that target the same region but provide signals with different methylation patterns.

[0331] Figure 5 The results of a representative GeneXpert run from 300 ng HGDNA are presented, showing the ACTB qPCR curve and HMBS qPCR curve.

[0332] Figure 6A and 6B This demonstrates the effect of nested qPCR in 15 cycles ( Figure 6A ) and 20 cycles of nested qPCR ( Figure 6B The use of human genomic DNA (hgDNA) for the conversion of bisulfite ACTB The titration results.

[0333] Figures 7A-7C This represents the results of 20 cycles of nested qPCR (in the cassette) targeting 6 methylation targets (AKR1B1, HOXB4, TM6SF1, RASGRF2, and RASSF1A). Figure 7A Results are shown for 25 ng HSDNA or 5000 cells without bisulfite conversion. Figure 7B The results of 20 cycles of nested qPCR using DNA from MBA-453 cells to target methylation targets converted from bisulfite are shown. Figure 7C The results of 20 cycles of nested qPCR targeting bisulfite-converted methylation targets are shown using DNA (1 µg SS and 10 ng HS DNA) from MBA-453 cells in the vector. Fallout occurred at approximately 25–50 copies or approximately 100 cells.

[0334] Figure 8 The results of the conversion efficiency measurement are presented. The difference in conversion efficiency between unconverted HMBS and converted ACTB is approximately 66% (~1 Ct).

[0335] Figure 9 This demonstrates increased specificity for transformed DNA generated via nested qPCR.

[0336] Figure 10 This illustrates the specificity of the methylation cassette. Unconverted DNA (top image) or unmethylated DNA (bottom image) does not have priming off, except for HIST1H3C.

[0337] Figure 11 An exemplary, but non-limiting, procedure for analyzing methylation using a cassette (such as a GENEXPERT® cassette) is shown. The upper section describes a procedure for analyzing DNA methylation in serum or plasma samples. The lower section describes a procedure for analyzing DNA methylation in tissue sections (such as frozen or formalin-fixed paraffin-embedded (FFPE) sections).

[0338] Figure 12 The results of the button show the transformation of ALU (blue) and methylated RASSF1A (gray) in FFPE cells.

[0339] Figure 13A The arrangement of the boxes was explained. Figure 13B A flowchart illustrating the scheme used in Example 4 is provided.

[0340] Figure 14 This indicates that some of the samples contained bisulfite contamination during operation.

[0341] Figure 15A The results were presented for 1000 MBA-453 cells with bisulfite transformation. Figure 15B The results of the 25ng HS DNA control were explained.

[0342] Figure 16 The structure of DABSO (1,4-diazobridged bicyclic [2.2.2]octane-1,4-sulfinic acid hydrogen salt) was explained.

[0343] Figure 17 An embodiment of the cfDNA sample preparation kit is described. The kit is effective for both DNA and RNA separation. The kit provides three GTC-ethanol washes (typically 1.25M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol), PEG200 rinse, and 15 mM KOH elution.

[0344] Figure 18 This describes the control for cfDNA extraction.

[0345] Figure 19A A comparison of cfDNA preparation using the sample preparation kit described herein is shown compared to preparation using standard tube filling (i.e., tube-based kits). The yield prepared using the kit is very comparable to the yield obtained using the tube filling method. Figure 19B This paper presents a comparison of the amount of extracted DNA using a box-based DNA cleanup assay compared to standard tube filling based on DNA quantity. The box-based method is conservatively within 1 Ct of the tube filling method and is considered to be closer to the standard at higher DNA concentrations.

[0346] Figure 20A An embodiment of a high-volume (e.g., up to 12 mL) sample preparation (HVSP) kit that can be used with qPCR kits and / or with methyl detection kits is described. Figure 20B This illustration shows a change in the HVSP box procedure when used in conjunction with a qPCR box for methylation analysis.

[0347] Figure 21 This illustrates the use of a dual-cassette clearance method (see, for example, Figure 20) utilizing a high-volume sample preparation cassette—where the sample is transferred from the high-volume cassette to the PCR analysis cassette—for HBMS or β-globulin detection, compared to detection using a single PCR analysis cassette (which produces a smaller sample volume).

[0348] Figure 22 This illustrates the results of bisulfite conversion using multiple heating steps (bottom figure) compared to a single heating step (top figure).

[0349] Figure 23A The steps and labor time of methylation analysis using the standard Qiagen DNA purification kit (right) in conjunction with the ZymoDNA methylation kit are described compared to methylation analysis using the methylation analysis kit described herein. Figure 23B The results obtained using two different methods are shown in the comparison.

[0350] Figure 24 The comparison between DNA transformation using DABSO as the transformation reagent and DNA transformation using Zymo sulfite transformation reagent is shown.

[0351] Figure 25 Boxes A and B illustrate the sensitivity of methylated DNA detection. Box A shows a dilution series of methylated DNA (MGMT). Box B illustrates the sensitivity of detection of methylated pancreatic cancer markers.

[0352] Figure 26 The results of the reverse complementary multiplexing measurements for the two chains are presented.

[0353] Figure 27A This illustrates the detection of methylated DNA and mutations in the same box. The top figure illustrates the detection of methylated DNA and the Kras G12D mutation in one box, while the bottom figure illustrates the detection of methylated DNA and wild-type Kras in one box. Figure 27B This demonstrates the detection of methylated DNA and mutation I in the same cassette in the following two pancreatic cancer cell lines: PANC-1 cells (top) and MIA-PaCa cells (bottom).

[0354] Figure 28 Explanation ADAMTS1 and BNC1 Temperature optimization for the forward (top) and reverse (bottom) strands of bisulfite-converted DNA in multi-path methylation analysis.

[0355] Figure 29 This explains multiplexing BNC1 , ADAMTS1 The ability of the MSP primer and probe sets for the control gene ACTB to bind to both sets was evaluated. The probes were then bound to both sets according to preferred conditions.

[0356] Figure 30 Instructions for detection MGMTA set of primers and probes for methylation. Inner forward primer 22150 (SEQ ID NO:266); outer forward primer 22422 (SEQ ID NO:263); probe 22419 (SEQ ID NO:268); inner reverse primer 22151 (SEQ ID NO:267); outer reverse primer 22423 (SEQ ID NO:265); template (SEQ ID NO:1).

[0357] Figure 31 The comparison results between bisulfite pyrosequencing and MGMT methylation cassettes are shown for extracted DNA (top) and FFPET samples (bottom).

[0358] Figure 32 This illustrates the difference in ∆Ct between methylated and unmethylated transformed DNA. BRCA1 Primer and probe set optimization.

[0359] Figure 33 This paper describes a target assay for BRCA1 methylation using the ACTB control gene. As shown in the figure, eight different cell lines were tested, and the effects of NH4 addition were compared.

[0360] Figure 34 This demonstrates that, in the context of normal plasma and three different lung cancer cell lines, methylation is associated with lung cancer-related genes (…). SOX17 , CD01 , TAC1 The results of the three-target methylation assay.

[0361] definition To aid in understanding this invention, many terms and words are defined as follows: The terms “detection”, “detecting”, or “detection” as used herein can describe general behavior of discovery or identification or specific measurement of a detectably labeled composition.

[0362] The term “detectably distinct” or “spectrally distinguishable” as used in this article refers to a set of markers (e.g., dyes / fluorophores) that can be detected and distinguished simultaneously.

[0363] DNA methylation refers to the covalent addition of a methyl group (CH3) to the base cytosine (C), which is typically located at the 5'-CpG-3' of a dinucleotide. The term CpG refers to the cytosine (C) base linked to the guanine (G) base via a phosphate bond in the DNA nucleotide sequence.

[0364] The term "conversion reagent" refers to a reagent that deaminations cytosine in single-stranded DNA to uracil while leaving 5-MeC substantially unaffected. Exemplary conversion reagents include bisulfites (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) and / or compounds that can produce bisulfites under appropriate reaction conditions (e.g., DABSO).

[0365] The term "detecting gene methylation" usually refers to detecting the methylation of cytosine in CPG islands, which are typically found in the promoter region of a gene.

[0366] The terms “patient” and “subject” used herein are generally used interchangeably to refer to humans. In some embodiments, the methods described herein can be used with samples from non-human animals, such as non-human primates, dogs, horses, cats, pigs, cattle, rabbits, etc.

[0367] As used herein, the terms "oligonucleotide," "polynucleotide," and "nucleic acid molecule" refer to molecules containing nucleic acids, including but not limited to DNA. These terms include sequences containing any known base analogues of DNA and RNA, including but not limited to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridylcytosine, pseudoisocytosine, 5-(carboxyhydroxymethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methyl... The following are listed: 5-methoxyamino-methyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, methyl uracil-5-hydroxyacetate, uracil-5-hydroxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl N-uracil-5-hydroxyacetate, uracil-5-hydroxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.

[0368] As used herein, the term "oligonucleotide" refers to a single-stranded polynucleotide that typically has fewer than 500 nucleotides. In some embodiments, oligonucleotides are 8 to 200, 8 to 100, 12 to 200, 12 to 100, 12 to 75, or 12 to 50 nucleotides in length. They can be referred to by their length; for example, a 24-residue oligonucleotide may be called a "24-mer".

[0369] The term “complementary” to the target gene (or its target region) as used herein, and the percentage of “complementarity” between the probe sequence and the target gene sequence, are percentages of “identity” with the target gene sequence or with its complement. In determining the degree of “complementarity” between a probe (or its region) used in the compositions described herein and a target gene (e.g., those disclosed herein), the degree of “complementarity” is expressed as the percentage of identity between the sequence of the probe (or its region) and the target gene sequence or its best-aligned complement. This percentage is calculated by counting the number of identical aligned bases between the two sequences, dividing by the total number of consecutive nucleotides in the probe, and multiplying by 100. When the term “complementary” is used, the oligonucleotide is at least 90% complementary to the target molecule, unless otherwise stated. In some embodiments, the target oligonucleotide is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target sequence.

[0370] As used herein, a "primer" or "probe" refers to an oligonucleotide containing a region complementary to at least eight consecutive nucleotides of a target nucleic acid molecule (e.g., a target gene). In some embodiments, the primer or probe contains a region complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 319, 32, 33, 34, 35, 36, 37, 38, 39, or 40 consecutive nucleotides of the target molecule. When a primer or probe contains a region "complementary to at least x consecutive nucleotides of the target molecule," the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some implementations, the primers or probes are at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.

[0371] The term "nucleic acid amplification" includes any method that typically replicates at least a portion of at least one target nucleic acid in a template-dependent manner, including, but not limited to, a wide range of techniques for linear or exponential amplification of nucleic acid sequences. Exemplary methods for performing the amplification step include polymerase chain reaction (PCR), ligase chain reaction (LCR), ligase detection reaction (LDR), multiplexed ligation-dependent probe amplification (MLPA), post-ligation Q-replicaase amplification, primer extension, strand displacement amplification (SDA), superbranched strand displacement amplification, multiple displacement amplification (MDA), nucleic acid strand-based amplification (NASBA), two-step multiplexing, rolling circle amplification (RCA), etc., including multiplexed versions and combinations thereof, such as, but not limited to, OLA / PCR, PCR / OLA, LDR / PCR, PCR / PCR / LDR, PCR / LDR, LCR / PCR, PCR / LCR (also known as combinatorial chain reaction—CCR), digital amplification, etc. For descriptions of such techniques, see Ausbel et al.; PCR Primer: A Laboratory Manual, Diffenbach, Ed., Cold Spring Harbor Press (1995); The Electronic Protocol Book, Chang Bioscience (2002); Msuih et al., J. Clin. Micro. 34:501-07 (1996); The Nucleic Acid Protocols Handbook, edited by R. Rapley, Humana Press, Totowa, NJ (2002); Abramson et al., Curr Opin Biotechnol. February 1993; 4(1):41-7, U.S. Patent No. 6,027,998; U.S. Patent No.6,605,451, Barany et al., PCT Publication No. WO 97 / 31256; Wenz et al., PCT Publication No. WO 01 / 92579; Day et al., Genomics, 29(1): 152-162 (1995); Ehrlich et al., Science 252:1643-50 (1991); Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press (1990); Favis et al., Nature Biotechnology 18:561-64 (2000); and Rabenau et al., Infection 28:97-102 (2000); Belgrader, Barany and Lubin, Development of a Multiplex Ligation Detection Reaction DNA Typing Assay, Sixth International Symposium on Human Identification, 1995 (available from the World Wide Web: promega.com / geneticidproc / ussymp6proc / blegrad.html); LCR kit instruction manual, Cat.#200520, Rev. #050002, Stratagene, 2002; Barany, Proc. Natl. Acad. Sci. USA88:188-93 (1991); Bi and Sambrook, Nucl. Acids Res. 25:2924-2951 (1997); Zirvi et al., Nucl. Acid Res. 27:e40i-viii (1999); Dean et al., Proc Natl Acad Sci USA 99:5261-66 (2002); Barany and Gelfand, Gene 109:1-11 (1991); Walker et al., Nucl. Acid Res. 20:1691-96 (1992); Polstra et al., BMC Inf. Dis. 2:18-(2002); Lage et al., Genome Res. 2003 Feb; 13(2):294-307, and Landegren et al., Science 241:1077-80 (1988), Demidov, V., Expert Rev Mol Diagn. 2002 November; 2(6):542-8., Cook et al., J Microbiol Methods. 2003 May; 53(2):165-74, Schweitzer et al., Curr OpinBiotechnol. 2001 February; 12(1):21-7, U.S. Patent No. 5,830,711, U.S. Patent No. 6,027,889, U.S. Patent No. 5,686,243, PCT Publication No. W00056927A3 and PCT Publication No. W09803673A1, and other sources.

[0372] In some embodiments, amplification includes at least one cycle of the following sequential steps: annealing at least one primer having a complementary or substantially complementary sequence in at least one target nucleic acid; synthesizing at least one nucleotide chain in a template-dependent manner using a polymerase; and denaturing the newly formed nucleic acid duplex to separate the strands. The cycles may be repeatable or non-repeatable. Amplification may include thermal cycling, or in some embodiments, may be performed isothermally.

[0373] The term "hybridization" in this document generally refers to "specific hybridization," which is the preferential binding of a nucleic acid molecule to a specific nucleotide sequence, forming a double strand or hybridizing, and in some implementations, performed under stringent conditions. The term "stringent conditions" refers to conditions under which the probe will preferentially hybridize with its target sequence and, to a lesser extent, or not at all, with other sequences. In the case of nucleic acid hybridization, "stringent hybridization" and "stringent hybridization washing conditions" are sequence-dependent and vary under different environmental parameters. For extensive guidance on nucleic acid hybridization, see, for example, Tijssen (1993), Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, NY ("Tijssen"). Typically, the highly stringent hybridization and washing conditions chosen for membrane hybridization are: at a defined ionic strength and pH, the temperature is higher than the melting point (T0) of the specific sequence. m Approximately 5°C lower. mThis is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe (at a given ionic strength and pH). In some embodiments, very stringent conditions are chosen to be equal to the Ta of a specific probe. m The dependence of hybridization strictness on buffer composition, temperature, and probe length is well known to those skilled in the art (see, for example, Sambrook and Russell (2001)). Molecular Cloning: A Laboratory Manual (3rd Edition) Volumes 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, NY.

[0374] As used herein, "sample" generally refers to biological samples, including biological fluids (e.g., blood or blood components, serum, plasma, pancreatic juice, cerebrospinal fluid, oral fluid, lymph, intraocular fluid, etc.) and / or tissue samples, including but not limited to biopsy samples from various tissues, frozen tissue samples, formalin-fixed paraffin-embedded (FFPE) samples, including but not limited to breast tissue, cervical tissue, vaginal tissue, colon / rectal tissue, laryngeal tissue, and other types of human samples, such as blood, feces, and biopsy samples. The term "sample" also includes diluted and / or buffered forms of the above-mentioned samples, such as buffer solutions containing swab samples, urine samples with added buffer, etc.

[0375] The term "indicating the presence or susceptibility to cancer" as used herein refers to a specific outcome that tends to suggest the presence or possibility of cancer and / or precancerous conditions. This term does not imply a definitive determination that the condition is present. A definitive determination may be made based on further examinations or tests deemed appropriate by the physician. Furthermore, this term is not required to determine which condition is likely based solely on a specific outcome. Additionally, positive results from other examinations or tests are expected to be considered for differential diagnosis.

[0376] The term "tubefill operation" refers to an operation performed using standard laboratory equipment instead of a box (e.g., instead of using the GENEXPERT® or modified GENEXPERT® boxes described herein). Detailed Implementation

[0377] In various embodiments, apparatus and methods are provided that facilitate the rapid detection and / or characterization of methylation in DNA samples. In some embodiments, automated reaction kits and methods utilizing these automated kits are provided to facilitate the analysis of methylation in DNA samples and optionally to measure mRNA levels and determine DNA methylation. In various embodiments, DNA methylation is determined by bisulfite conversion and analysis of the bisulfite-converted DNA (e.g., by methylation-specific PCR, nucleic acid sequencing, melting point analysis, etc.). In some embodiments, the kit performs all or part of the bisulfite conversion of DNA and all or part of the analysis of the bisulfite-converted DNA. In some embodiments, the kit performs all steps involved in the bisulfite conversion and all or part of the analysis of the bisulfite-converted DNA. In some embodiments, the kit performs all steps involved in the bisulfite conversion and all of the analysis of the bisulfite-converted DNA. In some embodiments, the kit optionally performs the isolation and purification of the DNA to be analyzed.

[0378] Automation of methylation analysis offers several advantages, including, for example, reduced overall processing time, increased efficiency, reduced user error and variability, minimized losses between steps, and improved ability to use smaller sample sizes. The use of the box-based method described herein not only allows for rapid and simple detection of a wide range of sample types but also enables the evaluation of methylation changes measured in several different types of cancer, including but not limited to breast cancer, colorectal cancer, prostate cancer, and lung cancer.

[0379] Furthermore, the box-based method described herein allows for the measurement of mRNA from the same sample. Measurement of the corresponding upstream and / or downstream mRNAs involved in DNA methylation is important for understanding the mechanisms and activities of epigenetic modifications. For example, the measurement of DNA methyltransferase (DNMT) mRNA, as well as DNA methylation in several cancers, has been investigated (see Table 1).

[0380] Table 1. Exemplary DNA methyltransferases and their importance in specific cancers (from Subramaniam et al. (2014)) Front Oncol. , 4: Article 80, doi: 10.3389 / fonc.2014.000). Typically, separate extractions of DNA or RNA are used to study and measure genes and transcripts. Co-detection from the same sample preparation is ideal for minimizing variability from sample preparation to assay, sample to sample, and cell to cell.

[0381] Box-based DNA bisulfite conversion In some embodiments, DNA extraction, bisulfite conversion, and methylation-specific PCR are all performed within the cassette. In one exemplary embodiment, the user adds the sample to the lysis / binding reagent, then briefly mixes / vortexes the reagent, and then adds the sample to the sample port or chamber in the cassette. Exemplary but non-limiting lysis reagents (including those particularly suitable for FFPE sections) are described in PCT Patent Publication No. WO / 2014 / 052551 (PCT / US2013 / 061863), which is incorporated herein by reference for the reagents described therein.

[0382] Other exemplary lysis reagents for serum or plasma and for formalin-fixed paraffin-embedded (FFPE) samples are shown in the examples (in Tables 11 and 12, respectively).

[0383] In some implementations, the box is placed in a processing module, and the measurement is initiated by clicking a set of selections within the software controlling the processing module (see, for example...). Figure 11 The bisulfite conversion process and analysis of the bisulfite-converted DNA are then performed after the cassette is installed. In some embodiments, mRNA is also measured. In some embodiments, all operations are performed within the cassette, while in other embodiments, the operations are performed in groups within the cassette, as described below.

[0384] The sample may include any biological sample containing DNA, the methylation status of which will be evaluated. Exemplary samples include, but are not limited to, isolated DNA and / or isolated total nucleic acids, cells, tissues, biological fluids containing nucleic acids, etc. In some embodiments, the biological sample includes a biological fluid selected from plasma, serum, amniotic fluid, saliva, mucus, urine, pancreatic juice, and cerebrospinal fluid. In some embodiments, the sample includes a tissue sample from healthy tissue or a tissue sample from a diseased tissue. In some embodiments, the tissue sample is from a fetus, newborn, child, adolescent, or adult. In some embodiments, the tissue sample includes tumor cells and / or biopsies from tumors (e.g., breast cancer, prostate cancer, brain cancer, cervical cancer, ovarian cancer, pancreatic cancer, colon cancer, gastric cancer, hepatocellular carcinoma, etc.). In some embodiments, the sample includes a fixed sample, such as a formalin-fixed tissue sample. In some embodiments, the sample includes an embedded tissue sample (e.g., a formalin-fixed paraffin-embedded (FFPE) tissue sample).

[0385] DNA bisulfite conversion typically involves the following four steps: 1) DNA purification; 2) DNA denaturation; 3) DNA transformation (e.g., bisulfite deamination); and 4) Basic desulfonate group.

[0386] Typically, DNA transformation (e.g., using transformation reagents such as bisulfite) involves: 1) desulfonation: adding bisulfite to the 5-6 double bond of cytosine; and 2) hydrolytic deamination: hydrolyzing and deaminating the resulting cytosine-bisulfite derivative to produce a uracil bisulfite derivative. This is followed by alkaline desulfonation: removing the sulfonic acid group through alkaline treatment to produce uracil, as described above.

[0387] As noted above, in some embodiments, DNA purification may be performed before the sample is placed in the cartridge, or DNA purification may be performed by the cartridge itself. Therefore, in some embodiments, the sample is added directly to the reaction cartridge, while in other embodiments, the sample is mixed with one or more reagents. In some embodiments, DNA preparation typically involves preparing substantially isolated DNA. This may include lysing cells to release DNA, removing microparticles and cellular debris, and / or removing protein components to provide a sample containing substantially pure nucleic acids (e.g., substantially pure DNA and / or a combination of substantially pure DNA and RNA). In an exemplary but non-limiting embodiment, a sample (e.g., a tissue sample) is added to a lysis reagent, agitated, and then inserted into the cartridge for further processing.

[0388] In some embodiments, all the reagents required for the bisulfite conversion of DNA are provided in the cartridge. In some embodiments, to prevent the reagents in the cartridge from degrading over time, certain reagents may be added to the cartridge immediately before use. Thus, for example, in some embodiments, it is anticipated that the conversion reagent (e.g., bisulfite reagent) and / or guanidine thiocyanate reagent (e.g., GTC-EtOH-Tween) may be loaded into the cartridge at or near the time the sample is added. In some embodiments, the guanidine thiocyanate reagent (e.g., GTC-EtOH-Tween) binds to the sample and is added to the sample receiving chamber of the cartridge (e.g., chamber 2 in the GENEXPERT® cartridge).

[0389] In some embodiments, when performing bisulfite conversion of DNA using a reaction cassette (e.g., the GENEXPERT® cassette), the method includes: i) Contacting a biological sample containing nucleic acids with a first matrix material containing a first column or filter, wherein the matrix material binds to and / or filters the nucleic acids in the sample, thereby purifying DNA.

[0390] ii) Elute the bound DNA from the first matrix material (e.g., using an alkaline solution) and denature the DNA to produce eluted denatured DNA; iii) Heating eluted DNA in the presence of a transformation reagent (e.g., a reagent that generates bisulfite ions) to produce transformed (e.g., deamination) nucleic acid; iv) Contact the transformed nucleic acid with a second matrix material containing the second column to bind the deaminated nucleic acid to the second matrix material (note that in some embodiments, the second column may be a different column from the first column, or in other embodiments, the same column may be used twice). v) Desulfonate the bound deamination nucleic acid and / or simultaneously elute and desulfonate the nucleic acid by contacting the deamination nucleic acid with an alkaline solution to produce transformed (e.g., bisulfite-converted) nucleic acid; and vi) Elution of the transformed nucleic acid from the second matrix material, wherein at least steps iv) to vi) are carried out in a reaction chamber.

[0391] In some embodiments, the method further includes analysis of the transformed DNA. Therefore, in some embodiments, the method further includes: vii) Perform methylation-specific PCR and / or nucleic acid sequencing and / or high-resolution melting analysis (HRM) on the transformed nucleic acid to determine the methylation of the nucleic acid, wherein at least steps iv) to vi) are performed in a single reaction cassette.

[0392] In some implementations, at least steps iii) to vi) are carried out in a reaction chamber.

[0393] In some implementations, at least steps ii) to vi) are carried out in a reaction chamber.

[0394] In some implementations, at least steps i) to vi) are carried out in a reaction chamber.

[0395] In some implementations, at least steps i) to vii) are carried out in a reaction chamber.

[0396] It should be noted that the first column and (if present) the second column can refer to separate columns. However, particularly when integrated into a reaction cassette, a "column" can simply be a matrix material of a chamber or channel disposed within the cassette. In various embodiments, the "column" functions as a filter and / or as an affinity column for binding nucleic acids. Thus, in some embodiments, the column comprises a matrix material for binding nucleic acids (e.g., DNA and / or RNA). Exemplary matrix materials include, but are not limited to, glass (silica), ion exchange resins, hydroxyapatite, etc. It should be understood that the matrix material can take many forms. Thus, in some embodiments, the matrix material includes porous materials, particulate materials (e.g., microbeads, nanobeads, etc.), structural materials (e.g., porous "baffle" systems, serpentine channels, etc.). In some embodiments, the first column and the second column are different columns (chambers or channels). In other embodiments, the first column and the second column are the same column (chamber or channel) that can be used twice (e.g., first and second).

[0397] In some embodiments, the use of one or more additional filters is considered, for example, to remove the initial sample before it comes into contact with the first matrix material. Thus, for example, in some embodiments, the filter matrix (e.g., a polycarbonate filter, nylon filter, polypropylene filter, polyester filter, nylon filter, ceramic filter, polytetrafluoroethylene filter, etc.) is positioned in or "downstream" of the sample receiving chamber and before the first "column". It should also be understood that in some embodiments, the sample may be pyrolyzed and / or filtered before deposition into the sample receiving chamber.

[0398] In some exemplary but non-limiting embodiments, the GENEXPERT® box (Cepheid, Inc., Sunnyvale, CA) or variations thereof may be used to perform the methods described herein. In each embodiment, sample extraction and / or amplification and / or DNA transformation and / or detection are all performed within this self-contained “laboratory in a box” (see, for example, U.S. Patent Nos. 5,958,349, 6,403,037, 6,440,725, 6,783,736, and 6,818,185, which are incorporated herein by reference in their entirety). In each embodiment, the box components may include, but are not limited to, a processing chamber containing reagents, a filter, and capture technologies suitable for the extraction, purification, and amplification of target nucleic acids. Valves allow fluid to transfer from one chamber to another and contain nucleic acid lysis and filtration components. Optical windows enable real-time optical detection (e.g., real-time optical detection of PCR amplification products). Reaction tubes that allow for very rapid heating and / or thermal cycling may be provided.

[0399] In some implementations, an exemplary GENEXPERT® cartridge includes a plurality of chambers arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or from the chambers in fluid communication with the central valve. Rotation of the valve assembly determines which chamber is in fluid communication with the central valve. Figure 1A An exemplary GENEXPERT® box is illustrated, showing the box, processing / reagent chamber, reaction tube (e.g., heating and / or thermal circulation tube), optional optical window, and valves that facilitate fluid transfer from one chamber to another.

[0400] An exemplary arrangement of the box is as follows: Figure 1B As shown, a top view of the box is provided, identifying each compartment by number. In one exemplary but non-limiting embodiment, the components of the compartments contained in the box are listed in Table 2. It should be understood that this arrangement of reagents and compartments is exemplary and non-limiting. Other reagent arrangements and / or other compartment layouts can be obtained by those skilled in the art using the teachings provided herein.

[0401] Table 2. An exemplary embodiment illustrating the contents of the GENEXPERT® kit for measuring DNA methylation. An implementation scheme for a step-by-step procedure for DNA methylation assay using this kit is shown in Figure 1C The kit configuration includes five chambers for holding reagents and buffers during use (e.g., when the kit is operated to determine DNA methylation) (e.g., chambers 3, 4, 5, 8, and 10); one chamber for holding a user-added sample (e.g., chamber 2); and one or two (or more) chambers for holding analytical reagents (e.g., MSP reagents such as enzyme reactions, template-specific reactions, and / or 200 mM Tris pH 7.0, such as beads) (e.g., chambers 9 and 11). In some embodiments, reagents (e.g., polymerases, reverse transcriptases, primers, probes) are provided in solution form. In some embodiments, reagents are provided in lyophilized powder form. In some embodiments, reagents are provided in lyophilized beads form. The beads may further contain reagents to improve reagent stability and / or activity (see, for example, U.S. Patent Publication No. 2006 / 0068399, which is incorporated herein by reference for the beads, bead constructions, and bead formulations described therein).

[0402] In some embodiments, the provided cartridge contains all the reagents required to operate the cartridge, and only the sample (e.g., the sample in a buffer / lysis / precipitation solution) is added to the cartridge. In some embodiments, the provided cartridge does not contain GTC-EtOH and / or bisulfite reagents, one or both of which are added at the time of use. Therefore, in some embodiments, the GTC-EtOH reagent is added to the cartridge at the time of use; in some embodiments, the bisulfite reagent (other than the sample) is added to the chamber at the time of use; in some embodiments, both GTC-EtOH and the bisulfite reagent (other than the sample) are added to the cartridge at the time of use. In some embodiments, these reagents are added directly to the desired chamber (see, for example, Table 2). In some embodiments, a port for loading reagents is provided, and said port is configured to deliver reagents to the desired chamber.

[0403] At the start of the assay, the sample is dispensed from chamber 2 of the cassette through a glass fiber column (e.g., the first column). DNA is eluted from the column while being denatured by an alkaline solution (e.g., a low-concentration potassium hydroxide solution from chamber 10) and introduced into chamber 4 with a concentrated sulfite reagent (e.g., concentrated ammonium bisulfite). In some embodiments, DNA is eluted with an alkaline solution of KOH, having a pH greater than about 10.5 or a pH greater than about 12. In some embodiments, DNA is eluted with 10–15 mM KOH.

[0404] As described above, DNA is eluted (optionally broken up using sonication) into a bisulfite reagent. In various embodiments, the conversion reagent (e.g., a bisulfite reagent) is present at a concentration of about 4 M to about 10 M, about 5 M to about 8 M, or about 6 M or about 7 M. In some embodiments, the sulfite solution comprises sodium metabisulfite or potassium bisulfite or ammonium bisulfite or cesium bisulfite or DABSO (1,4-diazobridged bicyclo[2.2.2]octane-1,4-sulfinate, see example...). Figure 16 In some embodiments, the conversion agent (e.g., a bisulfite agent) comprises a free radical scavenger (including, but not limited to, one or more chemicals that prevent the oxidation of sulfite to sulfate (TROLOX and hydroquinone)) and / or a catalyst (polyamine).

[0405] The DNA-bisulfite (DNA / conversion reagent) mixture is then introduced into a temperature-controlled chamber or channel and incubated at a temperature of about 40°C to about 95°C. In some embodiments, the mixture is incubated at a constant temperature, while in other embodiments, such as when the temperature-controlled chamber or channel is a thermally circulated chamber or channel (e.g., a smart circulator tube at the rear of the cartridge), the mixture is thermally circulated (e.g., from 60°C to 95°C). The mixture is incubated until the DNA is converted (e.g., deamination). In some embodiments, the incubation lasts from about 5 minutes to up to about 4 hours, or preferably from about 15 minutes to up to about 45 minutes.

[0406] After incubation with the DNA / conversion reagent (e.g., DNA-bisulfite), the solution is mixed with fresh guanidine thiocyanate-EtOH (e.g., from chamber 3) and dispensed onto the matrix material. In some embodiments, the first column is reused, so there is only one column and the second column is identical to the first column. In some embodiments, the second column is a separate column, distinct from the first column.

[0407] The DNA bound to the second column matrix material is washed and rinsed with fresh GTC-EtOH (e.g., from chamber 3) and then rinsed with PEG 200 rinsing agent (e.g., from chamber 8). The DNA is then desulfonated on the column, or simultaneously eluted and desulfonated by contacting the deaminated nucleic acid with an alkaline solution (e.g., KOH from chamber 10) to produce bisulfite-converted nucleic acid. In some embodiments, incubation lasts from about 1 minute to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or about 15 minutes.

[0408] When the initial incubation is performed in a thermally circulated chamber intended for further use, the chamber or channel is washed with buffer to remove residual bisulfite and neutralize the pH. Surprisingly, incubation and / or desulfonation using conversion reagents (e.g., bisulfite reagents) can be performed in the channel or chamber subsequently used for PCR without bisulfite contamination that substantially interferes with subsequent PCR reactions.

[0409] The eluted desulfonated bisulfite-converted DNA can be mixed with an appropriate buffer and analyzed for methylation. In some embodiments, the converted DNA is mixed with concentrated Tris, enzyme reaction and template-specific beads (e.g., beads containing primers and / or probes for PCR or nested PCR) in chambers 9 and 11, and the final mixture is aspirated into a heated circulating tube or chamber for methylation-specific quantitative PCR.

[0410] Bisulfite contamination in qPCR steps can be a major cause of failure in methylation cassettes. Residual bisulfite can originate from direct contamination of the PCR reaction tubes (e.g., during the bisulfite conversion step) or from indirect contamination (e.g., cross-contamination during bisulfite fluid movement between chambers). If present, residual bisulfite contamination can be measured by bisulfite-mediated probe cleavage in the qPCR step, which causes an increase in fluorescence in early qPCR cycles (cycles 1-10) typically used for background subtraction. Therefore, in some embodiments, the cassette includes beads providing one or more probes that are cleavable during PCR if bisulfite is present. The results of runs containing bisulfite contamination are... Figure 14 As shown in the image.

[0411] Although the above method is described in the context of a specific chamber in the GENEXPERT® box (and in Example 4, see, for example...), Figure 13A It should be understood that specific reagent / compartment allocations may vary depending on the specific circumstances of the methylation analysis protocol being applied.

[0412] Therefore, the operation of methylation analysis kits (e.g., GENEXPERT® kits) is typically described using flowcharts (see, for example...). Figure 1C and 13B ).exist Figure 13B In the exemplary but non-limiting embodiments shown, the DNA sample is provided in the form of a binding buffer (e.g., a buffer containing GTC-EtoH, which in some embodiments is provided after the sample has been treated with proteinase K and / or a lysis solution). In some embodiments, the sample is obtained from a sample preparation kit described herein (see, for example, Figure 20).

[0413] The sample in the binding buffer is introduced into the sample receiving chamber of the cartridge. In operation, the cartridge is manipulated to deliver the sample solution to the DNA-binding matrix (“column”). The bound DNA is then eluted from the column using an alkaline reagent (e.g., KOH solution) bound to a bisulfite reagent, and transferred to a heated tube (typically a PCR reaction tube) within the cartridge, where a bisulfite reaction is performed (e.g., in this exemplary protocol, at approximately 50°C or approximately 60°C to approximately 90°C for approximately 45 minutes (or up to approximately 90 minutes)). The reacted DNA binds to the binding buffer (e.g., 2.25 M guanidine thiocyanate, 22.5 mM Tris pH 7.0, 0.5% Tween 20, 50% ethanol, and 0.005% SE-15 defoamer (a 10% emulsion of active silicone defoamer and nonionic emulsifier)) and is transferred back to the same column or to a different column, where it binds again to the column matrix. The DNA from the reaction is washed with GTC-EtOH, rinsed with PEG (e.g., PEG200), and eluted again from the column with an alkaline reagent (e.g., KOH), which also desulfonates the DNA. When the DNA is desulfonated, the reaction tube (e.g., a PCR reaction tube) can be heated and rinsed (e.g., with 10× rinsing solution) to remove any bisulfite reagent. The eluted DNA (or portions thereof) can be transferred to reaction tubes for PCR and / or nested PCR.

[0414] It should be understood that these operations can be performed on the entire sample or on a portion of the DNA sample. In the latter case, a portion of the sample can be stored in one or more chambers and used as a control, or for different analyses / protocols.

[0415] Co-purification and detection of RNA expression and DNA methylation In some embodiments, co-purification and detection of altered RNA expression and DNA methylation (MSP) in a cassette-based assay (e.g., using a GENEXPERT® cassette) are provided. In some embodiments, these assays identify the expression of alterations such as DNMT associated with tumor-specific methylation from the same sample preparation. In some embodiments, these assays can be used to confirm expression and methylation status.

[0416] The inventors have demonstrated that we can use Tris buffer elution to elute nucleic acids from a column while retaining a portion of the nucleic acid on the column. In one exemplary embodiment, the RNA component is eluted using a Tris solution and retained in a chamber, for example, within a cassette.

[0417] After preserving the RNA component, the column is cleaned and eluted with NaOH or KOH eluting agent to remove and denature the DNA before entering the bisulfite for transformation, as described above. The RNA-eluted component is then used to elute the bisulfite-transformed DNA from the column, or the mixture is eluted with KOH, and the two components (RNA and transformed DNA product) are combined for qRT-PCR with RNA plus bisulfite transformation. This involves combining the reverse transcriptase (RT) step against RNA with MSP (or other analytical methods) from the same sample in the same tube. Alternative methods include, but are not limited to, using one thermally cycled tube / chamber in the cartridge or multiple thermally cycled tubes / chambers simultaneously, performing the RT step of qPCR separately / sequentially (separately before mixing with DNA (binding cDNA and DNA)), or PCR of DNA, or RT RNA.

[0418] Analysis of transformed DNA A variety of analytical methods can be performed within the cartridge to assess DNA methylation. Alternatively, in some embodiments, the cartridge can be coupled to another device and / or system for further analysis of transformed (e.g., bisulfite- or DABSO-transformed) DNA. Exemplary methods include, but are not limited to, methylation-specific PCR (MSP), direct sequencing, high-resolution melting analysis (HRM), pyrosequencing (by adding sequencing), base-specific cleavage analysis (e.g., base-specific MALDI-TOF), etc.

[0419] Methylation-specific PCR (MSP) In various embodiments, methylation-specific PCR can be used to assess the methylation status of target DNA. MSP uses primers and / or probes designed to be "methylation-specific" (by containing sequences complementary only to unconverted 5-methylcytosine) or conversely "non-methylation-specific" (complemented to thymine converted from unmethylated cytosine). Methylation is then determined by the ability to amplify using specific primers. This method is particularly effective for studying CpG islands in regions of high methylation density because the increased number of unconverted methylcytosines in the target to be amplified improves the specificity of the PCR. In some embodiments, placing CpG pairs at the 3' end of the primers also improves specificity.

[0420] In some implementations, the MethyLight method is used to assess methylation. The MethyLight method is based on MSP, but quantitative analysis is provided using quantitative PCR (see, for example, Eades et al. (2000)). Nucleic Acids Res.,28(8): E32. doi:10.1093 / nar / 28.8.e32). Methylation-specific primers are used, and methylation-specific fluorescent reporter probes annealed to the amplified region are also used. Alternatively, if differentiation between CpG pairs within the included sequence is required, primers or probes without methylation specificity can be designed. The methylated reference DNA is quantified. To improve the specificity of PCR for DNA that has successfully undergone bisulfite conversion, a modification of this protocol (ConLight-MSP) uses a probe for additional bisulfite-converted DNA to quantify this non-specific amplification (see, for example, Rand et al. (2002)). Methods 27(2): 114-120).

[0421] In each implementation, the MethyLight method utilizes TAQMAN® technology, which is based on the cleavage of double-labeled fluorescent hybridization probes by the 5' nuclease activity of Taq polymerase during PCR amplification (Eads et al. (1999)). Cancer Res. , 59: 2302-2306; Livak et al. (1995) PCR Meth. Appl. , 4: 357-362; Lee et al. (1993) Nucleic Acids Res. , 21: 3761-3766; Fink et al. (1998) Nat. Med. (4: 1329-1333). The use of three different oligonucleotides (forward and reverse PCR primers and fluorescent hybridization probes) in TAQMAN® technology provides opportunities for several sequence detection strategies.

[0422] For example, sequence differentiation can occur at the level of the PCR amplification process (see, for example, ...). Figure 4A (see box C) and / or at the level of fluorescent probe hybridization (see, for example, box C) and / or at the level of fluorescent probe hybridization (see, for example) Figure 4A (See Box B). In both steps, the differentiation is based on differential annealing of perfectly matched oligonucleotides relative to mismatched oligonucleotides. In the MethyLight technique, sequence differentiation at the PCR amplification level occurs through the following steps: designing primers and probes, or primers only, or probes only, to overlap with possible DNA methylation sites (e.g., CpG dinucleotides). One approach is simply a fluorescence-based version of the MSP technique (Herman et al. (1996)). Proc. Natl. Acad. Sci. USA(References 93: 9821-9826). Each oligonucleotide (primer and probe) can cover any position from zero to multiple CpG dinucleotides. Each CpG dinucleotide can produce two different sequence variants after bisulfite conversion, depending on whether the specific site is methylated (mCpG) or unmethylated (UpG). For example, if an oligonucleotide overlaps with two CpG dinucleotides, the number of possible sequence variants in the genomic DNA within the region covered by the oligonucleotide is 2 × 2 = 4. If both the primer and probe overlap with two CpGs, the total number of variants contained within the sequence covered by the oligonucleotide is 4 × 4 × 4 = 64. Theoretically, one could design individual PCR reactions to analyze the relative amounts of each of these 64 possible sequence variants. However, by designing reactions for fully methylated and fully unmethylated molecules (which represent the two most extreme sequence variants of this hypothetical instance), important methylation information can be obtained from the analysis of a much smaller number of variants. The ratio between these two reactions, or between the methylation reaction and the control reaction, provides a measure of the prevalence of methylated molecules at that position.

[0423] MethyLight technology can be further improved to avoid sequence discrimination at the PCR amplification level. If neither the primers nor the probes overlap with any CpG dinucleotides, the reaction represents unbiased amplification and can be used as a control for the amount of input DNA. A useful illustrative control reaction is one in which the entire amplicon contains no CpG dinucleotides in the untransformed genomic sequence. When only the probe is designed to cover CpG dinucleotides, sequence discrimination occurs only at the probe hybridization level. Under this version, all sequence variants derived from the sodium bisulfite transformation step are amplified with equal efficiency, provided there is no amplification bias (see, for example, Wamecke et al. (1997)). Nucleic Acids Res. (25: 4422-1426). In this context, the design of individual probes targeting different sequence variants associated with specific methylation patterns (2×2 = 4 probes in the case of two CpGs) allows for the quantitative determination of the relative prevalence of various sequence arrangements in the pool of PCR products.

[0424] In some embodiments, the analytical method also provides PCR specific to unconverted DNA. This PCR can investigate SNPs, mutations, and / or translocations, etc. In this regard, note that the detection of mutations and methylation in a single cassette is described in Example 12 (see, e.g.) Figure 27A and 27B The detection of SNPs, mutations, translocations, etc., can be easily achieved by using primer and probe sets that specifically target these targets.

[0425] Nested PCR and multi-channel PCR assays In some embodiments, PCR methods known to those skilled in the art can be used to detect methylated DNA. In some embodiments, nested PCR reactions are used to detect methylation targets. In an illustrative but non-limiting embodiment (see, for example, Example 4), a nested PCR protocol can be used for the first 15-20 cycles of PCR reactions and is non-specific to methylation but only to transformed DNA sequences (i.e., those not exceeding CpG, or when they exceed CpG, R=purine or Y=pyrimidine is used to capture methylated and unmethylated template sequences). The second qPCR reaction (e.g., a 45-cycle qPCR reaction) may contain primers and probes specifically targeting CpG typically 2-3 methylated sequences.

[0426] It should be noted that in some implementations, a single probe is used for MethyLight analysis (see, for example...). Figure 4B In this method, using a single (e.g., methylation-specific) probe (PR3) and methylation-specific forward (FW) and reverse (RV) primers, methylation-specific PCR of the probe (PR3) provides signals for methylation and bisulfite conversion dependent on the FW, RV, and PR3 sequences.

[0427] Each implementation scheme includes multiplex PCR assays. An example is provided to illustrate this. Figure 4C The MethyLight method, employing multiple probes (PR1, PR2, ..., PR5) targeting different regions, is described. Combined signals from all probes (PR1, PR2, PR3, PR4, and PR5) produce a measurement of the amount / degree of methylation. In some embodiments, each probe has its own specific dye / fluorophore, making it detectable independently of other probes. Therefore, a signal can still be detected even when a target is unmethylated; for example, if PR3 is unmethylated, there will be no signal or a reduced signal from the remaining probes. Figure 4D The MethyLight method is described, which uses multiple probes (PR1…PR5) that target the same region but provide signals with different methylation patterns. Although Figure 4C The method described herein can provide detection from a larger region. This multi-probe approach on a single, smaller region can be accomplished using sequence-specific primers or probes that, after bisulfite conversion, explore the degree of methylation on a specific sequence.

[0428] In some implementations, reverse complementary multiplexing for both chains can be used (see, for example, Figure 26Following bisulfite conversion, both strands lose their complementarity. Therefore, primer and probe sets for one or the other strand can be designed, generating unique amplicones. Besides providing "more opportunities" for detection, this method may improve sensitivity (at LOD, if only one or the other strand terminates in the tube, the method guarantees signal reception). This method allows multiplexing to be extended to detect different CpGs at the same promoter site. Reverse complementary multiplexing provides more opportunities to detect target methylation and obtain heteromethylation.

[0429] The methods described above are illustrative and non-limiting. Using the teachings provided herein, various variations of MSP and / or MethyLight analysis will be available to those skilled in the art and can be implemented on reaction cassettes (e.g., as described herein).

[0430] direct sequencing In some embodiments, direct sequencing methods can be used to determine the methylation status of DNA. In some embodiments, the method can utilize PCR and standard dideoxynucleotide DNA sequencing to directly determine nucleotides resistant to bisulfite conversion (see, for example, Frommer et al. (1992)). Proc. Natl. Acad. Sci. USA, 89 (5): 1827-1831). In various embodiments, primers are designed to be strand-specific and bisulfite-specific (e.g., primers containing non-CpG cytosine so that they are not complementary to untreated bisulfite DNA), flanking (but not containing) the target methylation site. Therefore, it amplifies both methylated and unmethylated sequences, unlike methylation-specific PCR. All unmethylated cytosine sites appear as thymine in the amplified sequence of the obtained sense strand and as adenine in the amplified antisense strand. In some embodiments, nested PCR methods can be used to increase the product available for sequencing.

[0431] In some embodiments, sequencing is performed within the cassette. In other embodiments, the cassette may be coupled to a sequencing instrument (e.g., fluid coupling) to provide sequencing analysis. Alternatively, in some embodiments, the amplified products may be manually transferred from the cassette to the sequencing system.

[0432] High-resolution melting analysis (HRM) In some implementations, high-resolution melting analysis (HRM) can be used to distinguish transformed from untransformed bisulfite-treated DNA. HRM is a quantitative PCR technique in which PCR amplicon is directly analyzed by temperature ramping and the release of intercalated fluorescent dyes generated during melting (see, for example, Wojdacz and Dobrovic (2007)). Nucleic Acids Res 35(6): e41). The degree of methylation, expressed as C to T content in the amplicon, determines the speed of melting and the subsequent dye release. This method allows for direct quantification, but assesses methylation in the amplified region as a whole rather than at specific CpG sites.

[0433] Pyrosequencing In some implementations, pyrosequencing (through synthetic sequencing) can be used to analyze bisulfite-treated DNA without using methylation-specific PCR (see, for example, Colella et al. (2003)). BioTechniques 35(1):146-150; Tost et al. (2003) BioTechniques 35(1): 152-156; etc.). The difference between synthetic sequencing and Sanger sequencing is that it utilizes the detection of phosphate release during nucleotide incorporation, rather than the chain termination of dideoxynucleotides. DNA sequences can be determined by the light released during the incorporation of the next complementary nucleotide, based on the fact that typically only one of the four possible A / T / C / G nucleotides is added and available at any given time, thus only one letter can be incorporated into the single-stranded template (which is the sequence to be determined).

[0434] Following PCR amplification of the target region, pyrosequencing can be used to determine the bisulfite-converted sequence of a specific region (e.g., a CpG site). In some embodiments, the C / T ratio at individual sites can be quantified based on the amount of C and T incorporation during sequence extension.

[0435] This improvement in the technique utilizes allele-specific primers that incorporate single nucleotide polymorphisms (SNPs) into the sequence of sequencing primers, thus allowing for separate analysis of maternal and paternal alleles (see, for example, Wong et al. (2006)). BioTechniques 41(6): 734-739). This improvement is particularly suitable for genomic imprinting analysis.

[0436] Base-specific cleavage analysis In some implementations, base-specific cleavage / MALDI-TOF utilizes bisulfite conversion by adding a base-specific cleavage step to increase the information obtained from nucleotide changes (Ehrich et al. (2005)). Proc. Natl. Acad. Sci. USA,102 (44): 15785-15790). RNase A can be used to cleave RNA transcripts at base-specific sites by first transcribing the target region into RNA using in vitro transcription (by adding the RNA polymerase promoter site to the PCR primers in the initial amplification). RNase A specifically cleaves RNA at cytosine and uracil ribonucleotides, and base specificity is achieved by incorporating dTTP for cleavage resistance when cytosine-specific (C-specific) cleavage is required, and dCTP for uracil-specific (U-specific) cleavage is required. The cleaved fragments can then be analyzed by MALDI-TOF or other methods. Bisulfite treatment introduces / removes cleavage sites through C-to-U conversion, or shifts fragment quality through G-to-A conversion in the amplified antisense strand. C-specific cleavage will specifically cut at fully methylated CpG sites. By analyzing the size of the resulting fragments (e.g., using MALDI-TOF, capillary electrophoresis, microchip electrophoresis, etc.), a specific pattern of DNA methylation at CpG sites within a region can be determined, rather than determining the degree of methylation of the region as a whole.

[0437] Methylation-sensitive single-chain conformation analysis (MS-SSCA) Methylation-sensitive single-strand conformation analysis (MS-SSCA) is based on single-strand conformation polymorphism analysis (SSCA) developed for single nucleotide polymorphism (SNP) analysis (Bianco et al. (1999)). Hum. Mutat. 14(4): 289-293). SSCA distinguishes between single-stranded DNA fragments of the same size but different sequences based on differential migration in non-denaturing electrophoresis. In MS-SSCA, this is used to distinguish between regions amplified by PCR with bisulfite treatment containing target CpG sites. Although SSCA lacks sensitivity when only a single nucleotide difference is present, bisulfite treatment often produces many C-to-T conversions in most target regions and produces higher sensitivity. In some embodiments, MS-SSCA can also provide a semi-quantitative analysis of the degree of DNA methylation based on the ratio of band densities. Typically, however, MS-SSCA assesses all CpG sites as a whole in the target region rather than at individual methylation sites.

[0438] methylation target As mentioned above, DNA methylation is important in many cases. In some implementations, the amount of DNA methylation is particularly clinically significant in oncology. Abnormal DNA methylation patterns (hypermethylation and hypomethylation compared to normal tissue) are associated with a large number of human malignancies. Hypermethylation typically occurs in CpG islands in promoter regions and is associated with gene inactivation. Lower levels of leukocyte DNA methylation are associated with many types of cancer (Zhang et al. (2011) Epigenetics, 6(3): 293-299). Overall hypomethylation is also involved in the occurrence and development of cancer through various mechanisms. Typically, there is hypermethylation of tumor suppressor genes and hypomethylation of oncogenes (see, for example, Lund et al. (2004)). J. Biol. Chem. 279(28): 29147-29154).

[0439] In this regard, it was noted that DNA methylation provides a prognostic indicator for stage I non-small cell lung cancer (NSCLC). Specifically, hypermethylation of five genes was found to be significantly associated with shorter recurrence-free survival (RFS) in stage I NSCLC: HIST1H4F , PCDHGB6 , NPBWR1 , ALX1 ,and HOXA9 Patients with high-risk stage I NSCLC can be distinguished from those with low-risk stage I NSCLC based on a signature indicating the number of hypermethylation events (see, for example, Sandoval et al. (2013)). J. Clin. Oncol. ,4140-4147).

[0440] Similarly, malignant gliomas have been observed to possess an inactivated MGMT gene due to methylation of its promoter region. Current research predicts that methylation of the MGMT gene could lead to a better response to chemotherapy (since tumors cannot repair DNA damage induced by alkylating agents). In gliomas, MGMT promoter methylation is a favorable prognostic marker in the presence of radiotherapy or chemotherapy (see, for example, / / neurosurgery.ucsd.edu / brain-tumor-research-mgmt / ).

[0441] To further illustrate this point, Table 3 shows a variety of genes that are hypermethylated in certain cancers.

[0442] Table 3 shows illustrative but non-limiting examples of hypermethylated genes in sporadic cancers (see, for example, Baylin (2005)). Nature Clinical Practice Oncology , 2: S4-S11). In each of the exemplary but non-limiting embodiments, the measurement includes methylation of any one or more of the promoters of the following genes: APC , ARF , CDKN2B , CDKN2A , BRCA1 , VLH , hMLH1 , MGMT. RASSF1A , ADAMTS1 , BNC1 , HIST1H3C , HOXB4 , RASGRF2 , TM6SF1 , AKR1B1 , HIST1H4F , PCDHGB6 , NPBWR1 , ALX1 and HOXA9 .

[0443] pancreatic cancer In some implementations, the methylation state of one or more promoters is determined, and the methylation state at the promoter is a marker of the presence and / or prognosis of pancreatic cancer. ADAMTS1 or BNC1 One or more methylation frequencies can be used to detect and / or stage pancreatic cancer. Therefore, exemplary but non-limiting methylation markers for pancreatic cancer include, but are not limited to, those mentioned above. ADAMTS1 and / or BNC1 Exemplary primers and probes for detecting methylation at the promoters of these genes are shown in Table 4 below (refer to specific sequences in Table 5) and Table 10 in Example 4. In some embodiments, primers and probes are provided for detecting methylation in the forward strand of transformed DNA, and / or for detecting methylation in the reverse strand of transformed DNA.

[0444] Breast cancer In some implementations, the methylation state of one or more promoters is determined, and the methylation state at the promoter is a marker of the presence and / or prognosis of breast cancer. Exemplary methylation markers for breast cancer include, but are not limited to, those mentioned above. RASSF1A and / or AKR1B1 and / or HOXB4 and / or HIST1H3C and / or RASGRF2 and / or TM6SF1 Exemplary primers and probes for detecting methylation at the promoters of these genes are shown in Table 4 below (refer to the specific sequences in Table 5) and Table 9 in Example 4.

[0445] In some implementations, the methylation state of one or more promoters is determined, and the methylation state at the promoter is a marker of the presence or likelihood of lung cancer. Exemplary methylation markers for lung cancer include, but are not limited to, those for lung cancer. CDO1 , SOX17 , TAC1 and / or HOXA7 .

[0446] The methods described herein are not limited to determining the methylation of promoters of these genes. Using the methods described herein, the methylation of virtually any target can be determined.

[0447] However, it should be noted that the measurement of DNA methylation is not limited to the measurement of methylation at CpG islands in promoters. For example, it has been shown that genosome methylation can also alter gene expression and provide therapeutic targets for cancer (see, for example, Yang et al. (2014) Cancer Cell, 26(4): 577-590).

[0448] In addition, DNA methylation measurements have prognostic / therapeutic applications in pathology beyond cancer. For example, abnormal methylation in regions on chromosomes 13, 18, 21, X, and Y can be used to diagnose Down syndrome (see, for example, Patsalis et al. (2012)). Exp. Opin. Biol. Ther. 12(Supplement 1): S155-S161). Because fetal DNA and maternal DNA are differentially methylated, cell-free DNA in maternal plasma can provide a source of fetal DNA, which can be obtained non-invasively and used to assess the methylation status of the aforementioned chromosomes (or other chromosomes or genes).

[0449] As described above, in some embodiments, the cassette and method described herein are also used to determine mRNA levels, for example, to determine the expression of various methyltransferases. In some embodiments, the RNA expression levels of methyltransferases selected from the following are measured: DNMT1 , DNMT2 , DNMT3A , DNMT3B and TNMT3L .

[0450] Primers / probes and multiplexed analysis In various embodiments, the methods described herein can include nested PCR reactions, and the kits described herein can contain reagents (e.g., primers and probes) for such nested PCR reactions. For example, in some embodiments, methylation of one, two, three, four, five, or six genes (gene promoters) is detected. Because bisulfite conversion of DNA changes cytosine residues to uracil, but 5-methylcytosine residues are unaffected, the sense and antisense strands of the converted (bisulfite-converted) DNA are no longer complementary. Therefore, the sense and antisense strands can be probed individually (e.g., in a multiplexed PCR reaction) to provide additional specificity and sensitivity for methylation detection. In such cases, the assay of a single target can include two-way multiplexing, while the assay of two, three, four, five, or six target genes can include four-way, six-way, eight-way, ten-way, or twelve-way multiplexing.

[0451] In some implementations, the assay may be divided into two multiplexed reactions, for example, to independently measure the forward and reverse strands. However, it should be understood that when divided into multiple multiplexed assays, the grouping of assays does not need to be through forward or reverse, but may only include primer / probe sets best suited for specific PCR reaction conditions.

[0452] As described above, by detecting / characterizing the methylation status of the forward and / or reverse strands of cancer-associated gene promoters (or their methylation or absence), various cancers can be identified and / or staged and / or their prognosis determined. Exemplary gene (promoter) targets associated with various cancers are described above and shown in Table 4 below. It should be understood that the methylation (forward and / or reverse strands) of one or more genes shown in Table 4 for various cancers can be determined for cancer identification and / or staging and / or prognosis. In some embodiments, the methylation status of all genes (forward and / or reverse strands) shown for a particular cancer can be determined in a single multiplex PCR reaction.

[0453] Table 4. Exemplary primers and probes for detecting methylation at promoter sites of genes associated with various cancers using the apparatus and methods described herein. Primer and probe numbers refer to the primer / probe numbers (primer / probe num) shown in Table 5 below. Exemplary primers and probes for detecting methylation at promoter sites of various genes are shown in Table 5 below, and in Tables 9 and 10 of Example 4. In some embodiments, these primers and / or probes are particularly suitable for multiplexed amplification.

[0454] Table 5. Exemplary primers and probes for detecting methylation of various gene promoters. Note: Y is C / T; R is A / G; C* is optional functionalization (e.g., to change probe T). m C;T* is optionally functionalized (e.g., to change the probe T). m T; A* ​​is optionally functionalized (e.g., to change the probe T). m A; N* is a nucleotide that is optionally a quencher; dP is a universal pyrimidine; dK is a universal purine. Note that these primers and probes identify the location of each fluorophore and quencher. However, it should be understood that the specific fluorophores and quenchers are illustrative and non-limiting, and many amplification and / or detection strategies can be used in the kits described herein. Therefore, in various embodiments, the methods and apparatus described herein can use many different nucleic acid hybridization probes. Typically, to generate a signal, the probe utilizes a change in the fluorescence of the fluorophore due to a change in the interaction between the fluorophore and another molecule or group, the change in interaction being generated by a change in the distance between the fluorophore and the interacting molecule or group. Alternatively, other methods for detecting polynucleotides in a sample may be included, including but not limited to the use of radiolabeled probes.

[0455] Fluorescence-based measurements typically rely on the generation of fluorescence resonance energy transfer (or "FRET") signals, whereby changes in fluorescence are caused by variations in the distance between the first fluorophore and the interacting resonance energy acceptor or another fluorophore or quencher. The combination of a fluorophore and an interacting molecule or group (including a quencher molecule or group) is called a "FRET pair." The mechanism of FRET pair interaction generally requires the absorption spectrum of one member of the pair to overlap with the emission spectrum of the other member (the first fluorophore). If the interacting molecule or group is a quencher, its absorption spectrum typically overlaps with the emission spectrum of the fluorophore (see, for example, Stryer (1978)). Ann. Rev. Biochem. 47: 819-846; Selvin (1995) Meth. Enzymol. 246: 300-335, etc.). Effective FRET interactions are typically achieved when the absorption and emission spectra of the pair overlap significantly. The efficiency of the FRET interaction is linearly proportional to this overlap. Typically, a large signal (i.e., high overlap) is required. Therefore, FRET pairs, including fluorophore-quencher pairs, are usually selected based on this.

[0456] Many labeled nucleic acid hybridization probes and their detection methods using FRET and FRET pairs are known. One such protocol is described in Cardullo et al. (1988). Proc. Natl. Acad. Sci. USA In references 85: 8790-8794 and Heller et al. EP 0070685, the probes used contain oligodeoxynucleotide pairs complementary to consecutive regions of the target DNA strand. One probe molecule contains a fluorescent label—a fluorophore—at its 5' end, and another probe molecule contains a different fluorescent label—also a fluorophore—at its 3' end. When the probes hybridize to the target sequence, the two labels are very close to each other. When the sample is stimulated with light of an appropriate frequency, a fluorescence resonance energy transfer (FRET) occurs from one label to the other. FRET produces a measurable change in the spectral response from the label, which is a signal of the target's presence. A label can be a "quencher," which in particular can be an interacting group (or molecule) that releases energy accepted as heat.

[0457] Another type of nucleic acid hybridization probe assay utilizing FRET pairs is the "TaqMan®" assay, as described in U.S. Patent No. 5,210,015 to Gelfand et al. and U.S. Patent No. 5,538,848 to Livak et al. The probe is typically a single-stranded oligonucleotide labeled with a FRET pair. In the TaqMan® assay, a DNA polymerase releases one or more nucleotides by cleaving the oligonucleotide probe as it hybridizes with the target strand. This release provides a way to separate the quencher label and the fluorophore label of the FRET pair.

[0458] In some embodiments, non-FRET fluorescent probes, such as those described in U.S. Patent No. 6,150,097 to Tyagi et al., may also be used. For example, the patent by Tyagi et al. describes how a change in the absorption spectrum of a label pair can be used as a detectable signal, as a substitute for a change in fluorescence. When utilizing changes in absorption, the label pair may include any two chromophores, namely a fluorophore, a quencher, and other chromophores. The label pair may even be the same chromophore.

[0459] In some embodiments, dyes and other groups (e.g., quenchers) are introduced into primers and / or probes used in the methods and kits described herein. In some embodiments, such dyes and quenchers include, but are not limited to, dyes (fluorophores) suitable for use as FRET probes. In some embodiments, the dyes and / or quenchers comprise modified nucleotides. "Modified nucleotides" refers to nucleotides that have been chemically modified but still function as nucleotides. In some embodiments, the modified nucleotides have covalently linked chemical groups (e.g., dyes or quenchers) and can be introduced into polynucleotides, for example, through solid-phase synthesis of polynucleotides. In some embodiments, the modified nucleotides comprise one or more reactive groups that can react with the dye or quencher before, during, or after the incorporation of the modified nucleotide into a nucleic acid. In some embodiments, the modified nucleotides are amine-modified nucleotides, i.e., nucleotides that have been modified to have reactive amino groups. In some embodiments, the modified nucleotides comprise modified base moieties, such as uridine, adenosine, guanosine, and / or cytidine. In some embodiments, the amine-modified nucleotide is selected from 5-(3-aminoallyl)-UTP, 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP, N6-(4-amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-oxy-di-(ethylamine)]-CTP, N6-(6-amino)hexyl-ATP, 8-[(6-amino)hexyl]-amino-ATP, 5-propynylamino-CTP, and 5-propynylamino-UTP. In some embodiments, nucleotides with different nucleobase moieties are similarly modified, for example, 5-(3-aminoallyl)-UTP is replaced with 5-(3-aminoallyl)-GTP. Many amine-modified nucleotides are commercially available and can be obtained from, for example, Applied Biosystems, Sigma, JenaBioscience, and TriLink. An illustrative but non-limiting list of suitable fluorophores is presented in Table 6.

[0460] Table 6. Illustrative but non-limiting fluorophores (fluorescent markers) used for the primers and / or probes described herein. If an assay is designed to detect a target DNA sequence, only one fluorescent hybridization probe is required. In some implementations, FAM, TET, or HEX (or one of their alternatives listed in Table 7) will be good fluorophores for labeling the probe. These fluorophores are readily excited and detected in various spectrofluorescence assay thermal cyclers. Furthermore, due to the availability of phosphoramide derivatives of these fluorophores and the availability of control-well glass columns linked to quenchers, fluorescent hybridization probes with these labels can be synthesized entirely in automated DNA synthesis processes, offering the advantages of relatively inexpensive and relatively labor-saving probe preparation.

[0461] Table 7. Additional illustrative fluorophore markers for use in fluorescent hybridization probes In some embodiments, multiple target genes are detected in a single multiplex reaction. In some embodiments, each probe targeting a different gene is spectrally distinguishable (detectably different) from other probes used in the multiplex reaction. Probe combinations suitable for multiplex detection are known to those skilled in the art. For example, illustrative combinations of detectably different fluorophores in a four-target multiplex system include, but are not limited to: 1) FAM, TMR, Texas Red and Cy5; 2) FAM, TET, TMR and Texas Red; 3) FAM, HEX, Texas Red and Cy5; and 4) FAM, Cy3, Texas Red and Cy5.

[0462] Illustrative combinations of different fluorophores detectable in a five-target multiplexer include FAM, TET, TMR, Texas Red, and Cy5. Illustrative combinations of different fluorophores detectable in a six-target multiplexer include, but are not limited to: 1) FAM, TET, HEX, TMR, ROX, and Texas Red; and 2) FAM, HEX, LC Red 610, LC Red 640, LC Red 670 and LC Red 705.

[0463] It should be understood that the compositions of these fluorophores are illustrative and non-limiting, and many other fluorophores will be available to those skilled in the art.

[0464] As mentioned above, to design fluorescent hybridization probes utilizing fluorescence resonance energy transfer (FRET), fluorophore-quencher pairs with sufficient spectral overlap should be selected. Fluorestyloses with emission maxima of 500 to 550 nm (e.g., FAM, TET, and HEX) are optimally quenched by quenchers with absorption maxima of 450 to 550 nm (e.g., dabcyl, BHQ-1, etc.) (see, for example, illustrative quencher labels in Table 8). Fluorestyloses with emission maxima above 550 nm (e.g., rhodamine) (including TMR, ROX, and Texas Red) and Cy dyes (including Cy3 and Cy5) are effectively quenched by quenchers with absorption maxima above 550 nm (including BHQ-2).

[0465] To design fluorescent hybridization probes that utilize contact quenching, any non-fluorescent quencher can act as a good acceptor of energy from the fluorophore. For example, Cy3 and Cy5 are effectively quenched by BHQ-1 and BHQ-2 quenchers.

[0466] Table 8. Illustrative quencher markers for fluorescent hybridization probes In some implementations, nucleotides can quench the fluorescence of a fluorophore, with guanosine being the most effective quencher, followed by adenosine, cytidine, and thymidine. Typically, fluorophores with excitation wavelengths of 500 to 550 nm are more effectively quenched by nucleotides with longer excitation wavelengths than the fluorophore. When designing fluorescent hybridization probes, it is necessary to avoid placing the fluorophore label directly next to uridine to ensure a higher fluorescence signal from the fluorophore.

[0467] The stabilizing effect of some fluorophore-quencher interactions through contact quenching can have a significant impact on the design of hybridization probes (see, for example, Marras et al. (2002)). Nucleic Acids Res. 30: e122; Johansson et al. (2002) J. Am. Chem. Soc (124: 6950-6956). For example, hybridization probes labeled with fluorophores quenched by BHQ-1 or BHQ-2 have been observed to show an increase in hybridization melting temperature of approximately 4 °C compared to hybridization probes with the same probe sequence but labeled with fluorophores quenched by dabcyl. Strong affinity has also been observed between Cy dyes Cy3 and Cy5 and Black Hole quenchers BHQ-1 and BHQ-2.

[0468] In view of the foregoing description and the embodiments and teachings provided herein, a variety of primer / probe combinations are available for use in the methods and kits described herein.

[0469] Kits, modules, and systems for DNA methylation analysis In some embodiments, a cartridge is provided for performing the methods described herein (e.g., determining DNA methylation and optionally RNA expression). In some embodiments, the cartridge includes a column containing a first matrix material, a sample receiving chamber, a temperature-controlled channel or chamber, multiple chambers containing reagents and / or buffers, and in use, at least one of the chambers contains a DNA transformation reagent (e.g., DABSO and / or bisulfite reagent), and at least one of the chambers contains a desulfonate / elution buffer, and wherein the cartridge optionally includes a second column containing the second matrix material. In some embodiments, the cartridge is configured such that, in use, the cartridge includes a chamber containing a reagent including guanidinium thiocyanate ethanol (GTC-EtOH). In some embodiments, the second column is absent, while in other embodiments, the second column is present. In some embodiments, the temperature-controlled channel or chamber may be only a heating channel or chamber, or it may be a thermal cycling channel or chamber. In some embodiments, the cartridge further includes a second heating channel or chamber (e.g., a second thermal cycling channel or chamber). In some embodiments, the cassette is configured such that DNA transformation steps (e.g., bisulfite incubation) and / or desulfonation steps occur in the same reaction tube or chamber, in which one or more PCR reactions are subsequently performed.

[0470] In some embodiments, the bisulfite reagent is provided as a component of the cartridge. In some other embodiments, the cartridge is configured for the bisulfite reagent to be added when or near the time a sample is placed in the cartridge. In some cases, the bisulfite reagent is added directly to a chamber within the cartridge, while in other embodiments, the bisulfite reagent is introduced into the cartridge via a sample dispensing port (e.g., an injection port). In some embodiments, the bisulfite reagent is introduced into the cartridge via a system (e.g., a processing module) that operates the cartridge while simultaneously operating the cartridge to determine DNA methylation.

[0471] In some embodiments, a reagent containing guanidine thiocyanate (e.g., GTC-EtOH) is provided as a component of the cartridge. In some embodiments, the cartridge is configured for the guanidine thiocyanate-containing reagent to be added when or near the time a sample is placed in the cartridge. In some cases, the guanidine thiocyanate-containing reagent is added directly to a chamber in the cartridge, while in other embodiments, the guanidine thiocyanate-containing reagent is introduced into a sample dispensing port (e.g., an injection port) on the cartridge to introduce bisulfite reagent into the cartridge. In some embodiments, the guanidine thiocyanate-containing reagent is introduced into the cartridge by operating a system (e.g., a processing module) simultaneously with operating the cartridge to determine DNA methylation.

[0472] In various illustrative but non-limiting embodiments, the conversion reagent (e.g., a bisulfite reagent) comprises a compound selected from sodium metabisulfite, potassium bisulfite, cesium bisulfite, DABSO, and ammonium bisulfite. In some embodiments, the bisulfite is provided in a reagent mixture comprising a scavenger (e.g., Trolox and hydroquinone) and / or a catalyst to prevent sulfite oxidation. In some embodiments, the bisulfite is provided in a reagent mixture comprising a polyamine as a catalyst.

[0473] In various embodiments, when the first matrix material and / or the second matrix material are present, they include materials selected from glass or silica, ion exchange resins and hydroxyapatite.

[0474] In various embodiments, the box includes one or more chambers (e.g., 1 chamber, 2 chambers, 3 chambers, 4 chambers, etc.), each chamber containing one or more reagents selected from methylation-specific PCR primers, methylation-specific PCR probes, PCR enzymes (e.g., polymerases), reverse transcriptases, and PCR reaction buffers.

[0475] In some embodiments, the cartridge includes one or more chambers containing primers specifically targeting methylated and / or unmethylated sequences converted to bisulfite. In some embodiments, the cartridge includes one or more chambers containing primers and probes for the MethyLight PCR protocol. In some embodiments, the cartridge includes one or more chambers containing TaqMan PCR reaction reagents. In some embodiments, the cartridge includes one or more chambers containing one or more fluorescent probes labeling amplified methylated sequences and / or one or more fluorescent probes labeling amplified unmethylated sequences. In some embodiments, the probe contains a fluorescent reporter dye and a quencher dye, at which the probe provides a signal upon cleavage by the 5' to 3' nuclease activity of Taq DNA polymerase. In some embodiments, the cartridge includes multiple probes, each specifically targeting a different methylated region within the target amplification region. In some embodiments, the cartridge includes a single probe specifically targeting a methylated region within the target amplification region. In some embodiments, the cartridge includes multiple probes, each specifically targeting the same methylated region within the target amplification region.

[0476] Explanatory primers and probes include, but are not limited to, primers and / or probes for determining methylation of promoter regions selected from the following genes: APC , ARF , CDKN2B , CDKN2A , BRCA1 , VLH , hMLH1 , MGMT. RASSF1A , ADAMTS1 , BNC1 , HIST1H3C , HOXB4 , RASGRF2 , TM6SF1 , AKR1B1 , HIST1H4F , PCDHGB6 , NPBWR1 , ALX1 and HOXA9 In some implementations, primers and / or probes are selected to determine methylation of promoter regions selected from genes including: MGMT , RASSF1A , ADAMTS1 , BNC1 , HIST1H3C , HOXB4 , RASGRF2 , TM6SF1 and AKR1B1 In various embodiments, PCR primers and / or probes and / or enzymes are provided as beads, such as those described in U.S. Patent Publication No. 2006 / 0068399, which is incorporated herein by reference for the beads and bead formulations described therein.

[0477] In various embodiments, the housing is configured such that the sample receiving chamber, the column, the plurality of chambers, and the temperature control channel or chamber are selectively in fluid communication. In some embodiments, selective fluid communication is provided via microfluidic channels and valves. In some embodiments, selective fluid communication is provided by providing sample receiving chambers, the column, the plurality of chambers, the thermal channel or chamber, or ports into the thermal channel or chamber, arranged around a central valve and selectively in fluid communication with channels in the central valve.

[0478] In some embodiments, the cartridge is configured such that, when in use, it comprises: a first compartment containing a sample; a second compartment containing a guanidine thiosulfate-ethanol (GTC-EtOH) solution; a third compartment containing a bisulfite reagent; a fourth compartment containing a buffer solution; a fifth compartment containing a washing solution; and a sixth compartment containing an elution / desulfonate reagent. In some embodiments, the cartridge includes a seventh compartment containing PCR primers and / or probes and / or PCR enzymes. In some embodiments, the cartridge includes an eighth compartment that also contains PCR primers and / or probes and / or PCR enzymes.

[0479] Figure 1A , 1B Sections 2 and 3 illustrate a box suitable for implementing the methods described herein. The box described is based on the GENEXPERT® box (Cepheid, Inc., Sunnyvale, CA). Figure 2As shown in Part A, the cartridge 200 includes a cartridge body 202 containing a plurality of reagent and / or buffer chambers 208. These chambers are arranged around a central syringe 206, which is connected to a valve body 210 (Part B and...). Figure 1B The cartridge 206 is in fluid communication and sealed with a gasket 204. The valve body 210 may include a cap 212, and the entire cartridge may be supported on a cartridge base 226. An operable plunger (not shown) introduces fluid into the syringe 206, and rotation of the syringe 206 and the connected valve body 212 provides selective fluid communication between chamber 208 and cavity 214, which may contain the matrix material described herein and function as a column. In various embodiments, the cartridge also includes one or more temperature-controlled channels or chambers 216, which in some embodiments can function as thermal circulation chambers. The temperature-controlled channels or chambers are also selectively in fluid communication with cavity 214 and / or chamber 208. Figure 1A As shown, in some embodiments, the box provides an optical window to provide real-time detection of, for example, amplification products, base identity during sequencing operations, etc.

[0480] In some implementations, the configuration box 200 is inserted into the reaction module 300, for example... Figure 3A As shown. Figure 3B As described herein, the module is configured to receive cartridge 200. In some embodiments, the reaction module provides a heating plate 308 to heat a temperature-controlled chamber or channel. When the temperature-controlled channel or chamber is a thermally circulating channel or chamber, the module may optionally also include a fan 304 to provide cooling. Electronic circuitry 302 may be provided to transmit information (e.g., optical information) to a computer for analysis. In some embodiments, the module may include an optical block 306 to provide excitation and / or detection of one or more (e.g., 1, 2, 3, 4, or more) optical signals representing, for example, multiple nucleic acid targets. In various embodiments, an electrical connector 312 may be provided for interconnecting the module with a system (e.g., a system controller) or with a separate analysis / controller unit. Figure 3B As explained, the sample can be introduced into the box using a pipette 310.

[0481] In some implementations, the module also includes a controller for rotating the plunger and valve body in the syringe.

[0482] In some implementations, a system (e.g., a processing unit) is provided. An illustrative but non-limiting implementation is shown below. Figure 3CIn some embodiments, the processing unit includes an accessory configured to contain one or more sample processing modules, each configured to hold and operate the removable cartridges described herein. In some embodiments, the system is configured to operate the sample processing modules to process samples within a respective removable sample cartridge to determine the methylation of one or more target nucleic acids and optionally to determine the levels of one or more target RNA / DNA sequences, wherein the processing of samples within the respective removable sample cartridges is performed according to the methods described herein. In some embodiments, the system is configured to contain one sample processing module. In some embodiments, the system is configured to contain at least two sample processing modules, or at least four sample processing modules, or at least eight sample processing modules, or at least twelve sample processing modules, or at least sixteen sample processing modules, or at least twenty sample processing modules, or at least twenty-four sample processing modules, or at least twenty-eight sample processing modules, or at least thirty-two sample processing modules, or at least sixty-four sample processing modules, or at least twelve-eight sample processing modules. In some implementations, the system provides a user interface that allows users to input operating instructions and / or the operation of the monitoring kit to determine DNA methylation.

[0483] Although the methods described herein are primarily for Cepheid Inc.'s (Sunnyvale, CA) GENEXPERT® box (see, for example...), Figure 1A It should be understood that, based on the teachings provided herein, the methods described can be implemented on other box / microfluidic systems. Such box / microfluidic systems may include, for example, microfluidic systems implemented using soft lithography, fabricated microfluidic systems implemented using hard lithography, and so on.

[0484] High Volume Sample Preparation (HVSP) Kit In various embodiments, a cassette for preparing large sample volumes is provided. In some embodiments, the sample preparation cassette includes a GENEXPERT® cassette modified for high-volume sample preparation (e.g., as shown in Figure 20). In some embodiments, such as when the cassette is based on a GENEXPERT® cassette, it includes one or more channels or chambers containing an affinity matrix for binding DNA, a plurality of chambers arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chambers in fluid communication with the central valve, wherein the plurality of chambers includes at least two distinct chambers configured to receive up to about 4 mL (or up to about 5 mL) of sample solution (in some embodiments, the maximum volume of chamber 2 is about 4 mL and the maximum volume of chamber 3 is about 4.5 mL), a chamber containing PEG (e.g., PEG200), a chamber containing an alkaline solution (e.g., KOH solution), and a chamber containing a buffer solution (e.g., Tris). In some embodiments, the multiple chambers include at least three distinct chambers, each configured to receive up to about 4 mL (or up to about 5 mL) of sample solution. In some embodiments, the multiple chambers include a chamber containing a washing solution (e.g., a GTC-ethanol washing solution, typically 1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol). In some embodiments, the cartridge includes a chamber configured for removing processed samples. In some embodiments, the sample chamber, when used, contains a sample solution, GTC, and an alcohol (e.g., isopropanol). In some embodiments, the sample chamber, when used, contains substantially equal volumes of sample solution, GTC, and alcohol. In some embodiments, the cartridge, when used, contains 4 mL of sample solution, GTC, and isopropanol, which is placed in each of the chambers configured to receive the sample. In some embodiments, the cartridge provides DNA or RNA recovery that is substantially linear relative to a sample volume of 0.5 mL to about 4 mL.

[0485] In some embodiments, the HVSP box is configured to perform DNA transformation (e.g., bisulfite transformation) to provide methylation analysis. Therefore, in some embodiments, the HVSP box is configured to contain or receive transformation reagents (e.g., bisulfite reagent, DABSO, etc.) immediately or shortly before use. In some embodiments, the HVSP box may be configured to also contain and provide a reagent for and to transform DNA by desulfonation. Alternatively, in some embodiments, transformation is performed in the HSVP box, while desulfonation and methylation analysis (e.g., PCR) are performed in a second box (e.g., as shown in the image). Figure 20B (As illustrated in the operation flowchart shown).

[0486] cfDNA sample preparation kit In some embodiments, a sample preparation kit is provided, which is particularly suitable for preparing nucleic acids (and optionally analyzing them) from plasma or serum. An illustrative but non-limiting embodiment is shown below. Figure 17 In some embodiments, the cartridge includes channels or chambers containing an affinity matrix for binding DNA, a plurality of chambers arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chambers in fluid communication with the central valve, wherein the plurality of chambers include: a chamber configured to receive up to about 5 mL or up to about 4 mL of sample solution; a chamber containing PEG (e.g., PEG200); a chamber containing GTC-EtOH; a chamber containing an alkaline solution (e.g., KOH solution); and a chamber containing a buffer solution (e.g., Tris). In some embodiments, the plurality of chambers further include a chamber containing a conversion reagent (e.g., bisulfite reagent). In some embodiments, the plurality of chambers include a chamber containing a washing solution (e.g., GTC-ethanol washing solution (typically 1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol)). In some embodiments, the plurality of chambers includes a chamber containing beads, the beads containing one or more PCR primers and / or probes. In some embodiments, the chamber containing PEG contains about 1 mL of PEG. In some embodiments, the chamber containing an alkaline solution contains about 500 µL of solution. In some embodiments, the chamber containing GTC-EtOH contains about 2 mL of GTC-EtOH. In some embodiments, the chamber containing a buffer contains about 2 mL of buffer.

[0487] It should be understood that this configuration is illustrative, and many other preparation box configurations are available to those skilled in the art using the teachings provided herein.

[0488] Uses of DABSO as a substitute for bisulfite Surprisingly, DABSO has been found to be usable for DNA transformation in a manner similar to that used for DNA transformation and methylation detection with bisulfite. Therefore, in some embodiments, a method is provided for using DABSO to convert cytosine residues in DNA to uracil while leaving 5-methylcytosine residues substantially unaffected. In some embodiments, the method includes contacting a sample containing DNA with DABSO to transform the DNA, and desulfonating the transformed DNA to produce DNA in which cytosine residues are converted to uracil, but 5-methylcytosine residues are substantially unaffected. In some embodiments, DABSO is provided at a concentration of about 2 M to up to about 5 M. In some embodiments, DABSO is provided at a concentration of about 2.5 M. In some embodiments, DABSO is dissolved in an alkaline aqueous solution (e.g., KOH solution). In some embodiments, the reagent containing DABSO comprises DABSO dissolved in a KOH-containing solution.

[0489] In some embodiments, the method includes heating the DABSO / DNA solution to a temperature of about 55°C to about 90°C. In some embodiments, the DABSO is reacted with the DNA for about 15 minutes to a maximum of about 90 minutes. After the DNA is transformed, it is desulfonated (e.g., by contacting the transformed DNA with an alkaline reagent (e.g., KOH solution)). In some embodiments, the DNA bound to the column is transformed and / or desulfonated, while in other embodiments, the DNA in solution is transformed and / or desulfonated.

[0490] Methods for analyzing DNA methylation are also provided, wherein the methods include providing a DNA sample, transforming the DNA in the sample using a DABSO reagent (e.g., as described above), and performing methylation-specific PCR and / or nucleic acid sequencing, and / or performing high-resolution melting analysis (HRM) on the transformed nucleic acid to determine the methylation of the nucleic acid. In some embodiments, providing a DNA sample includes preparing the sample as described herein (e.g., using a lysis buffer and / or preparation kit, as described herein).

[0491] Reagent test kit Kits for methylation detection In some embodiments, a kit is provided for performing the methods described herein. In one illustrative embodiment, the kit includes a container containing the reaction cartridge described herein, a container containing the sample processing reagent described herein, and a container containing the conversion reagent described herein (e.g., bisulfite reagent). In some embodiments, the bisulfite reagent is provided in a chamber of the cartridge. In some embodiments, the bisulfite reagent is provided in a container separate from the cartridge. In some embodiments, the sample processing reagent is provided in a chamber of the cartridge. In some embodiments, particularly when the sample processing reagent comprises guanidine thiocyanate, the sample processing reagent is provided in a container separate from the cartridge.

[0492] In addition, the kit optionally includes labeling and / or guidance materials to provide guidance (i.e., protocols) for using the kit described herein to determine DNA methylation and optionally RNA expression.

[0493] In some embodiments, a kit for determining DNA methylation is provided, wherein the kit includes a container containing a cassette as described herein for determining the methylation state of nucleic acids. In some embodiments, the kit further includes lysis solutions as described herein (e.g., lysis solutions for serum or plasma, as described in Table 11, and / or lysis solutions for FFPE samples, as described in Table 12). In some embodiments, the kit includes a container containing proteinase K. In some embodiments, the kit contains a conversion reagent (e.g., a bisulfite reagent) in the cassette or in a separate container from the cassette. In some embodiments, the separate container may contain a predicted volume of conversion reagent suitable for one “run” of the cassette. In some embodiments, the conversion reagent includes a compound selected from sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and DABSO. In some embodiments, the kit includes a container containing a sample processing reagent. In some embodiments, the sample processing reagent includes guanidine thiocyanate and / or ethanol.

[0494] In various embodiments, the kit may additionally include a cassette for sample preparation as described herein (e.g., illustrated in Figure 20).

[0495] In some embodiments, the kit includes instructional materials teaching how to use the kit to determine DNA methylation. When the kit includes a sample preparation kit, it may additionally include instructional materials teaching the use and operation of the sample preparation kit.

[0496] Kit for DABSO DNA Transformation and Methylation Detection In some embodiments, a kit is provided for using DABSO as a conversion reagent, for example, in the detection of DNA methylation status. In some embodiments, the kit includes a container containing the conversion reagent (containing DABSO) and a container containing a desulfonate reagent. In some embodiments, the kit includes a column containing an affinity matrix (e.g., a silica matrix material). In some embodiments, the kit includes a container containing a binding buffer and / or a container containing an elution buffer. In some embodiments, the kit includes a container containing a wash buffer.

[0497] In some embodiments, the kit further includes lysis solutions described herein (e.g., lysis solutions for serum or plasma, as described in Table 11, and / or lysis solutions for FFPE samples, as described in Table 12). In some embodiments, the kit includes a container containing proteinase K.

[0498] In various embodiments, the kit may additionally include a cassette for sample preparation as described herein (e.g., illustrated in Figure 20).

[0499] In some embodiments, the kit includes instructional material that teaches how to use the kit to transform nucleic acids in order to determine the methylation status of the nucleic acids.

[0500] While the instruction materials in the aforementioned kits typically include handwritten or printed materials, they are not limited to these. Any medium capable of storing these instructions and conveying them to the end user is included in this invention. Such media include, but are not limited to, electronic storage media (e.g., disks, magnetic tapes, cartridges, chips), optical media (e.g., CD-ROMs), etc. Such media may include the address of the website providing the instruction materials.

[0501] Example The following embodiments are provided for illustration, but are not intended to limit the claimed invention.

[0502] Example 1 To validate the method, human genomic DNA (HGDNA) was used as the starting sample to monitor sample preparation, bisulfite conversion, sample clearance, and methylation-specific qPCR within the CepheidGENEXPERT® cassette. To measure bisulfite conversion efficiency, half of the DNA-bisulfite mixture was loaded into a 50 µL cassette tube and heated during the bisulfite conversion step. Therefore, under optimal conversion conditions, approximately half of the HGDNA was converted, while the other half remained unconverted.

[0503] For an untransformed gene ( HMBS(hydroxymethylcholestane synthase housekeeping gene) and a transformed gene ( ACTB (β-actin) Primers and Taqman probes were designed for the qPCR step, and then the transformation efficiency was quantified by comparing the cycle threshold (Ct). ACTB and HMBS These are typically used as single-copy or low-copy reference genes, so the inventors anticipated a similar copy number per ng HGDNA.

[0504] A representative GENEXPERT® run from 300 ng HGDNA is shown below. Figure 5 In the diagram, the ACTB qPCR curve is shown in green, and the HMBS qPCR curve is shown in blue. The qPCR reaction was run for 45 cycles, with one cycle at three temperatures: 96°C for 5 seconds, 60°C for 15 seconds, and 72°C for 15 seconds. At a manual threshold setting of 20 fluorescent units, the inventors observed a Ct of 31.7 for the transformed ACTB gene and 32.7 for the untransformed HMBS gene. Importantly, these results demonstrate that we can achieve near-optimal bisulfite conversion efficiency of HGDNA in our kit at physiologically relevant concentrations of DNA present in FFPE tissue sections and plasma / serum samples. Further specificity of the fully transformed sequence can be achieved via nested qPCR or by heating the intact sample. However, neither of these methods is absolutely necessary for methylation-specific qPCR in GENEXPERT®, as the designed primer and probe sets only amplify the transformed sequence. Therefore, the remaining untransformed DNA sequence serves as vector DNA, which is frequently added, particularly during bisulfite conversion, DNA isolation, and PCR procedures.

[0505] Example 2 Figure 6A and 6B The linearity of the transformed ACTB is shown. Specifically, Figure 6A The results of nested qPCR using hgDNA and ACTB for 15 cycles are shown. As can be seen from the right-hand plot, the signal (Ct value) is substantially linear between approximately 25,000 copies and approximately 100 copies. Figure 6B The results of nested qPCR using hgDNA and ACTB for 20 cycles are shown. These figures demonstrate the sensitivity of the cassette to hgDNA. Dropout begins at approximately 20–50 copies, with sensitivity around 25 copies of transformed DNA.

[0506] Figure 7A , 7BThe results of qPCR for six methylation targets (AKR1B1, HOXB4, TM6SF1, RASGRF2, and RASSF1A) are shown in Figure 7C. Figure 7A Nested qPCR for 20 cycles of control is shown (25 ng HSDNA and 5000 DNA-unconverted MBA-453 cells). Figure 7B The results of 20 cycles of nested PCR using DNA from MBA-453 cells that had been converted to bisulfite are shown. Strong signals for all targets are shown. HIST1H3C was not reliably detected. Figure 7C The results of nested qPCR for 20 cycles using DNA from MBA-453 cells that had been converted to bisulfite and contained in a vector containing 1 µg SS and 10 ng HS DNA are shown. Decreases were observed at approximately 100 cells or less; however, significantly fewer decreases were observed when using the vector.

[0507] Example 3 Figure 8 The results of the conversion efficiency measurements are presented. The difference in conversion efficiency between unconverted HMBS and converted ACTB is approximately 66% (~1 Ct). The ideal Ct for 100% binding / elution, 100% conversion, and 100% binding / elution is approximately 24-25. For a 10-fold reduction, experiments appear to show Ct of approximately 27 for 50% binding / elution, 50-66% conversion, and 50% binding / elution.

[0508] Figure 9 This demonstrates an increase in the specificity of transformed DNA produced by nested qPCR. Nested PCR appears to increase the specificity of transformed DNA, increase the specificity of methylated DNA, and reduce contamination issues.

[0509] Figure 10 This illustrates the specificity of the methylation cassette. Specificity is not shown for unconverted DNA (top) or unmethylated DNA (bottom), except for HIST1H3C.

[0510] Figure 11 Some illustrative but nonspecific flowcharts are shown for methylation analysis using a cartridge (such as the GENEXPERT® cartridge). Figure 11 The first line describes a procedure for analyzing DNA methylation in serum samples. As illustrated in the flowchart, serum is added to the lysis reagent vial and mixed / vortexed. The sample is then dispensed into the sample port of the cartridge. The cartridge is placed in the system for analysis.

[0511] Figure 11 The second line describes a procedure for analyzing DNA methylation in tissue sections (e.g., frozen or formalin-fixed paraffin-embedded (FFPE) sections). As shown in the figure, in one embodiment, a tissue section (e.g., a 4 µm FFPE section) is provided. FFPE lysis reagent is added (see, for example, the illustrative lysis reagent in PCT / US2013 / 061863 (WO / 2014 / 052551), and the mixture is heated. Ethanol may be added, and the mixture is vortexed. The sample is then dispensed into the sample port in the cartridge. The cartridge is placed in the system for analysis.

[0512] Figure 12 The results illustrate the effects of transformed ALU and methylated RASSF1A on the FFPE cell button.

[0513] Example 4 Marker detection for breast cancer surveillance Materials and methods Add 1000 MBA-453 cells or 25 ng of human semen (HS) DNA to 2.5 mL of binding buffer (2.25 M guanidine thiocyanate, 22.5 mM Tris pH 7.0, 0.5% Tween 20, 50% ethanol, and 0.005% SE-15 antifoaming agent). Add 2.5 mL of cell solution or DNA to chamber 2 of the Cepheid methylation cassette ( Figure 13A The remaining compartments in the methylation box are filled as follows: Compartment 3 – 3.2 mL wash buffer (1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol); Compartment 4 – 90 µL 7 M ammonium bisulfite; Compartment 5 – 4 mL 50 mM Tris pH 8.5; Compartment 8 – 1 mL PEG200 Rinse; Compartment 9 – Quantitative PCR beads containing EZR (Taq) and TSR (a six-target breast cancer multiplexer targeting RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1, see Table 9 below); Compartment 10 – 500 µL 15 mMMKOH; and Compartment 11 – Nested beads containing EZR (Taq) and TSR (a six-target breast cancer multiplexer targeting RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1). The methylation cassette was then loaded into Cepheid GeneXpert and the entire methylation assay was performed via GeneXpert—first DNA sample preparation, bisulfite conversion, second post-conversion DNA sample preparation, desulfonation, and 20 cycles of nested and quantitative PCR reactions.

[0514] A flowchart illustrating the methylation scheme is shown below. Figure 13B Note that PEG200 is added to the waste liquid chamber 8, and is also dispensed into chamber 1 after the assay begins. PEG200 is a viscous liquid, which is not easily loaded directly into the smaller chamber 1. Furthermore, chamber 1 functions as an air chamber during the initial loading of the cartridge before becoming the PEG200 chamber. Therefore, at the start of the assay, chamber 1 = air and chamber 8 = PEG200, rapidly changing to chamber 1 = PEG200 and chamber 8 = waste liquid after cartridge loading.

[0515] Figure 13A The numbers shown in the "Initial Volume" column refer only to liquid volume. In this case, chamber 11 contains only 2x beads—1x TCR bead (primers and probes for 6 targets) and 1x EZR bead (Phoenix Taq). These beads are used for the final qPCR reaction. Similarly, chamber 9 contains 3x beads—1x TSR bead (primers for 6 targets), 1x Tris bead (to quench KOH), and 1x EZR bead (Phoenix Taq). These beads are used for the first 15-20 cycles of PCR reaction.

[0516] It is also noted that chamber 6 is an air chamber throughout the assay and is never filled. Chamber 7 is partially used as an inlet to the PCR tubes at the back of the box. It is not filled at the start of the assay, but is filled during the assay in three ways before being loaded into the tubes: 1) for a DNA-bisulfite mixture heated in the tube for transformation; 2) for 15-20 cycles of PCR reaction; and 3) for the final qPCR reaction.

[0517] The primers provided in Table 9 show five sequences for each gene—two extension primers and two qPCR primers, along with one probe. The first 15–20 cycles of PCR are not specifically targeted at methylation, but only at the transformed DNA sequences (i.e., those that do not pass through CpG; when they do pass through CpG, we use R=purine or Y=pyrimidine to capture both methylated and unmethylated sequences simultaneously). The second 45 cycles of qPCR contain primers and probes specifically targeting typically 2–3 methylated CpG sequences.

[0518] result Use with and without bisulfite ( Figure 15A 1000 MBA-453 cells and 25 ng of HS DNA containing bisulfite ( Figure 15BThe methylation cassette was run to methylate the cells and HS DNA, which were predominantly unmethylated at the promoters of the genes (except for HIST1H3C). In control reactions using HS DNA without bisulfite or unmethylated DNA, there was little or no amplification of the target. Figure 15A , 15B After the addition of bisulfite, high levels of methylation were detected in the methylation cassette at multiple gene promoters (specifically AKR1B1, RASSF1A, HOXB4, and RASGRF2) in 1000 MBA-453 cells.

[0519] Table 9. RASSF1A , AKR1B1 , HOXB4 , HIST1H3C , RASGRF2 and TM6SF1 Nested primers. C* and T* are optionally functionalized (e.g., to modify probe T). m The bases of ). The primers shown in Table 9 are illustrative and non-limiting. Many other primers and nested primer sets are available to those skilled in the art. For example, those used for detecting pancreatic cancer-related... ADAMTS1 and BNC1 Gene methylation and its use in detecting glioma-related diseases MGMT Illustrative primers for gene methylation are shown in Table 10.

[0520] Table 10. Detection of pancreatic cancer-related diseases ADAMTS1 and BNC1 Gene methylation and its use in detecting glioma-related diseases MGMT Illustrative primers for gene methylation Example 5 Sample preparation of plasma and FFPE samples Figure 17 The construction of a cartridge for preparing DNA samples for PCR and / or methylation detection is described. Samples obtained from serum or plasma, or FFPE samples, can be simply introduced into the sample chamber (e.g., chamber 3) of the cartridge, and the operation of the cartridge as described herein provides for the preparation of samples for PCR and / or methylation detection.

[0521] Sample preparation In one illustrative but non-limiting embodiment, a serum or plasma sample (e.g., for cfDNA analysis) is prepared by treating serum or plasma with proteinase K. The proteinase K-treated serum / plasma is then mixed with a lysis buffer comprising guanidine thiocyanate (GTC), a buffer (e.g., Tris pH 7.0), a detergent (e.g., Tween 20), and optionally an antifoaming agent (e.g., antifoaming agent SE15). An alcohol (e.g., isopropanol) is added to the solution, and the solution is then introduced into a cartridge for sample processing. In one embodiment, the lysis solution is prepared as shown in Table 11. The proteinase K-treated serum / plasma may be mixed with the lysis solution and alcohol in a ratio equivalent to 1.3 mL of proteinase K-treated serum / plasma, 2.2 mL of lysis solution, and 1.5 mL of alcohol. In some embodiments, the serum / plasma sample is treated with proteinase K for approximately 15 minutes. A frozen lysis solution is added and held / mixed for approximately 10 minutes. Isopropanol is then added to the mixture, after which the mixture is loaded into a cartridge for processing.

[0522] As mentioned above, for serum / plasma, alcohol (e.g., isopropanol) precipitation is typically performed at RT, and in particular, "salt" solutions are not usually used. In some embodiments, a longer precipitation time at room temperature can be used.

[0523] Table 11. Lysis solutions for serum or plasma

[0524] In another illustrative but non-limiting embodiment, formalin-fixed paraffin-embedded (FFPE) samples are prepared by combining FFPE samples with proteinase K and a lysis solution comprising a buffer (e.g., HEPES), a chelating agent (e.g., EDTA), NaCl, MgCl2, and optionally sodium azide and / or an antifoaming agent. The solution is heated (e.g., 70°C to 90°C) for a period of time, e.g., about 10 minutes to up to about 4 hours. Alcohol is added to the solution, and the solution is then introduced into a cartridge for sample processing. In one embodiment, the lysis solution is prepared as shown in Table 12. In one illustrative but non-limiting embodiment, 1.2 mL of the lysis solution shown in Table 12 is added to the FFPE slice. Proteinase K is added and the mixture is heated, e.g., at 80°C for about 15 minutes. In some embodiments, heating is performed at 56°C for about 2 hours, followed by heating at 90°C for 30 minutes. 1.2 mL of ethanol is then added to the mixture, and the mixture is loaded into the sample chamber of the cartridge for processing.

[0525] Table 12. Lysis solutions used for formalin-fixed paraffin-embedded (FFPE) samples

[0526] Box operation and extraction performance In some implementations, an extraction control may be included during cfDNA preparation to allow monitoring of the quality of DNA preparation. For example... Figure 18 The diagram illustrates two distinct bead sets. One bead set contains an endogenous HMBS primer and probe set for SAC (sample assay control) and an exogenous BG primer and probe set for SPC (sample preparation control). The other bead set contains an endogenous β-globin PP set for SAC (and BG SPC).

[0527] In particular, it was found that the use of GTC in the cartridge is less important for serum samples than for plasma samples. This is not limited to any particular theory, but it is thought that this may be due to serum containing fewer proteins. Therefore, in some embodiments, the cartridge may contain fewer GTCs or may contain no GTCs at all.

[0528] Figure 19A and 19B The results of cfDNA preparation using the kit described herein are shown in comparison to those obtained using the conventional "tube filling" procedure. Figure 19A The qPCR results shown demonstrate binding and elution efficiencies obtained using the described kit that are very close (within 1 Ct) to those obtained using tube-filling methods. Figure 19B The sample concentration titration results indicate that when the sample concentration is as low as approximately 10 pg, the box preparation is conservatively within 1 Ct of the tube-filling preparation. It is believed that at higher sample concentrations, the box preparation is even closer to the tube-filling protocol.

[0529] Example 6 Test high volume sample preparation kit In some embodiments, a high-volume sample preparation (HSVP) kit is provided for preparing large-volume samples (e.g., up to about 12 mL to 15 mL). This is particularly useful when the sample contains low concentrations of DNA (e.g., cfDNA in serum or plasma). Figure 20A An example of such a box is illustrated. As shown, the box provides three chambers (chambers 2, 3, and 5) for receiving samples. In the illustrated embodiment, each of these chambers is capable of receiving approximately 4 mL of sample, which in some embodiments comprises 4 mL of plasma / serum bound with 4 mL of GTC and 4 mL of alcohol (e.g., isopropanol).

[0530] Samples are introduced into these chambers, and the cartridges are operated as described herein to prepare samples for PCR and / or methylation analysis. In some embodiments, as illustrated, operation of the cartridge may include binding DNA to an affinity column (e.g., for removal) and eluting the DNA. In some embodiments, when performing methylation analysis, operation of the cartridge may further include binding DNA to a transformation reagent (e.g., bisulfite as described herein) and heating the mixture to transform the DNA. In some embodiments, the HSVP cartridge may also be configured to desulfonate the transformed DNA. In other embodiments, the DNA may be desulfonated in a second (e.g., qPCR) cartridge, such as... Figure 20B The diagram is shown below. The second kit can also be used for methylation analysis (e.g., qPCR analysis).

[0531] Figure 21 The results of DNA sample preparation from plasma and serum using HMBS or β-globulin primer and probe sets are shown as a comparison between single-box and dual-box protocols. As shown in the figure, DNA recovery showed a linear increase between 0.5 mL and 4 mL of serum or plasma. Furthermore, the loss was minimal to non-existent when using a single box for preparation and analysis or when using separate boxes for preparation and analysis.

[0532] Example 7 Optimize sulfite conversion In some implementations, when using a cassette for methylation analysis as described herein, a potential challenge is optimizing elution efficiency using the smallest possible volume. Spin columns are easier to handle for small elution volumes. This problem can be addressed by using multiple heating steps to handle larger sample volumes.

[0533] A second technical concern arises when heating larger sample volumes (e.g., a minimum of 100 µL) using smaller heating tubes or chambers (e.g., 50 µL). In some cases, the pressurization effect between heating steps makes it difficult to repeatedly generate aspirates and dispenses. Secondly, the lack of pressurization can lead to volume changes and bubbles, especially at higher temperatures. Thirdly, air can be introduced between the heated and unheated samples during port changes between heating steps.

[0534] To optimize the conversion of these bisulfites in a 50 µL tube, single-heating and double-heating methods were investigated. The experiment was conducted as follows: Take 75-80 µL of bisulfite-DNA; heat at 95°C for 10 s, then at 65°C for 300 s x 8; Pull rest + 5-10 µL; pressurize; heat at 95°C for 480 s, then at 65°C for 1800 s x1.

[0535] The results of 0.5 mL serum are as follows Figure 22 As shown, the top graph represents 1x heating (converted is 33.0, unconverted is 34.4) N=4, and the bottom graph represents 2x heating (converted is 31.9, unconverted is 36.1) N=4.

[0536] When the heating intensity was changed from 1x to 2x, there was an increase of approximately 1 Ct in the transformed ACTB signal. This indicates that almost all the DNA was transformed. This is supported by the fact that there was also a decrease of approximately 2 Ct in the untransformed HMBS signal. The 1 Ct increase is reasonable because we changed from heating a 50 / 100 µL DNA-bisulfite sample to heating a 100 / 100 µL DNA-bisulfite sample.

[0537] Example 8 Comparison of DNA methylation cassettes with tube-based commercial kits Figure 23A This paper illustrates a comparison of the steps required for methylation analysis using the kit described herein (left) with those required using commercial kits (QIAamp MinElute Viral Spin Kit (Qiagen, Inc.) and EZ DNA Methylation-Lightning™ Kit (Zymo Research, Inc.)). It is readily apparent that kit-based methylation analysis requires significantly fewer steps and approximately 5 minutes of labor time compared to the 2–3 hours required using the kits.

[0538] To compare the results from different methods, 200 µL of serum was purified using a Qiagen kit. DNA was transformed using a Zymo kit, purified with a second spin column, and eluted with 10 µL. The entire 10 µL was run using the transformed, unmethylated ACTB primers and probes (TSR). In contrast, 200 µL of serum was run in the methylation cassette described herein. Results are as follows: Figure 23B As shown. It is quite obvious that the results produced by the box method are very comparable to those obtained using commercial kits. However, this is achieved with far less labor and time.

[0539] Example 9 Uses of DABSO for DNA transformation First, try dissolving 5 g of DABSO in 5 mL of H2O. Finally, add a few mL of 10 M KOH and a mL of water and heat to dissolve the DABSO, and raise the pH to approximately pH 5.5 at the estimated final DABSO concentration of approximately 2.5 M.

[0540] Figure 24 Tube-filled diagrams of 750 ng DNA transformed using DABSO or Zymo transformation reagents are shown. The material was heated off-center (1 µg) in a thermal cycler and purified using a spin column and run as tube-filled. Three different experiments were performed: 1) 120 µL DABSO / 30 µL DNA; 2) 120 µL Zymo / 30 µL DNA; and 3) 70 µL Zymo / 30 µL DNA (current ratio in the box).

[0541] like Figure 24 As shown, DABSO provides a good conversion, which is almost equivalent to those obtained using Zymo reagents.

[0542] Example 10 Sensitivity of methylated DNA detection To evaluate the sensitivity of DNA methylation detection, the kit described herein was used to detect transformed DNA based on copy number. ACTB Gene promoters. The goal was to detect transformed unmethylated DNA with fewer than 25 copies. As previously shown, a decrease was observed at approximately 10–50 copies (a decrease of 1 for each). Similar sensitivity was observed for methylated DNA targets in the serum background.

[0543] Figure 25 Box A illustrates the detection of methylated DNA in a dilution series. MGMT (O-6-methylguanine-DNA methyltransferase gene). As shown in the figure, MGMT was detected at levels as low as 78 pg.

[0544] methylated breast cancer markers in MBA-453 cells RASSF1A and AKR1B1 The test results are shown in Figure 25 In box B. As shown in the figure, breast cancer markers were detected at concentrations as low as 100 cells.

[0545] Methylated pancreatic cancer markers in a diluted series ACTB , BNC1 and ADAMTS1 Detection such as Figure 25As shown in box C, pancreatic cancer markers were detected at levels as low as 25 copies, as illustrated in the figure.

[0546] Table 13 shows pancreatic cancer markers as a function of concentration. BNC1 and ADAMTS1 The hit rate. As shown in the figure, these markers can be detected at levels below 120 pg. Note that the positive "hit rate" refers to the amplification of copies in any gene.

[0547] Table 13 illustrates the hit rate of pancreatic cancer marker detection as concentration changes.

[0548] Example 11 Reverse complementary multiplexing of two chains Figure 26 This describes the results of reverse complementarity multiplexing for two DNA strands. After bisulfite conversion, both strands lose their complementarity. Therefore, primer and probe sets must be designed for one or the other strand to generate unique amplicon. In addition to providing "more chances," this method may improve sensitivity (at LOD, this method guarantees signal capture if only one or the other strand terminates in the tube).

[0549] Multiplexing allows for the detection of different CpGs at the same promoter site. Reverse complementary multiplexing provides more querying of the target and the possibility of finding heteroogamous methylation.

[0550] Example 12 Detection of DNA methylation and mutations in a single kit In some implementations, multiplexed PCR reactions can contain primers and probes in the same cassette that allow the detection of mutations other than methylation. Figure 27A This explains methylation BNC1 and ADAMTS1 as well as KRAS G12D Detection of mutations and control BG (above), and methylation. BNC1 and ADAMTS1 as well as KRAS Detection of wild type and control BG (see figure below).

[0551] Figure 27B This illustrates the differences between PANC-1 cells (top image) and MIA-PaCa cells (bottom image). BNC1 and ADAMTS1 Methylation and KRAS Simultaneous detection of G12D mutation.

[0552] Example 13 Multipath optimization for pancreatic cancer confirm ADAMTS1 , BNC1 Methylation analysis of (and certain other genes) allows for the detection and / or staging of pancreatic cancer. Therefore, optimization targeting... BNC1 and ADAMTS1 Initial multiplexing was performed to encourage probe incorporation of other genes. To optimize the assay, temperature gradients were run on both external and internal PCR of the strands undergoing forward / reverse bisulfite transformation. Single-path (forward / reverse for each gene) was run at external temperatures of 56°C, 58°C, and 60°C, and internal temperatures of 64°C, 66°C, and 68°C (see example). Figure 28 In some implementations, the determination is developed to target... BNC1 and ADAMTS1 Two 4-way assays were performed on two other genes, one for forward methylation analysis and the other for reverse methylation analysis.

[0553] Two sets of probes were synthesized according to the preferred reaction conditions (salt conditions: 40 mM (LS), 60 mM (MS), 80 mM (HS) KCl, 15 mM NH4SO4) (see [link to original text]). Figure 29 The specificity of the multiplexer was optimized. The final optimized salt conditions for multiplexer 1 were 80 mM KCl, 5 mM MgCl2, 20 mM Tris at pH 8.5 and 10 mM NH4, and the final optimized salt conditions for multiplexer 2 were 62 mM KCl, 4 mM MgCl2, 20 mM Tris at pH 8.5 and 10 mM NH4.

[0554] Example 14 MGMT Detection of methylation O(6)-methylguanine-DNA methyltransferase ( MGMT The gene encodes a DNA repair enzyme that can counteract the effects of alkylating chemotherapy (such as temozolamide). If MGMT If genes are active, damage can be rapidly repaired. It is believed that malignant gliomas may possess inactivated genes. MGMT Genes, this is due to methylation of their promoter regions. Methylation MGMT Genes are predictive indicators of better response to chemotherapy (because tumors cannot repair DNA damage induced by alkylating agents).

[0555] Develop primers and probes to detect MGMT Methylation, such as Figure 30 As shown, and summarized in Table 14 below. Specifically, Figure 30The templates with CPG transformation (as determined by pyrosequencing) are shown in gray. As illustrated, after bisulfite transformation, the forward and reverse strands are no longer complementary, allowing for separate analysis of each strand.

[0556] Table 14. Used for detection MGMT Illustrative primer / probe set for methylation (see, for example) Figure 30 ).

[0557]

[0558] To evaluate detection sensitivity, ACTB was used as a control. MGMT Dilution series (5 ng to 78 pg against a background of 20 ng HS DNA) MGMT DNA). In an illustrative experiment, 78 pg of methylation MGMT The DNA is only about 10 cycles away from the Ct of unmethylated HS DNA.

[0559] like Figure 31 As shown, the methylation cassette described herein will be used for detection. MGMT The result of methylation is similar to that obtained through extracted DNA ( Figure 31 (above) and FFPE sample ( Figure 31 The results were compared with those from pyrosequencing (below). Pyrosequencing typically uses a cutoff of 10-15% to determine patient strata. We used an arbitrary cutoff of 12.5 ( ACTB and MGMT The threshold was set at δCt = 12.5 and calculated based on >15% methylation to match the pyrosequencing results as closely as possible. Therefore, in this embodiment, the threshold was set at δCt = 12.5 and calculated based on >15% methylation. Cassette analysis of the extracted DNA showed 90% sensitivity and 86% specificity, while cassette analysis of the FFPE samples showed 88% sensitivity and 95% specificity.

[0560] It is noted that specificity can be improved in two ways: 1) The annealing temperature can be increased, since 62°C is a relatively low annealing temperature. Alternatively, methylation probes covering 3 (or more) CpGs can be used.

[0561] Example 15 BRCA1 Detection of methylation BRCA1 is a watchdog gene responsible for repairing DNA. It is believed that... BRCA1 It participates in homologous recombination, non-homologous end joining, and nucleotide excision repair. It exhibits abnormalities. BRCA1 Women with certain genes have an 80% chance of developing breast cancer.

[0562] Not limited to a specific theory, it is believed that BRCA1 Methylation is a potential predictive marker of chemotherapy response in triple-negative BC patients. Studies in NSCLC patients treated with cisplatin have shown that low methylation... BRCA1 The patients who expressed these results had improved survival rates. High levels of these substances reduced the effectiveness of chemotherapy by repairing damage caused to cancer cells.

[0563] Based on these and other observations, an observation kit and usage method were developed to detect BRCA1 methylation. Specifically, PCR conditions were optimized as follows: 1) Evaluating an external temperature of 56-62°C, we selected a 3-step PCR protocol with annealing at 56°C; 2) Evaluating an internal temperature of 64-70°C, we selected a 2-step PCR protocol with annealing at 68°C. Results are shown in... Figure 32 .

[0564] for BRCA1 ,use ACTB A control gene assay was performed to determine a target. Eight different cell lines were tested, and the effects of NH4 addition were compared (see [link to test]). Figure 33 ) Expected to be observed in the 3199 cell line. BRCA1 Methylation.

[0565] Example 16 Detection of gene methylation associated with lung cancer Targeting genes associated with lung cancer methylation ( SOX17 , CD01 , TAC1 ),as well as ACTB Control gene, test three-target methylation assay. Figure 34 The data shown indicate that, as expected, the three targets were not present in the normal plasma background, but were present to some extent in three different lung cancer cell lines.

[0566] It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications and variations thereof will be suggested to those skilled in the art and are included within the spirit and scope of this application and the appended claims. All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety for all purposes.

Claims

1. A method for determining the methylation status of transformed nucleic acids, the method comprising: i) Contacting a biological sample containing nucleic acids with a first matrix material containing a first column or filter, wherein the matrix material binds and / or filters the nucleic acids in the sample to purify DNA, wherein the biological sample has a sample volume of about 0.5 ml to about 12 ml. ii) Elute any bound DNA from the first matrix material and denature the eluted or purified DNA to produce denatured DNA; iii) Denature DNA by heating in the presence of bisulfite reagent to produce deaminated nucleic acids; iv) Contact the deamination nucleic acid with a second matrix material containing the second column to bind the deamination nucleic acid to the second matrix material; v) Desulfonate the bound deamination nucleic acid and / or simultaneously elute and desulfonate the bound deamination nucleic acid by contacting the bound deamination nucleic acid with an alkaline solution to produce transformed nucleic acid; The process of binding the deaminated nucleic acid desulfonates involves eluting the DNA from the second column using a desulfonate buffer with a pH greater than about 10.5 and incubating the solution. vi) If no elution has been performed previously, elute the transformed nucleic acid from the second matrix material; and vii) Amplifying the transformed nucleic acid, wherein steps i) to iii) are performed in the first reaction chamber and steps iv) to vi) are performed in the second reaction chamber; The second box includes a column containing a second matrix material, a sample receiving chamber, a reaction channel or chamber that can be temperature controlled and subjected to thermal cycling, a plurality of chambers for containing reagents and / or buffers, and wherein at least one of the chambers contains a desulfonate / elution buffer when in use. The sample receiving chamber, the column, the plurality of chambers, and the reaction channel or chamber are selectively in fluid communication via microfluidic channels and valves; in: The sample receiving chamber, the column, the plurality of chambers, and the reaction channel or chamber, or the port leading to the reaction channel or chamber, are arranged around a central valve and selectively in fluid communication with a channel in the central valve, wherein the central valve is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of a chamber in fluid communication with the central valve; and / or The amplification is performed by polymerase chain reaction (PCR), wherein heating with bisulfite is carried out in the reaction channel or chamber subsequently used for PCR. The method described herein is a non-diagnostic method.

2. A kit for determining the methylation state of nucleic acids, the kit comprising a first box and a second box, wherein: The first box includes a column containing a first matrix material, a sample receiving chamber, a reaction channel or chamber, and multiple chambers for containing reagents and / or buffer solutions, wherein at least one of the chambers contains a bisulfite reagent when in use. The first box is capable of bisulfite conversion in the reaction channel or chamber, after which a polymerase chain reaction (PCR) is performed; and The second cartridge includes a chamber containing a desulfonate / elution buffer, wherein the desulfonate / elution buffer is an alkaline buffer with a pH greater than about 10.5; at least two different chambers, each configured to receive up to about 4.5 mL of sample solution; and optionally includes a second column containing a second matrix material. The second box is capable of performing a desulfonate step in the reaction channel or chamber, which is then used for polymerase chain reaction (PCR). The sample receiving chamber, the column, the plurality of chambers, and the reaction channel or chamber are selectively in fluid communication via microfluidic channels and valves; in: The sample receiving chamber, the column, the plurality of chambers, and the reaction channel or chamber, or the port leading to the reaction channel or chamber, are arranged around a central valve and selectively in fluid communication with a channel in the central valve, wherein the central valve is configured to accommodate a plunger capable of introducing or drawing fluid into or out of a chamber in fluid communication with the central valve.

3. A system for determining the methylation of nucleic acids in biological samples, the system comprising: An accessory configured to include one or more sample processing modules, each sample processing module being configured to accommodate the first or second box of claim 2; The system is configured to operate the sample processing module to process samples to determine the methylation of one or more target nucleic acids and optionally to determine the level of one or more target DNA sequences in a corresponding first or second box, wherein the processing of the samples in the corresponding first or second box is performed according to the method of claim 1.

4. A high-volume sample preparation (HVSP) kit, the kit comprising a first kit and a second kit, wherein: The second cartridge includes channels or chambers containing an affinity matrix for binding DNA, a plurality of chambers arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chambers in fluid communication with the central valve, wherein the plurality of chambers include: At least two different chambers, each configured to receive up to approximately 4.5 mL of sample solution; Chambers containing PEG; A chamber containing an alkaline solution with a pH greater than approximately 10.5; and A chamber containing a buffer solution; The box contains or is configured to receive a conversion reagent; The second box provides DNA or RNA recovery, which is substantially linear with respect to sample volumes from 0.5 mL to approximately 4 mL.

5. A kit for determining DNA methylation, said kit comprising: A container comprising the kit of claim 2 for determining the methylation status of nucleic acids.

6. The kit of claim 5, wherein the kit further comprises: A container containing a lysis solution for serum or plasma, wherein the lysis solution comprises: GTC, buffer, detergent, and optional defoamer; and / or A container containing a lysis solution for FFPE samples; and / or Containers containing proteinase K; and / or The conversion reagent in the box or in a separate container; and / or A container comprising the sample preparation box of claim 4.

7. A kit for detecting methylation markers in cancer, the kit comprising a first kit and a second kit, wherein: The first box includes: Sample receiving chamber; A chamber containing or configured to receive bisulfite reagent; A chamber containing a washing solution; and The second box includes: a plurality of chambers and a reaction channel or chamber capable of temperature control and thermal cycling, wherein the plurality of chambers or ports entering the reaction channel or chamber are arranged around a central valve assembly and selectively in fluid communication with the central valve assembly, wherein the central valve assembly is configured to accommodate a plunger capable of introducing or withdrawing fluid into or out of the chamber or port in fluid communication with the central valve, wherein the plurality of chambers include: The chamber containing Tris buffer; A chamber containing an alkaline solution, said alkaline solution including KOH; A chamber containing beads that provide the PCR master mixture; and A chamber containing beads that provide PCR primers and probes to detect methylation of one or more gene promoters, the methylation status of which is a marker of cancer; The second box has at least two different chambers each configured to receive up to about 4.5 mL of sample solution; The second box is capable of performing a desulfonate grouping step in the reaction channel or chamber, which is then used for polymerase chain reaction (PCR).

8. The kit of claim 7, wherein the chamber comprising beads providing PCR primers and probes for detecting methylation of one or more gene promoters comprises beads that provide PCR primers and probes for detecting methylation of one or more gene promoters, the methylation state of said gene promoters being a marker selected from cancers including breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

9. A method for preparing cfDNA samples from serum or plasma, the method comprising: A proteinase K-treated serum or plasma sample is combined with a lysis solution and an alcohol to form a sample solution, wherein the lysis solution includes GTC, a buffer, a detergent, and an optional defoamer. The sample solution is added to the sample receiving chamber of at least one of the boxes in the box assembly of claim 4; and At least one cassette of the cassette assembly is operated to bind DNA in the sample to the affinity matrix, and then the DNA is washed and released from the matrix.

10. A method for preparing DNA from an FFPE sample, the method comprising: The formalin-fixed paraffin-embedded sample was combined with the lysis solution; Heating the lysis solution containing the sample; Alcohol is added to the sample to form a sample solution; The sample solution is added to the sample receiving chamber of the first box in claim 4; as well as The first box is operated to bind DNA from the sample to the affinity matrix, and then the DNA is washed from the matrix and released.

Images