Monocarboxylate transporter 4 (MCT4) antisense oligonucleotide (ASO) inhibitors used as therapeutic agents in the treatment of cancer

Abstract

The present application provides compositions, methods, and uses for modulating MCT4 activity or for treating cancer. The compositions comprise an antisense oligonucleotide (ASO) for administration to a cancer cell, wherein the cancer cell can be characterized by elevated MCT4 expression. The cancer can be selected from one or more of the following: prostate cancer; renal cell carcinoma; breast cancer; cervical cancer; liver cancer; bladder cancer; and small cell lung cancer pr. The prostate cancer can be castration-resistant prostate cancer (CRPC).

Description

Technical Field

[0001] This invention provides compounds, compositions, and methods for regulating the expression of monocarboxylic acid transporter 4 (MCT4). In particular, this invention relates to antisense oligonucleotides (ASOs) capable of regulating human MCT4 mRNA expression, and their use and methods for treating various indications, including various cancers. Specifically, this invention relates to therapies and methods for treating cancers such as prostate cancer, including castration-resistant prostate cancer (CRPC).

[0002] Cross-references to related applications

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 260,837, filed November 30, 2015, entitled “Antisense oligonucleotides as monocarboxylate transporter 4 therapeutic compositions and methods for their use in the treatment of cancer.” background

[0004] Prostate cancer is the most common non-skin cancer and the second leading cause of cancer-related death among men in the Western world (Siegel R, et al., 2012., 62(1):10-29). Prostate cancer is initially androgen-dependent, and although androgen deprivation therapy (ADT) can induce significant tumor regression, tolerance to ADT inevitably develops, leading to castration-resistant prostate cancer (CRPC). The current standard of care for CRPC is systemic docetaxel-based chemotherapy, which increases overall survival by approximately 2 months compared to mitoxantrone-based therapy (Petrylak DP, et al., N Engl J Med. 2004; 351(15):1513-1520; Tannock IF, et al., N Engl J Med. 2004; 351(15):1502-1512). Recently, ciproxetine-T, cabazitaxel, abiraterone, MDV3100, and radium-223 have shown more durable overall survival benefits and have been approved by the FDA for the treatment of CRPC (Bishr M and Saad F., Nat Rev Urol. 2013; 10(9):522-528). Although the efficacy of treatment for metastatic castration-resistant prostate cancer (mCRPC) has recently improved with the use of more potent chemotherapeutic agents targeting the androgen receptor (AR) signaling axis, such as enzalutamide (Ning et al., 2013) and abiraterone (de Bono et al., 2011), overall survival has only increased slightly (Badrising et al., 2014; Loriot et al., 2013; Tannock et al., 2004). Furthermore, it is believed that further improved forms of these drugs could promote the differentiation and transformation of prostate adenocarcinoma into neuroendocrine prostate cancer (NEPC) (a subtype of currently incurable disease) (Beltran et al., 2011; Nadal et al., 2014; Yuan et al., 2007). However, these drugs have not shown efficacy, and they have gradually improved overall survival. Developing more effective therapeutic targets and drugs, particularly those targeting the molecular drivers of metastatic CRPC and mCRPC, is crucial for improving disease management and patient survival (Lin D, et al., Curr Opin Urol. 2013; 23(3):214-219).

[0005] Mounting evidence suggests that targeted reprogramming of cancer energy metabolism offers a uniquely effective therapeutic intervention (Zhang and Yang, 2013). Unlike normal resting cells, cancer cells typically favor lactate-coupled glycolysis for glucose utilization, a process known as aerobic glycolysis or the Warburg effect (Warburg, 1956). This leads to increased glucose consumption, a near-universal characteristic of both primary and metastatic cancers. Furthermore, aberrant utilization of glutamine, which also leads to increased lactate production, has been observed to be very common in cancer (Koochekpour et al., 2012). These metabolic pathways cause cancer cells to increase lactate secretion into their microenvironment, thereby promoting a variety of carcinogenic, lactate-stimulated processes, including tissue invasion / metastasis, angiogenesis, and responses to hypoxia (Choi et al., 2013; Choi et al., 2014; Doherty and Cleveland, 2013; Ullah et al., 2006). Furthermore, lactate-induced acidification of the cancer cell microenvironment (to pH 6.0–6.5) can lead to suppression of local host anti-cancer immunity (Choi et al., 2013; Parks et al., 2013). 18F-fluorodeoxyglucose positron emission tomography (FDG-PET) is most commonly used clinically to detect cancer-induced hyperglycemia. Although this imaging technique is not widely used in prostate cancer (Jadvar, 2009), there is evidence that glucose metabolism in prostate cancer cells is increased through AR signaling and progression to treatment resistance (Tennakoon et al., 2014; Vaz et al., 2012). Therefore, targeting the aerobic glycolysis pathway may be an effective treatment for advanced prostate cancer.

[0006] The monocarboxylic acid transporter (MCT) family comprises plasma membrane transporters involved in the transport of lactate and other metabolic monocarboxylate. Specifically, lactate / H+ efflux is thought to be primarily mediated by MCT4 (SLC16A3) (Dimmer et al., 2000). MCT4 expression is associated with highly glycolytic cells (Halestrap, 2013; Manning Fox et al., 2000; Ullah et al., 2006), and elevated MCT4 expression in tumors has clinical relevance, as it has been associated with poor patient prognosis in several types of cancer (Fisel et al., 2013; Lisanti et al., 2013; Ohno et al., 2014), including prostate cancer (Hao et al., 2010; Pértega-Gomes et al., 2011). Furthermore, elevated MCT4 expression may play an important role in cancer-stromal interactions that promote prostate cancer progression (Sanità et al., 2014). This information, along with the cancer-promoting ability of cancer-produced lactate, suggests that inhibiting MCT expression or function offers a promising therapeutic strategy for a wide variety of vegetations (Marchiq et al., 2015). However, therapeutic strategies specifically targeting MCT4-mediated lactate efflux remain lacking.

[0007] Therapeutic options for castration-resistant prostate cancer (CRPC) have changed significantly with the recent FDA approval of newer agents that improve patient survival. In particular, the second-generation androgen receptor antagonist enzalutamide (ENZ) has been approved for the treatment of metastatic CRPC in post-docetaxel and more recently, pre-docetaxel situations. However, within two years of clinical practice, the development of ENZ tolerance has been evident in most patients (Claessens et al., 2014), and to date, no known therapy has been shown to be effective against ENZ-resistant CRPC. Therefore, novel therapeutic agents that can effectively inhibit ENZ-resistant CRPC would be useful.

[0008] Overview

[0009] This invention is partly based on the finding that inhibiting MCT4 expression with MCT4 antisense oligonucleotides (ASOs) (SEQ ID NO:1-23 and SEQ ID NO:46-50) can be used to treat cancer. Inhibition of MCT4 expression with certain ASOs leads to reduced cancer cell proliferation. Furthermore, this reduced proliferation extends to castration-resistant prostate cancer (CRPC).

[0010] In a first aspect, a composition for treating cancer cells is provided, the method comprising administering one or more oligonucleotides selected from SEQ ID NO:1-23 or SEQ ID NO:46-50 to cells.

[0011] In another aspect, a pharmaceutical composition is provided comprising (a) an antisense oligonucleotide (ASO) of one or more oligonucleotides selected from SEQ ID NO:1-23 and SEQ ID NO:46-50; and (b) a pharmaceutically acceptable carrier.

[0012] According to another aspect, commercial packaging is provided, which includes (a) the antisense oligonucleotide sequence described herein and a pharmaceutically acceptable carrier; and (b) a description of its use for modulating MCT4 activity.

[0013] On the other hand, commercial packaging is provided, which includes: (a) an ASO of oligonucleotides optionally selected from SEQ ID NO:1-23 or SEQ ID NO:46-50; and (b) instructions for use in the treatment of cancer.

[0014] On the other hand, a method for treating cancer is provided, which includes administering an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49.

[0015] On the other hand, a method for treating cancer is provided, comprising administering an MCT4 antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49.

[0016] In the case of the State of the Union, the Association of Societal Organisations (ASO), the following are the following statements: (a) TCCCATGGCCAGGAGGGTTG (SEQ ID NO:1);(b) GTCCCGGAAGACGCTCAGGT (SEQ ID NO:2);(c) AAGGACGCAGCCACCATGCC (SEQ ID NO:3);(d) TTGGCGTAGCTCACCACGAA (SEQ ID NO:4):(e) AGATGCAGAAGACCACGAGG (SEQ ID NO:5);(f) CCACTCTGGAATGACACGGT (SEQ IDNO:6),(g) GTAGGAGAAGCCAGTGATGAC (SEQ ID NO:7),(h) AGCATGGCCAGCAGGATGGA (SEQID NO:8),(i) GGCTGGAAGTTGAGTGCCAA (SEQ ID NO:9),(j) CATGCCGTAGGAGATGCCAA (SEQID NO:10);(k) CTCAGGCTGTGGCTCTTTGG (SEQ ID NO:11);(l) TAGCGGTTCAGCATGATGA(SEQ ID NO:12):(m) AGCACGGCCCAGCCCCAGCC (SEQ ID NO:13):(n)GAGCTCCTTGAAGAAGACACT (SEQ ID NO:14)?(o) CAGGATGGAGGAGATCCAGG (SEQ ID NO:15);(p) AGACCCCCCACAAGCATGAC (SEQ ID NO:16);(q) GAAGTTGAGTGCCAAACCCAA (SEQ ID NO:17);(r) CCCGTTGGCCATGGGGCGCC (SEQ ID NO:16). NO:18)(s) GCCAGCCCGTTGGCCATGGG (SEQ IDNO:19);(t) AGGAAGACAGGGCTACCTGC (SEQ ID NO:20);(u) GCACACAGGAAGACAGGGCT (SEQID NO:21);(v) CAGGGCACACAGGAAGACAG (SEQ ID NO:20). NO:22) and (w) CAGCAGTTGAGCAGCAGGCC(SEQ ID NO:23) and (x) ATGGCCAGGAGGTTG (SEQ ID NO:46)(y) CATGGCCAGGAGGGTT (SEQ ID NO:47); (z) CCATGGCCAGGAGGGT (SEQ ID NO:48); and (aa) CCCATGGCCAGGAGGG (SEQ ID NO:49). ;

[0017] On the other hand, a pharmaceutical composition is provided comprising (a) an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49; and (b) a pharmaceutically acceptable carrier.

[0018] On the other hand, the use of antisense oligonucleotides (ASOs) having sequences selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49 for the treatment of cancer is provided.

[0019] On the other hand, the use of antisense oligonucleotides (ASOs) having sequences selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49 is provided in the preparation of medicaments for treating cancer.

[0020] On the other hand, a combination therapy is provided comprising (a) an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49; and (b) docetaxel. The combination therapy may also comprise a pharmaceutically acceptable carrier or excipient.

[0021] On the other hand, commercial packaging is provided, which includes an ASO having a sequence selected from one or more of SEQ ID NO:1-23 and SEQ ID NO:46-49; and instructions for use in treating cancer.

[0022] The antisense oligonucleotide (ASO) may have the sequences of SEQ ID NO:1-23 or SEQ ID NO:46-49. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:1. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:2. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:3. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:4. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:5. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:6. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:7. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:8. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:9. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:10. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:11. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:12. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:13. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:14. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:15. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:16. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:17. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:18. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:19. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:20. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:21. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:22. The antisense oligonucleotide (ASO) may have the sequence of SEQ ID NO:23. Antisense oligonucleotides (ASOs) may have the sequence of SEQ ID NO:46. Antisense oligonucleotides (ASOs) may have the sequence of SEQ ID NO:47. Antisense oligonucleotides (ASOs) may have the sequence of SEQ ID NO:48. Antisense oligonucleotides (ASOs) may have the sequence of SEQ ID NO:49.

[0023] The ASO may also contain modified internucleotide links. Modified internucleotide links may be peptide-nucleic acid links, morpholine links, N3' to P5' aminophosphate links, methylphosphonate links, or thiophosphate links. Modified internucleotide links may be peptide-nucleic acid links. Modified internucleotide links may be morpholine links. Modified internucleotide links may be N3' to P5' aminophosphate links. Modified internucleotide links may be methylphosphonate links. Modified internucleotide links may be thiophosphate links. The ASO may also contain a modified sugar moiety. The modified sugar moiety may be a 2'-O-alkyl oligonucleotide. The ASO may have a 2'MOE gapmer modification. The ASO may also contain modified nucleosides. Modified nucleosides may be 5-methylpyrimidine or 5-propynylpyrimidine. The cell may be a human cell. This cancer may be characterized by elevated MCT4 expression. This cancer can be one or more of the following: prostate cancer; renal cell carcinoma; breast cancer; cervical cancer; liver cancer; bladder cancer; and small cell lung cancer. The cancer can be one or more of the following: prostate cancer; renal cell carcinoma; breast cancer; liver cancer; bladder cancer; and small cell lung cancer. The cancer can be one or more of the following: prostate cancer; renal cell carcinoma; cervical cancer; liver cancer; bladder cancer; and small cell lung cancer. The cancer can be prostate cancer. Prostate cancer can be castration-resistant prostate cancer (CRPC). The cancer can be one or more of the following: prostate cancer; renal cell carcinoma; breast cancer; liver cancer; and bladder cancer. Prostate cancer can be enzalutamide (ENZ)-resistant CRPC. The cancer can be metastatic prostate cancer. ASO is substantially complementary to MCT4 mRNA. ASO can be administered intravenously. ASO can be administered topically to tissues. ASO can be mixed with lipid particles before administration. ASO can be encapsulated in liposomes before administration.

[0024] ASO may also contain modified internucleotide links. Modified internucleotide links may be peptide-nucleic acid links, morpholino links, N3' to P5' aminophosphate links, methylphosphonate links, or thiophosphate links. ASO may also contain a modified sugar moiety. This modified sugar moiety may be a 2'-O-alkyl oligonucleotide. ASO may also have 2'MOE-notched polymer modification. ASO may also contain modified nucleobases. Modified nucleobases may be 5-methylpyrimidine or 5-propynylpyrimidine.

[0025] This cell type can be human cells. This cancer may be characterized by elevated MCT4 expression. This cancer can be one or more of the following: prostate cancer; renal cell carcinoma; breast cancer; cervical cancer; liver cancer; bladder cancer; and small cell lung cancer. Prostate cancer can be castration-resistant prostate cancer (CRPC). Prostate cancer can be enzalutamide (ENZ)-resistant CRPC or metastatic CRPC (mCRPC).

[0026] ASO is substantially complementary to MCT4 mRNA. ASO can be administered intravenously. ASO can be administered topically to tissues. ASO can be mixed with lipid particles before administration. ASO can be encapsulated in liposomes before administration. In cases involving surgery, radiation (short-range radiotherapy or external beam), or other therapies (such as HIFU), antisense oligonucleotides can be used as neoadjuvant therapy (before), adjuvant therapy (during), and / or adjuvant therapy (after). For example, MCT4 antisense oligonucleotides can be used in combination with docetaxel, MDV3100, or regulators of glucose metabolism (including doxycycline or other mitochondrial inhibitors). Brief description of the attached diagram

[0027] Figure 1 shows MCT4 expression in tissue microarrays (TMA) of patient-derived prostate cancer samples available from the Vancouver Prostate Centre Tissue Bank, stained against MCT4 expression. A) and B) show bar graphs confirming the association between elevated MCT4 expression and Gleason grade; C) shows a graph where, as measured by increased serum PSA, high MCT4 expression is associated with earlier time to recurrence; and D) and E) show two bar graphs representing patients who have undergone prolonged neoadjuvant hormone therapy (NHT), and those with CRPC also show elevated MCT4 expression.

[0028] Figure 2 shows the efficacy screening of MCT4-targeting ASOs for inhibiting MCT4 expression and cell proliferation in PC-3 cells in vitro. MCT4 ASOs #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) exerted their in vitro effects in a dose-dependent manner, and this effect persisted 96 hours after transfection. A) shows that siRNA-silencing of MCT4 in PC-3 cells significantly inhibited cell proliferation, suggesting that inhibiting MCT4 expression may have potential therapeutic efficacy. B) shows that the 10 screened MCT4-targeting ASOs revealed different inhibitory effects on cell proliferation, with sequences #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) showing the most significant inhibition. C) shows that MCT4 ASOs induced different levels of MCT4 knockdown, as measured by qPCR and Western blotting, with ASOs #1 and #14 being the most effective. D) shows the effect of MCT4 knockdown on MCT4 cells. There was a strong correlation between mRNA expression and the number of cells obtained (p<0.001), indicating that the inhibitory effect on cell proliferation was strongly correlated with the reduced MCT4 expression (dashed line represents the 95% confidence interval); E) Transfection with 5 nM to 200 nM MCT4 ASO showed that the inhibition of MCT4 cell proliferation and expression was also dose-dependent (for ASO #14, IC50...). 50 =32 nM; For ASO #1, IC 50 = 50 nM); and F) showed that time-course experiments demonstrated that the inhibition of cell proliferation and MCT4 expression after MCT4 ASO transfection lasted for at least 96 hours after transfection.

[0029] Figure 3 shows that MCT4 ASO #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) are effective against human prostate cancer cells other than PC-3 in vitro, but ineffective against mouse prostate cancer cells: A) shows that candidate MCT4 ASO can also inhibit the proliferation of C4-2 human prostate cancer cells and the expression of MCT4 in a dose-dependent manner, with an IC50 of 100%. 50 Values ​​and those IC50 values ​​observed using PC-3 cells 50 The values ​​were comparable; B) showed that the candidate MCT4 ASO also inhibited the proliferation of DU145 human prostate cancer cells in a dose-dependent manner, with an IC50 value of [missing value]. 50 Values ​​compared to those obtained using other cell lines 50Similar values ​​were observed, with inhibition of cell proliferation accompanied by a decrease in MCT4 expression; and C) showed that the candidate MCT4 ASO had no perceptible effect on TRAMPC2 mouse prostate cancer cells, and even at the highest tested concentration of 200 nM, they did not affect cell proliferation or mouse MCT4 expression levels, indicating that the tested ASO was specific for human MCT4 and that the inhibition of cell proliferation was a phenomenon associated with MCT4 knockdown.

[0030] Figure 4 shows that transfection with candidate MCT4 ASO led to the inhibition of glucose metabolism in PC-3 cells: A) shows that MCT4 ASO significantly inhibited lactate secretion, and the corresponding inhibition of intracellular lactate accumulation and glucose consumption was also observed 48 hours after transfection (ud = undetectable); and B) shows a schematic diagram of the glycolytic pathway and the metabolic changes induced by MCT4 knockdown, characterized by qPCR analysis of the gene expression levels of various genes involved in glycolysis and lactate conversion, where the significant reduction in the expression of various genes in glycolysis indicates an overall reduction in glucose metabolism, and the reduced expression of LDHA and PDK1 indicates that pyruvate is redirected from lactate production to the TCA cycle for oxidative phosphorylation.

[0031] Figure 5 shows the results of treatment with MCT4 ASO #1 (SEQ ID NO: 1), #14 (SEQ ID NO: 5), control ASO, or PBS daily for 5 days followed by a 2-day treatment break, for a total of 15 days, in athymic nude mice with subcutaneous PC-3 tumors. The reduction in MCT4 expression in PC-3 tumor cells induced by MCT4 ASO was associated with inhibition of PC-3 tumor growth, characterized by increased apoptosis and inhibited cell proliferation: A) shows a graph representing the percentage of tumor volume on the treatment day, comparing MCT4 ASO in terms of tumor growth rate; B) shows a bar graph representing the percentage of caspase 3-positive and Ki-67-positive cells after treatment with MCT4 ASO, which can be attributed to increased apoptosis and decreased cell proliferation; and C) shows the reduction in MCT4 expression in tumors after treatment with MCT4 ASO, as measured by IHC staining.

[0032] Figure 6 shows that MCT4-targeted ASO increases immune cell aggregation and alters the proportion of tumor-associated immune cells (i.e., NK cells and CD3-positive cells) in vivo: A) shows a bar graph in which the immunomodulatory effect of treatment with MCT4 ASO is exerted by significantly increasing the degree of aggregation of such immune cells; B) shows a bar graph in which treatment with MCT4 ASO increases the proportion of tumor-associated NK cells; and C) shows a bar graph in the presence of MCT4 ASO, representing the proportion of CD3-positive cells (as nude mice lack T cells) as a marker of activated NK cells, compared to the control.

[0033] Figure 7 shows that candidate MCT4-targeting ASOs can inhibit cell proliferation and MCT4 expression in LNCaP human prostate cancer cells 48 hours after transfection: A) shows that MCT4 ASOs can inhibit LNCaP cell proliferation to levels comparable to those observed in other human prostate cancer cell lines; and B) shows that reduced cell proliferation is associated with reduced MCT4 expression, suggesting that the inhibitory effect of MCT4 ASOs may be more related to the glycolytic phenotype than to androgen receptor status.

[0034] Figure 8 shows that the candidate MCT4 ASO was able to inhibit PC-3 cell migration and tissue invasion in vitro; A) shows that treatment of PC3 cells with the candidate MCT4 ASO resulted in inhibition of cell migration through the Transwell, as indicated by the observed reduction in the number of migrating cells; and B) shows that treatment with MCT4 ASO also inhibited the ability of PC-3 cells to invade the Matrigel, and indicates that MCT4-mediated lactate secretion may play an important role in cancer metastasis.

[0035] Figure 9 shows that treatment of nude mice with MCT4 ASO does not cause host toxicity as measured by animal weight: A) shows a graph of animal weight throughout the duration of the study in vivo, and treatment with MCT4 ASO does not significantly affect the mean animal weight of each group; B) shows that the individual animal weights also remained stable throughout the treatment period.

[0036] Figure 10 shows a comparison of the total viable cell count assessed 48 hours after treatment with SEQ ID NO:5 ASO, metformin, doxycycline, docetaxel, and MDV3100, wherein SEQ ID NO:5 ASO was tested against each of the individual metformin, doxycycline, docetaxel, and MDV3100, as well as combinations thereof. (A) shows the total viable PC3 cell count of SEQ ID NO:5 ASO and metformin; (B) shows the total viable PC3 cell count of SEQ ID NO:5 ASO and doxycycline; (C) shows the total viable PC3 cell count of SEQ ID NO:5 ASO and docetaxel; and (D) shows the total viable C4-2 cell count of SEQ ID NO:5 ASO and MDV3100.

[0037] Detailed Explanation

[0038] Any term not directly defined herein should be understood to have the meaning generally associated with it as understood in the field of this invention. Certain terms are discussed below or elsewhere in the specification to provide practitioners with additional guidance on the compositions, apparatus, methods, etc., describing the embodiments, and how they are prepared and used. It should be understood that the same thing can be said in more than one way. Therefore, alternative language and synonyms may be used for any one or more terms discussed herein. Whether a term is set forth or discussed herein is not significant. Some synonyms or alternative methods, materials, etc., are provided. Unless expressly stated, the description of one or more synonyms or equivalents does not preclude the use of other synonyms or equivalents. Examples used in the specification (including examples of terms) are for illustrative purposes only and do not limit the scope and meaning of the embodiments described herein.

[0039] Methods for “treating” cancer cells are provided, wherein treatment is intended to encompass preventing cell proliferation, improving cancer-related symptoms, and eradicating cancer cells. The term “treatment” as used herein is also intended to include administration at any stage of cancer, including early or late administration of the compound. Those skilled in the art will understand that the term “improve” is intended to include the prospect of making a subject with cancer more tolerant of the cancer (e.g., by reducing the tumor burden). Those skilled in the art should also understand that the cancer-related term “eradicate” will include the complete or partial removal of cancer cells from the subject. Therefore, as used herein, “treatment” can refer to preventing the proliferation of cancer cells in a subject, improving cancer-related symptoms, eradicating cancer in a subject, or a combination thereof.

[0040] Antisense oligonucleotide compounds are typically single-stranded RNA compounds that bind to complementary RNA compounds (such as target mRNA molecules) and block the translation of the complementary RNA compound through a steric interference mechanism. This process is typically passive, as it does not require or involves additional enzymes to mediate the RNA interference process. Specific targeting of the desired gene expression by an antisense RNA compound may often involve designing the antisense RNA compound to have a complementary sequence homologous to the desired gene. The RNA interference effect does not need to be perfectly homologous. In one embodiment of the invention, the antisense RNA compound comprises any RNA compound having sufficient complementary homology to bind to MCT4 mRNA transcripts, thereby resulting in reduced MCT4 protein translation. In another embodiment of the invention, the antisense RNA compound comprises any RNA compound having sufficient complementary homology to bind to MCT4 mRNA transcripts, thereby resulting in reduced MCT4 protein translation. Antisense compounds can be modified to enhance the stability of the oligonucleotide, particularly for in vivo use. Numerous examples of methods for designing and optimizing antisense RNA compounds can be found in journal literature (i.e., Pan and Clawson 2006; Patzel 2007; Peek and Behlke 2007). Complete sequence complementarity is not required for antisense compounds to regulate target gene expression. The inventors of this application provide non-limiting examples of antisense compounds that regulate MCT4 expression.

[0041] Antisense oligonucleotide sequences as described herein (see Tables A and B) or used herein may be administered via medical devices or appliances such as implants, grafts, prostheses, stents, etc. Furthermore, implants designed to contain and release such compounds or compositions can be designed. One example is an implant made of a polymeric material suitable for releasing a compound over a period of time.

[0042] Table A below shows the percentage of MCT4 ASO inhibition for all tests. Typically, 50% inhibition is considered effective for MCT4 ASO.

[0043] Table A: MCT4 ASO sequence and MCT4 inhibition percentage.

[0044] This document provides antisense oligonucleotides (ASOs) targeting MCT4. The methods described herein cover the use of MCT4 ASOs for cellular application. Some ASOs, as used in the Examples section, have modified internucleotide bonds. In particular, ASOs have phosphate thioester bonds between all nucleosides. MCT4 ASO is a 16- to 20-mer oligonucleotide having modified phosphate thioester bonds. However, variants of MCT4 ASO may also have unmodified phosphodiester bonds or partially modified bonds (i.e., any integer number of phosphate thioester bonds from 1 to 19 or other modified bonds). Alternative modifications are also known in the art.

[0045] This article provides antisense oligonucleotides (ASOs) of 16 to 20-mer length that target MCT4. However, it will be apparent to those skilled in the art that bioactive oligonucleotides containing 16, 19, or 20 nucleotides of SEQ ID NO: 1-23 or SEQ ID NO: 46-49 may also be used.

[0046] Phospho-thiophosphate oligonucleotide modification alters the phosphate ester bond by replacing a non-bridging oxygen atom with sulfur. The introduction of the phosphate thiophosphate bond changes the chemical properties of the oligonucleotide. In particular, the addition of the phosphate thiophosphate bond reduces nuclease degradation of the oligonucleotide, thereby increasing its in situ half-life. Therefore, this modification is particularly useful for antisense oligonucleotides, which, upon introduction into cells or biological matrices, can interact with target nucleic acids to silence the expression of specific transcripts. Oligonucleotides containing phosphate thiophosphate bonds achieve this feat by directly blocking translation or enabling the target transcript to undergo enzymatic degradation (e.g., via RNase H).

[0047] While thiophosphate bonds provide an enhanced half-life, introducing these bonds into oligonucleotides can also limit their function as antisense oligonucleotides. Each thiophosphate bond generates a chiral center at each bond, which can lead to multiple isomers of the oligonucleotide produced during synthesis, and these isomers may have different characteristics and functional properties. However, most of the isomerism effect can be mitigated by careful targeting modifications or by using additional modifications that bind to the thiophosphate bond.

[0048] One or more phosphothioester bonds of the oligonucleotide moiety can be modified by replacing one or both of the two bridging oxygen atoms of the bond with an analog such as -NH, -CH2, or -S. Other oxygen analogs known in the art may also be used.

[0049] As used herein, “modified oligonucleotides” are intended to include substituted or modified oligonucleotides. In addition to the naturally occurring major bases adenine, guanine, cytosine, and thymine, or other natural bases such as inosine, deoxyinosine, and hypoxanthine, many other modifications are possible. For example, isosteric purine 2'-deoxyfuranoside analogs, 2'-deoxynebularine, or 2'-deoxyxanthine, or other purine and pyrimidine analogs such as 5-methylpyrimidine or 5-propynylpyrimidine, can be used to improve stability and target hybridization.

[0050] As used herein, “modified sugar” refers to a sugar that has been modified or substituted with ribose, glucose, sucrose, galactose, or any other sugar when discussing the oligonucleotide portion. Optionally, an oligonucleotide may have one or more of its sugars substituted or modified at their 2' position, i.e., 2'-alkyl or 2'-O-alkyl. An example of a 2'-O-allyl sugar is a 2'-O-methylribonucleotide. Furthermore, an oligonucleotide may have one or more of its sugars substituted or modified to form an α-anomeric sugar.

[0051] As used herein, “second-generation” oligonucleotides can be defined as oligonucleotides that are resistant to degradation by cellular nucleases and capable of specifically hybridizing to their target mRNA with an affinity equal to or higher than that of first-generation ASOs. An example of a second-generation ASO is 2'-O-(2-methoxyethyl)-RNA (2'MOE-modified polymer). For 2'-MOE-modified polymers, the 5' and 3' ends may have 2'-MOE-modified nucleotides to protect them from degradation, but the nick between the 5' and 3' ends can be an unmodified phosphodiester bond. Many other chemical modifications have been developed to improve ASOs. For example, morpholino, N3' to P5' aminophosphate, and methylphosphonate modifications are known in the art (N. Dias and CASTeiin 2002). Additionally, peptide nucleic acids (PNAs) can also be used.

[0052] Table B shows the comparison of the 16-mer truncated derivatives of SEQ ID NO:1 and their MCT4 inhibition percentage. Table B: Comparison of SEQ ID NO 1 with the 16-mer truncated form

[0053] The compounds described herein may be separate from, linked to, or combined with tracer compounds, liposomes, carbohydrate carriers, polymer carriers, or other reagents or excipients as readily apparent to those skilled in the art. In alternative embodiments, such compounds may also comprise additional pharmaceutical ingredients, wherein such compounds may be present in a pharmacologically effective amount.

[0054] As used herein, the term "drug" refers to a composition that can be administered to a patient or test subject and is capable of producing an effect in said patient or test subject. The effect may be chemical, biological, or physical, and the patient or test subject may be a human or a non-human animal, such as a rodent (e.g., a transgenic mouse, rat, or mouse), dog, cat, cow, sheep, horse, hamster, guinea pig, rabbit, or pig. A drug may comprise a single effective chemical entity or an effective chemical entity in combination with pharmaceutically acceptable excipients.

[0055] The term "pharmaceutically acceptable excipient" can include any and all physiologically compatible solvents, dispersion media, coatings, antibacterial agents, antimicrobial or antifungal agents, isotonic agents, and absorption delay agents. Excipients may be suitable for intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal, topical, or oral administration. Excipients can include sterile aqueous solutions or dispersions used for the provisional preparation of sterile injectable solutions or dispersions. The use of such media to prepare pharmaceutical products is known in the art.

[0056] Compositions or compounds according to some of the schemes described herein can be administered via any of a variety of known routes. Examples of methods suitable for administering the compounds include oral, intravenous, inhalation, intramuscular, subcutaneous, topical, intraperitoneal, rectal, or vaginal suppositories, sublingual, etc. The compounds described herein can be administered as a sterile aqueous solution where appropriate, or in the form of a lipid-soluble excipient or another solution, suspension, patch, tablet, or paste. Compositions containing the compounds described herein can be formulated for administration by inhalation. For example, the compounds can be combined with excipients to allow dispersion in an aerosol. Examples of inhalation formulations are known to those skilled in the art. Other agents may be included in combination with the compounds described herein to aid uptake or metabolism, or to delay dispersion within the host, such as in controlled-release formulations. Examples of controlled-release formulations are known to those skilled in the art and may include microcapsules, emboli within a carbohydrate or polymer matrix, etc. Other methods known in the art for preparing formulations can be found, for example, in "Remington's Pharmaceutical Sciences", (19th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa.

[0057] The dosage of some of the compositions or compounds described herein may vary depending on the route of administration (oral, intravenous, inhalation, etc.) and the form in which the composition or compound is administered (solution, controlled release, etc.). Determining an appropriate dosage is within the capabilities of those skilled in the art. As used herein, the “effective amount,” “therapeutic effective amount,” or “pharmacologically effective amount” of a compound refers to the amount of the ASO described herein present at a concentration that produces a therapeutic level delivered by using the terminology of the compound. This may depend on the mode of delivery, the time period of the dose, and the age, weight, general health condition, sex, and diet of the subject receiving the compound. Methods for determining the effective amount are known in the art. It should be understood that it may be potentially beneficial to restrict the delivery of the compounds described herein to target tissues or cells where inhibition of MCT4 expression is desired. It should also be understood that it is preferable to target the compounds described herein to the desired tissue or cell type. Therefore, the compounds described herein may be coupled to a targeting moiety. The compound may be coupled to a cellular uptake moiety. The targeting moiety may also function as a cellular uptake moiety.

[0058] Generally, the antisense oligonucleotides described herein can be used without causing significant toxicity. The toxicity of the compounds described herein can be determined using standard techniques, such as by testing and determining the ratio of the therapeutic index—the LD50 (50% lethal dose) to the LD100 (100% lethal dose)—in cell cultures or laboratory animals. However, in some cases, such as in several disease conditions, it may be appropriate to administer a significant overdose of the composition. Some of the antisense oligonucleotides described herein may be toxic at certain concentrations. Titration studies can be used to determine toxic and non-toxic concentrations. Toxicity can be evaluated by examining the specificity of a particular antisense oligonucleotide across cell lines. If the compound has any effects on other tissues, animal studies can be used to determine indications.

[0059] In some implementations, at least one antisense oligonucleotide described herein may be used, for example, but not limited to, treating cancer cells. As used herein, “at least one” is intended to mean one or more, namely 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, etc.

[0060] In some implementations, the antisense oligonucleotides described herein may, for example but not limited to, be used in combination with other treatment methods for at least one indication selected from malignancies in which elevated MCT4 expression is observed. These include, but are not limited to, prostate cancer, renal cell carcinoma, breast cancer, cervical cancer, liver cancer, bladder cancer, and small cell lung cancer in mammals including humans. In cases involving surgery, radiation (short-range radiotherapy or external beam) or other therapies (e.g., HIFU), the antisense oligonucleotides may be used as a novel adjuvant therapy (before), adjuvant therapy (during), and / or adjuvant therapy (after). For example, the MCT4 antisense oligonucleotides described herein may be used in combination with docetaxel, MDV3100, or with glucose metabolism regulators (including doxycycline or other mitochondrial inhibitors).

[0061] Methods and Materials

[0062] The following methods and materials are used in the embodiments described herein.

[0063] cell culture

[0064] Human PC-3 and DU145 CRPC cells, human LNCaP prostate cancer cells, and mouse TRAMPC2 prostate cancer cells were purchased from the American Type Culture Collection (ATCC); C4-2 CRPC cells were obtained from the Vancouver Prostate Centre (Vancouver, BC, Canada). Human monolayer cultures were maintained in RPMI-1640 (GE Healthcare Hyclone™, Logan, UT) supplemented with 10% fetal bovine serum (FBS) (GE Healthcare Hyclone™, Logan, UT), while TRAMPC2 cells were maintained in DMEM (GE Healthcare Hyclone™, Logan, UT) supplemented with 5% FBS (GE Healthcare Hyclone™, Logan, UT). For cell counting, cells were trypsinized to form single-cell suspensions and counted using a TC20 Automated Cell Counter (Bio-Rad, Hercules, CA). Cell viability was assessed by trypan blue exclusion.

[0065] Construction and immunohistochemistry of human prostate cancer tissue microarray (TMA)

[0066] TMAs were manually constructed using a variety of Gleason grade-display prostate cancer samples (n = 342) obtained from the Vancouver Prostate Centre Tissue Bank with written informed consent from patients, clinical information, and institutional research approval, as previously described (Chiang et al., 2014; Thomas et al., 2011). All samples were obtained via radical prostatectomy, except for CRPC samples obtained via transurethral resection of the prostate (TURP). Immunohistochemical staining was performed using the Ventana™ automated staining system with an enzyme-labeled biotin-streptavidin system (model Discover Discover XT™; Ventana Medical System™, Tucson, AZ) and solvent-resistant DAB Map kits (Ventana™). Staining intensity was rated by trained pathologists using a four-point scale: 0 for no staining on any tumor cells, 1 for weak or focal, questionable staining, 2 for convincingly strong staining in a few cells, and 3 for convincingly strong staining in the majority of cells.

[0067] Antibody

[0068] The following antibodies and conjugates were used: rabbit anti-MCT4 antibody (Santa Cruz™, Santa Cruz, CA; WB 1:4000, IHC 1:100), mouse anti-neoprotein antibody (Sigma™; WB 1:1000), rabbit anti-lysed caspase 3 antibody (Cell Signalling Technology™, Danvers, MA; IHC 1:50), mouse anti-Ki67 antibody (Dako™, Burlington, ON; IHC 1:50), rat anti-CD31 antibody (Dianova™, Hamburg, Germany; IHC 1:20), mouse anti-pan-T cell marker CD3 antibody (Dako™; IHC 1:50), biotinylated mouse anti-NK1.1 (Cedarlane™, Burlington, ON; IHC 1:100), and IRDye 800CW goat anti-mouse antibody (Li-Cor Biosciences™, Lincoln). NE; WB 1:10,000), IRDye 680RD goat anti-rabbit antibody (Li-Cor Biosciences™; WB 1:10,000), biotinylated goat anti-rabbit antibody (Vector Laboratories™, Burlingame, CA; IHC 1:200), biotinylated goat anti-rat antibody (Vector Laboratories™; IHC 1:200), and biotinylated goat anti-mouse antibody (Vector Laboratories™; IHC 1:200).

[0069] ASO Design and Selection

[0070] First-generation phosphate-thioester-modified ASOs targeting human MCT4 were rationally designed by selecting sequences containing favorable motifs while excluding unfavorable motifs (Matveeva et al., 2000). BLAST was used to evaluate the specificity of the MCT4-targeting sequences compared to human and mouse genes (with at least 3 mismatches in 20 bases). Ten sequences, SEQ ID Nos. 1, 4, 5, 9, 11, 30, 36, 37, 40, and 41, distributed throughout the transcript length and perfectly complementary to all human MCT4 transcript variants (NM_001042422.2, NM_001042423.2, NM_001206950.1, NM_001206951.1, NM_001206952.1, and NM_004207.3), were selected and synthesized by Eurofins MWG Operon. The knockdown efficiency of these ten ASOs was tested by measuring target mRNA and protein expression 48 hours post-transfection using qPCR and Western blotting. Two candidate ASOs (#1 and #14 - SEQ ID NO: 1 and 5, respectively) were selected for further investigation. Sequences: ASO #1 (SEQ ID NO: 1), 5'-TCCCATGGCCAGGAGGGTTG-3'; ASO #14 (SEQ ID NO: 5), 5'-AGATGCAGAAGACCACGAGG-3'; publicly disclosed non-targeted control ASO, 5'-CCTTCCCTGAAGGTTCCTCC-3' (Mullick et al., 2011; Samuel et al., 2006).

[0071] Based on common knowledge in the field and the information provided herein, those skilled in the art will be able to synthesize or modify the ASO described herein.

[0072] ASO and siRNA transfection

[0073] Following the manufacturer's instructions, transfect cells in 6-well plates with 100 nM ASO using Oligofectamine™ (Invitrogen™, Carlsbad, CA) for 48 hours (unless otherwise specified), or with Lipofectamine™ 2000 (Invitrogen™) with 50 nM M M M MCT4-targeting siRNA and a control (Dharmacon™, Chicago, IL) for 48 hours.

[0074] Quantitative PCR

[0075] Total RNA was isolated using the RNeasy Mini Kit™ (Qiagen Inc.™, Hilden, Germany), and cDNA was synthesized using the QuantiTect Reverse Transcription Kit™ (Qiagen™). Primers were designed using Primer-BLAST™. qRT-PCR reactions were performed in triplicate using the KAPA SYBR Fast Universal™ (Kapa Biosystems™, Woburn, MA) system in a ViiA 7 Real-Time PCR™ system (Applied Biosystems™, Foster City, CA). Target genes were normalized to the geometric mean of three internal reference genes (Vandesompele et al., 2002).

[0076] Protein blot

[0077] Cells were harvested and lysed in RIPA buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl, 1% Igepal, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with a complete protease inhibitor mixture (Roche, Nutley, NJ). Protein concentration of the lysates was determined using the Pierce BCA Protein Assay™ (Thermo Scientific™, Waltham, MA). Lysates were run on an 8% SDS-polyacrylamide gel (20 μg protein per lane), and proteins were transferred to PVDF membranes (Millipore™, Billerica, MA). Blots were blocked with Odyssey™ blocking buffer (Li-cor Biosciences™) and detected with anti-MCT4 antibody. Neoprotein was used as a loading control. After incubation overnight at 4°C, the primary antibody was detected with the corresponding secondary antibody and analyzed using the Odyssey Infrared Imaging System™ (Li-cor Biosciences™) and Image Studio Version 3.1™ (Li-cor Biosciences™). Density assays were performed using ImageJ (US National Institutes of Health, Bethesda, MD).

[0078] Modified Boyden chamber assay

[0079] As previously described (Chiang et al., 2014), the migration and invasion potential of PC-3 cells treated with MCT4 ASO was investigated using a modified Boyden chamber (BD Bioscience™, San Jose, CA) coated with matrix gel. Briefly, ASO-treated cells were seeded at 50,000 live cells per well in the upper chamber. The cells were then resuspended in dissociation buffer (Trevigen™, Gaithersburg, MD) containing calcein AMS (12.5 mM; Trevigen™) after 48 hours. The number of migrating / invading cells in the lower chamber was determined by fluorescence measurements of the cell suspension (485 nm excitation, 520 nm emission) using an Infinite F500 fluorometer™ (Tecan™, Männedorf, Switzerland).

[0080] Lactate and glucose determination

[0081] Lactate and glucose levels in PC-3 cells transfected with ASO for 48 hours were assessed. Cells were incubated in fresh culture medium for 4 hours. Before measuring lactate concentration using the Lactate Assay Kit (BioVision) and glucose concentration using the Glucose Assay Kit (BioVision™), samples of the culture medium were removed and deproteinized using 10K Spin Columns™ (BioVision™, Milpitas, CA). Intracellular lactate levels were measured by lysing ASO-transfected cells in MQH2O. Final concentrations were determined by normalization to the total viable cell count.

[0082] PC-3 tumor-bearing nude mice were treated with MCT4 ASO.

[0083] PC-3 cells (10⁶ cells in 1:1 HBSS:Matrix gel) were subcutaneously injected into the lateral sides of 24 male athymic nude mice (Simonsen Laboratories™, Gilroy, CA). Once the average tumor volume reached approximately 100 mm³, the mice were randomly assigned to four groups and treated daily with intraperitoneal injections of 10 mg / kg of MCT4ASO #1 (SEQ ID NO:1), #14 (SEQ ID NO:5), control ASO, or a mediator (PBS) for 5 days, followed by a 2-day treatment break, for a total of 15 days. Throughout the study, the health of the mice was monitored by measuring body weight and examining for aberrant behaviors such as lethargy, lack of hydration, and other signs of weakness. Tumor size was measured twice weekly, and tumor volume was calculated using the following formula: Volume = Length × Width × Depth × 0.5236 (mm³). Mice were sacrificed 1 hour after the final dose used for tissue harvesting.

[0084] Immunohistochemistry of tumor tissue

[0085] Tumor tissue was fixed in formalin and embedded in paraffin for immunohistochemical analysis. As previously described (Wang et al., 2005), tissue sections were probed and stained with DAB (Sigma™). For Ki-67 and lysed caspase 3 staining, images of five random fields at 400x magnification were obtained for each tumor, and cell counts were performed to determine the percentage of positively stained cells. For MCT4, images of five random fields at 200x magnification were obtained for each tumor, and staining intensity was assessed by a percentage score using the following formula: Intensity = (% area score 3) × 3 + (% area score 2) × 2 + (% area score 1) × 1. Following CD31 staining, the extent of immune cell aggregates was quantified by imaging the five most prominent regions of the aggregates at 200x magnification and determining the percentage of the field of view they occupied. The proportion of immune cells was evaluated as the positively stained area normalized to the area occupied by immune cell aggregates in the same five prominent regions.

[0086] Statistical analysis

[0087] All pooled results are presented as mean ± SEM. Statistical analyses were performed using GraphPad Prism 6™ (GraphPad Software, Inc., La Jolla, CA). Student's t-test was performed to compare means between two groups. One-way ANOVA was used, followed by Dunnett's test post-hoc to compare means between more than two groups. Two-way ANOVA was applied, followed by post-hoc multiple comparisons to compare tumor growth. Randomness tests were performed to compare staining intensity between patient cohorts on tissue microarrays. Log-rank tests were performed to compare patient survival curves. Chi-squared tests were performed to correlate MCT4 expression levels with various clinical parameters. Results with p-values ​​<0.05 were considered statistically significant. This indicates that p < 0.05. This indicates that p < 0.01 and This means p < 0.001.

[0088] Example

[0089] Example 1: Elevated MCT4 protein expression is associated with CRPC

[0090] Tissue microarrays (TMAs) composed of tissues from Gleason grade 3, 4, and 5 human prostate cancer were stained for the MCT4 protein. Figure 1A As shown in Figures B and C, Gleason grade 5 prostate cancer exhibited significantly increased MCT4 protein expression compared to Gleason grade 3 and 4 samples. Furthermore, elevated MCT4 expression was associated with earlier recurrence time as measured by increased serum PSA levels following primary treatment, with a median recurrence time of 63.3 months compared to a median of 94.2 months in the low MCT4 expression group. Figure 1C Furthermore, high MCT4 expression was associated with other clinical features related to poor prognosis, such as higher serum PSA levels at the diagnostic and clinical T stages (Table C). Additionally, elevated MCT4 protein expression was found in tumors of patients who underwent prolonged neoadjuvant hormone therapy (>6 months) and in patients with CRPC. Figure 1D (and E), indicating that elevated MCT4 protein expression in prostate cancer is associated with the development of CRPC.

[0091] Table C: Clinicopathological features associated with high MCT4 expression in patient samples

[0092] Example 2: Knockdown of MCT4 inhibits PC-3 cell proliferation

[0093] The potential therapeutic efficacy of inhibiting MCT4 expression was investigated using siRNA and ASO targeting MCT4. Human PC-3CRPC cells were used because they exhibit a distinct glycolytic metabolic profile, a property associated with MCT4 expression (Vaz et al., 2012). Figure 2A As shown, treatment of PC-3 cells with MCT4 siRNA resulted in inhibition of cell proliferation, demonstrating the potential therapeutic efficacy of the MCT4 knockdown approach. Therefore, ASOs specifically targeting human MCT4 were designed. Ten screened MCT4 ASOs revealed varying abilities to inhibit PC-3 cell proliferation and MCT4 expression, with ASOs #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) exhibiting the greatest potency. Figure 2B and 2C There was a strong correlation between decreased MCT4 mRNA levels in PC-3 cells treated with various ASOs and the resulting cell number. Figure 2D This indicates that the growth inhibition of ASO is directly related to the knockdown of MCT4.

[0094] Example 3: MCT4 ASO inhibits PC-3 cell proliferation

[0095] The growth-inhibiting activities of MCT4 ASO #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) were also characterized. Figure 2E As shown, both ASOs inhibited PC-3 cell proliferation in a dose-dependent manner, with ASO #14 (IC50 = 26 nM) being slightly more effective than ASO #1 (IC50 = 50 nM). ASOs also reduced MCT4 mRNA levels in a dose-dependent manner, reflecting their inhibitory effect on cell proliferation (IC50 ASO #14 = 32 nM, IC50 ASO #1 = 50 nM). Figure 2F As shown, even 96 hours post-transfection, both ASOs maintained their inhibitory effect on cell proliferation. Although MCT4 mRNA levels began to rise slightly 48 hours after transfection, MCT4 protein levels remained low even after 96 hours.

[0096] Example 4: MCT4 ASO exerts growth-inhibitory and MCT4-reducing effects in various human prostate cancer cell lines, but does not reduce MCT4 expression in mice.

[0097] When MCT4 ASO #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) were transfected into human C4-2 CRPC cells, they inhibited their proliferation, with IC50 values ​​comparable to those observed in PC-3 cells: ASO #1 = 40 nM and ASO #14 = 27 nM. Similarly, they reduced MCT4 expression, with ASO #1 having an IC50 value of 50 nM and ASO #14 having an IC50 value of 26 nM. Figure 3A Furthermore, when ASO was transfected into human DU145 prostate cancer cells, similar inhibitory effects on cell proliferation and MCT4 expression were observed, with nearly identical IC50 values. Figure 3B Transfection of ASO into LNCaP prostate cancer cells also showed similar inhibition of cell proliferation and MCT4 expression (Figure 7), indicating that the inhibitory effect was more associated with the glycolytic phenotype than with androgen receptor status. Importantly, transfection of MCT4 ASO #1 and #14 into mouse TRAMPC2 prostate cancer cells did not lead to a significant decrease in cell proliferation or mouse MCT4 expression. Figure 3C In summary, these results indicate that these ASOs specifically target human MCT4, and their inhibitory effect on cell proliferation is a result of MCT4 knockdown.

[0098] Example 5: Candidate MCT4 ASO inhibits glucose metabolism and tissue invasion / migration in CRPC cells in vitro.

[0099] To further investigate the effects of MCT4-targeting ASOs on prostate cancer cells, we measured their effects on lactate secretion, intracellular lactate concentration, and glucose consumption in PC-3 cells. As measured 48 hours after transfection, transfection with MCT4 ASO #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) significantly inhibited lactate secretion, correspondingly reduced intracellular lactate accumulation, and significantly decreased glucose consumption. Figure 4A In addition, such as Figure 4B As shown, ASO treatment resulted in the downregulation of various genes involved in glycolysis, namely GAPDH, PGK1, PGAM1, and ENO1. Furthermore, the expression of lactate dehydrogenase A (LDHA) was inhibited, indicating a reduction in the conversion of pyruvate to lactate. Additionally, the expression of pyruvate dehydrogenase kinase-1 (PDK1), an enzyme that removes pyruvate from the TCA cycle and promotes its conversion to lactate, was decreased. Therefore, treatment with MCT4 ASO resulted in the inhibition of aerobic glycolysis.

[0100] Treatment with MCT4 ASO also inhibited the migration and tissue invasion of PC-3 cells in the modified Boyden chamber (Fig. 8), indicating that MCT4-promoted lactate secretion may also play an important role in the metastatic process.

[0101] Example 6: Growth of PC-3 xenografts in nude mice treated with MCT4 ASO

[0102] Male athymic nude mice with subcutaneous PC-3 tumors were treated with MCT4 ASO #1 (SEQ ID NO: 1) and #14 (SEQ ID NO: 5) for 15 days. As assessed by monitoring animal weight (Fig. 9) and behavior, both ASOs significantly inhibited tumor growth. Figure 5A It does not induce major host toxicity. Immunohistochemical analysis revealed that ASO-induced tumor growth inhibition was associated with increased apoptosis (as measured by staining for lysed caspase 3) and decreased cell proliferation (as measured by Ki-67 staining). Figure 5B Reduced tumor growth is associated with decreased MCT4 protein expression. Figure 5C This is consistent with the anti-proliferative effect produced by MCT4 knockdown. Representative images of tumors from each group show strong membrane staining in control tumors, which was absent in MCT4ASO-treated tumors (micrographs not shown).

[0103] Example 7: Effects of MCT4 ASO on tumor cell aggregates in nude mice

[0104] Since lactate-induced tumor acidification is associated with the suppression of local host anticancer immunity (Choi et al., 2013), it is of interest to determine whether treatment of PC-3 tumor-bearing nude mice with MCT4 ASO induced alterations in the local host immune response in these mice, even if their immunoreactivity was very limited. To this end, aggregates of immune cells extravasating from CD31-positive vessels, particularly in the peritumor region, were quantified. Figure 6A As shown, xenografts treated with both MCT4 ASOs exhibited significantly larger aggregates of immune cells compared to control tumors. Upon examination of the micrographs, these immune aggregates revealed characteristic regions of small, round, densely packed nuclei distinct from the surrounding tumor cells, and staining against CD31 revealed that these immune cells had extravasated and surrounded blood vessels around the tumor periphery (not shown in the micrographs). Quantification of the natural killer (NK) cell population (the major cytotoxic immune cell subtype) in nude mice (Shultz et al., 2007) revealed that treatment with MCT4 ASOs significantly increased the proportion of tumor-associated NK cells. Figure 6BFurthermore, CD3 promotes NK cell activation (Koch et al., 2013), and this molecule is generally considered a T-cell marker due to its binding to the T-cell receptor complex. Its expression in NK cells can be detected by immunohistochemistry (Morice, 2007), and given the absence of T cells in nude mice, it can be used as an indicator of NK cell activation (Lanier et al., 1992). Treatment with MCT4 ASO also significantly altered the composition of immune cells present in the aggregates, and staining with the NK cell marker NK1.1 revealed an increased proportion of tumor-associated NK cells (not shown in the micrograph). Figure 6C As shown, the proportion of CD3-positive cells increased with MCT4 ASO treatment. Simultaneous staining revealed an increased proportion of tumor-associated activated NK cells associated with ASO treatment, indicating stimulation of anti-cancer immunity.

[0105] Example 8: Combination therapy with SEQ ID NO: 5

[0106] With approximate IC 50 Concentration screening was conducted to determine whether synergistic effects could be found by combining current cancer therapies (see Table D) with MCT4 ASO SEQ ID NO:5. In Figure 10 AC, the total number of viable PC3 cells was assessed 48 hours after treatment with mefenamic acid, doxycycline, and docetaxel alone, as well as in combination with MCT4 ASO SEQ ID NO:5. However, C4-2 cells were used to test MDV3100, SEQ ID NO:5, and combinations of SEQ ID NO:5 with MDV3100 (…). Figure 10D The combination of docetaxel and MCT4 ASO SEQ ID NO:5 showed a synergistic effect with a combination index of 0.780.

[0107] Table D: IC50 of SEQ ID No. 5, Mefenamic acid, Doxycycline, Docetaxel, and MDV3100 50 concentration

[0108] Although the embodiments described herein have been described in detail by illustration and example for purposes of clarity, it will be apparent to those skilled in the art, based on the teachings herein, that changes and modifications can be made thereto without departing from the spirit or scope of the appended claims. Such modifications include substitution with known equivalents of any aspect of the invention to achieve the same result in substantially the same manner. Numerical ranges include numbers that define the range. The word “comprising” is used herein as an open-ended term, substantially equivalent to the phrase “including but not limited to,” and the word “including” has the corresponding meaning. As used herein, unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “the” include plural indicators. Thus, for example, a reference to “one thing” includes more than one such thing. References herein are not an admission that such references are prior art to embodiments of the invention. The invention includes all embodiments and variations substantially as described herein and with reference to the accompanying drawings.

[0109] References

[0110] Albertsen, PC, Hanley, JA, and Fine, J. (2005). 20-year outcomes following conservative management of clinically localized prostate cancer. JAMA 293, 2095-2101.

[0111] Badrising, S., van der Noort, V., van Oort, IM, van den Berg, HP, Los, M., Hamberg, P., Coenen, JL, van den Eertwegh, AJ, de Jong, IJ, Kerver, ED, et al . (2014). Clinical activity and tolerability of enzalutamide (MDV3100) in patients with metastatic, castration-resistantprostate cancer who progress after docetaxel and abiraterone treatment. Cancer 120, 968-975.

[0112] Beltran, H., Rickman, D.S., Park, K., Chae, S.S., Sboner, A.,MacDonald, T.Y., Wang, Y., Sheikh, K.L., Terry, S., Tagawa, S.T., et al .(2011). Molecular characterization of neuroendocrine prostate cancer andidentification of new drug targets. Cancer Discov 1, 487-495.

[0113] Bishr M and Saad F. Overview of the latest treatments for castration-resistant prostate cancer. Nat Rev Urol. 2013; 10(9):522-528.

[0114] Chiang, Y.T., Wang, K., Fazli, L., Qi, R.Z., Gleave, M.E., Collins,C.C., Gout, P.W., and Wang, Y. (2014). GATA2 as a potential metastasis-driving gene in prostate cancer. Oncotarget 5, 451-461.

[0115] Choi, S.Y., Collins, C.C., Gout, P.W., and Wang, Y. (2013). Cancer-generated lactic acid: a regulatory, immunosuppressive metabolite? J Pathol230, 350-355.

[0116] Choi, S.Y., Lin, D., Gout, P.W., Collins, C.C., Xu, Y., and Wang, Y.(2014). Lessons from patient-derived xenografts for better in vitro modelingof human cancer. Adv Drug Deliv Rev 79-80, 222-237.

[0117] Claessens F, Helsen C, Prekovic S, Van den Broeck T, Spans L, VanPoppel H and Joniau S. Emerging mechanisms of enzalutamide resistance inprostate cancer. Nat Rev Urol. 2014; 11(12):712-716.

[0118] de Bono, J.S., Logothetis, C.J., Molina, A., Fizazi, K., North, S.,Chu, L., Chi, K.N., Jones, R.J., Goodman, O.B., Saad, F., et al . (2011).Abiraterone and increased survival in metastatic prostate cancer. N Engl JMed 364, 1995-2005.

[0119] Dias, N., and Stein, C.A. (2002). Antisense oligonucleotides: basicconcepts and mechanisms. Mol Cancer Ther 1, 347-355.

[0120] Dimmer, K.S., Friedrich, B., Lang, F., Deitmer, J.W., and Bröer, S.(2000). The low-affinity monocarboxylate transporter MCT4is adapted to theexport of lactate in highly glycolytic cells. Biochem J 350 Pt 1, 219-227.

[0121] Doherty, J.R., and Cleveland, J.L. (2013). Targeting lactatemetabolism for cancer therapeutics. J Clin Invest 123, 3685-3692.

[0122] Fisel, P., Kruck, S., Winter, S., Bedke, J., Hennenlotter, J., Nies,A.T., Scharpf, M., Fend, F., Stenzl, A., Schwab, M., et al . (2013). DNAmethylation of the SLC16A3 promoter regulates expression of the human lactatetransporter MCT4in renal cancer with consequences for clinical outcome. ClinCancer Res 19, 5170-5181.

[0123] Gerlinger, M., Santos, C.R., Spencer-Dene, B., Martinez, P.,Endesfelder, D., Burrell, R.A., Vetter, M., Jiang, M., Saunders, R.E., Kelly,G., et al. (2012). Genome-wide RNA interference analysis of renal carcinomasurvival regulators identifies MCT4as a Warburg effect metabolic target. JPathol 227, 146-156.

[0124] Gravel, S.P., Andrzejewski, S., Avizonis, D., and St-Pierre, J.(2014a). Stable isotope tracer analysis in isolated mitochondria frommammalian systems. Metabolites 4, 166-183.

[0125] Gravel, S.P., Hulea, L., Toban, N., Birman, E., Blouin, M.J.,Zakikhani, M., Zhao, Y., Topisirovic, I., St-Pierre, J., and Pollak, M.(2014b). Serine deprivation enhances antineoplastic activity of biguanides.Cancer Res 74, 7521-7533.

[0126] Halestrap, A.P. (2013). The SLC16 gene family - structure, role andregulation in health and disease. Mol Aspects Med 34, 337-349.

[0127] Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the nextgeneration. Cell 144, 646-674.

[0128] Hao, J., Chen, H., Madigan, M.C., Cozzi, P.J., Beretov, J., Xiao, W.,Delprado, W.J., Russell, P.J., and Li, Y. (2010). Co-expression of CD147(EMMPRIN), CD44v3-10, MDR1 and monocarboxylate transporters is associatedwith prostate cancer drug resistance and progression. Br J Cancer 103, 1008-1018.

[0129] Jadvar, H. (2009). Molecular imaging of prostate cancer with 18F-fluorodeoxyglucose PET. Nat Rev Urol 6, 317-323.

[0130] Koch, J., Steinle, A., Watzl, C., and Mandelboim, O. (2013).Activating natural cytotoxicity receptors of natural killer cells in cancerand infection. Trends Immunol 34, 182-191.

[0131] Koochekpour, S., Majumdar, S., Azabdaftari, G., Attwood, K.,Scioneaux, R., Subramani, D., Manhardt, C., Lorusso, G.D., Willard, S.S.,Thompson, H., et al. (2012). Serum Glutamate Levels Correlate with GleasonScore and Glutamate Blockade Decreases Proliferation, Migration, and Invasionand Induces Apoptosis in Prostate Cancer Cells. Clin Cancer Res 18, 5888-5901.

[0132] Lanier, L.L., Chang, C., Spits, H., and Phillips, J.H. (1992).Expression of cytoplasmic CD3 epsilon proteins in activated human adultnatural killer (NK) cells and CD3 gamma, delta, epsilon complexes in fetal NKcells. Implications for the relationship of NK and T lymphocytes. J Immunol149, 1876-1880.

[0133] Lin D, Gout PW and Wang Y. Lessons from in-vivo models of castration-resistant prostate cancer. Curr Opin Urol. 2013; 23(3):214-219.

[0134] Lisanti, M.P., Sotgia, F., Pestell, R.G., Howell, A., and Martinez-Outschoorn, U.E. (2013). Stromal glycolysis and MCT4are hallmarks of DCISprogression to invasive breast cancer. Cell Cycle 12, 2935-2936.

[0135] Loriot, Y., Bianchini, D., Ileana, E., Sandhu, S., Patrikidou, A.,Pezaro, C., Albiges, L., Attard, G., Fizazi, K., De Bono, J.S., et al .(2013). Antitumour activity of abiraterone acetate against metastaticcastration-resistant prostate cancer progressing after docetaxel andenzalutamide (MDV3100). Ann Oncol 24, 1807-1812.

[0136] Manning Fox, J.E., Meredith, D., and Halestrap, A.P. (2000).Characterisation of human monocarboxylate transporter 4 substantiates itsrole in lactic acid efflux from skeletal muscle. J Physiol 529 Pt 2, 285-293.

[0137] Marchiq, I., Le Floch, R., Roux, D., Simon, M.P., and Pouyssegur, J.(2015). Genetic Disruption of Lactate / H+ Symporters (MCTs) and Their SubunitCD147 / BASIGIN Sensitizes Glycolytic Tumor Cells to Phenformin. Cancer Res 75,171-180.

[0138] Matveeva, O.V., Tsodikov, A.D., Giddings, M., Freier, S.M., Wyatt,J.R., Spiridonov, A.N., Shabalina, S.A., Gesteland, R.F., and Atkins, J.F.(2000). Identification of sequence motifs in oligonucleotides whose presenceis correlated with antisense activity. Nucleic Acids Res 28, 2862-2865.

[0139] Morice, W.G. (2007). The immunophenotypic attributes of NK cells andNK-cell lineage lymphoproliferative disorders. Am J Clin Pathol 127, 881-886.

[0140] Mullick, A.E., Fu, W., Graham, M.J., Lee, R.G., Witchell, D., Bell,T.A., Whipple, C.P., and Crooke, R.M. (2011). Antisense oligonucleotidereduction of apoB-ameliorated atherosclerosis in LDL receptor-deficient mice.J Lipid Res 52, 885-896.

[0141] Nadal, R., Schweizer, M., Kryvenko, O.N., Epstein, J.I., andEisenberger, M.A. (2014). Small cell carcinoma of the prostate. Nat Rev Urol11, 213-219.

[0142] Ning, Y.M., Pierce, W., Maher, V.E., Karuri, S., Tang, S.H., Chiu,H.J., Palmby, T., Zirkelbach, J.F., Marathe, D., Mehrotra, N., et al . (2013).Enzalutamide for treatment of patients with metastatic castration-resistantprostate cancer who have previously received docetaxel: U.S. Food and DrugAdministration drug approval summary. Clin Cancer Res 19, 6067-6073.

[0143] Ohno, A., Yorita, K., Haruyama, Y., Kondo, K., Kato, A., Ohtomo, T.,Kawaguchi, M., Marutuska, K., Chijiiwa, K., and Kataoka, H. (2014). Aberrantexpression of monocarbohydrate transporter 4 (MCT4) in tumor cells predictsan unfavorable outcome in patients with hepatocellular carcinoma. Liver Int.

[0144] Ovens, M.J., Davies, A.J., Wilson, M.C., Murray, C.M., and Halestrap,A.P. (2010). AR-C155858 is a potent inhibitor of monocarboxylate transportersMCT1 and MCT2 that binds to an intracellular site involving transmembranehelices 7-10. Biochem J 425, 523-530.

[0145] Pan WH, Clawson GA. Identifying accessible sites in RNA: the firststep in designing antisense reagents. Curr Med Chem. 2006;13(25):3083-103.

[0146] Parks, S.K., Chiche, J., and Pouysségur, J. (2013). Disrupting protondynamics and energy metabolism for cancer therapy. Nat Rev Cancer 13, 611-623.

[0147] Patzel V. In silico selection of active siRNA. Drug Discov Today.2007 Feb;12(3-4):139-48.

[0148] Peek AS, Behlke MA. Design of active small interfering RNAs. CurrOpin Mol Ther. 2007 Apr;9(2):110-8.

[0149] Pértega-Gomes, N., Vizcaíno, J.R., Miranda-Gonçalves, V., Pinheiro,C., Silva, J., Pereira, H., Monteiro, P., Henrique, R.M., Reis, R.M., Lopes,C., et al . (2011). Monocarboxylate transporter 4 (MCT4) and CD147overexpression is associated with poor prognosis in prostate cancer. BMCCancer 11, 312.

[0150] Petrylak DP, Tangen CM, Hussain MH, Lara PN, Jr., Jones JA, TaplinME, Burch PA, Berry D, Moinpour C, Kohli M, Benson MC, Small EJ, Raghavan Dand Crawford ED. Docetaxel and estramustine compared with mitoxantrone andprednisone for advanced refractory prostate cancer. N Engl J Med. 2004; 351(15):1513-1520.

[0151] Samuel, V.T., Choi, C.S., Phillips, T.G., Romanelli, A.J., Geisler,J.G., Bhanot, S., McKay, R., Monia, B., Shutter, J.R., Lindberg, R.A., et al .(2006). Targeting foxo1 in mice using antisense oligonucleotide improveshepatic and peripheral insulin action. Diabetes 55, 2042-2050.

[0152] Sanità, P., Capulli, M., Teti, A., Galatioto, G.P., Vicentini, C.,Chiarugi, P., Bologna, M., and Angelucci, A. (2014). Tumor-stroma metabolicrelationship based on lactate shuttle can sustain prostate cancerprogression. BMC Cancer 14, 154.

[0153] Shultz, L.D., Ishikawa, F., and Greiner, D.L. (2007). Humanized micein translational biomedical research. Nat Rev Immunol 7, 118-130.

[0154] Siegel, R.L., Miller, K.D., and Jemal, A. (2015). Cancer statistics,2015. CA Cancer J Clin 65, 5-29.

[0155] Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, OudardS, Theodore C, James ND, Turesson I, Rosenthal MA and Eisenberger MA.Docetaxel plus prednisone or mitoxantrone plus prednisone for advancedprostate cancer. N Engl J Med. 2004; 351(15):1502-1512.

[0156] Tennakoon, J.B., Shi, Y., Han, J.J., Tsouko, E., White, M.A., Burns,A.R., Zhang, A., Xia, X., Ilkayeva, O.R., Xin, L., et al . (2014). Androgensregulate prostate cancer cell growth via an AMPK-PGC-1α-mediated metabolicswitch. Oncogene 33, 5251-5261.

[0157] Thomas, C., Zoubeidi, A., Kuruma, H., Fazli, L., Lamoureux, F.,Beraldi, E., Monia, B.P., MacLeod, A.R., Thüroff, J.W., and Gleave, M.E.(2011). Transcription factor Stat5 knockdown enhances androgen receptordegradation and delays castration-resistant prostate cancer progression invivo. Mol Cancer Ther 10, 347-359.

[0158] Ullah, M.S., Davies, A.J., and Halestrap, A.P. (2006). The plasmamembrane lactate transporter MCT4, but not MCT1, is up-regulated by hypoxiathrough a HIF-1alpha-dependent mechanism. J Biol Chem 281, 9030-9037.

[0159] Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N.,De Paepe, A., and Speleman, F. (2002). Accurate normalization of real-timequantitative RT-PCR data by geometric averaging of multiple internal controlgenes. Genome Biol 3, RESEARCH0034.

[0160] Vaz, C.V., Alves, M.G., Marques, R., Moreira, P.I., Oliveira, P.F.,Maia, C.J., and Socorro, S. (2012). Androgen-responsive and nonresponsiveprostate cancer cells present a distinct glycolytic metabolism profile. Int JBiochem Cell Biol 44, 2077-2084.

[0161] Wang, Y., Xue, H., Cutz, J.C., Bayani, J., Mawji, N.R., Chen, W.G.,Goetz, L.J., Hayward, S.W., Sadar, M.D., Gilks, C.B., et al . (2005). Anorthotopic metastatic prostate cancer model in SCID mice via grafting of atransplantable human prostate tumor line. Lab Invest 85, 1392-1404.

[0162] Warburg, O. (1956). On respiratory impairment in cancer cells.Science 124, 269-270.

[0163] Yuan, T.C., Veeramani, S., and Lin, M.F. (2007). Neuroendocrine-likeprostate cancer cells: neuroendocrine transdifferentiation of prostateadenocarcinoma cells. Endocr Relat Cancer 14, 531-547.

[0164] Zhang, Y., and Yang, JM (2013). Altered energy metabolism incancer: a unique opportunity for therapeutic intervention. Cancer Biol Ther14, 81-89.

[0165] The implementation scheme of this application is described by the following scheme.

[0166] 1. An antisense oligonucleotide (ASO), wherein the oligonucleotide has a sequence selected from the following: (a) TCCCATGGCCAGGAGGGTTG (SEQ ID NO: 1); (b) AGATGCAGAAGACCACGAGG (SEQ ID NO:5); (c) ATGGCCAGGAGGGTTG (SEQ ID NO:46); (d) CATGGCCAGGAGGGTT (SEQ ID NO:47); (e) CCATGGCCAGGAGGGT (SEQ ID NO:48); and (f) CCCATGGCCAGGAGGG (SEQ ID NO:49).

[0167] 2. The ASO as described in embodiment 1, wherein the ASO further comprises a modified nucleoside interlinking bond.

[0168] 3. The ASO as described in Embodiment 2, wherein the modified internucleotide link is a peptide-nucleic acid link, a morpholino link, an N3' to P5' aminophosphate link, a methylphosphonate link, or a thiophosphate link.

[0169] 4. The ASO as described in embodiment 1, wherein the ASO further comprises a modified sugar moiety.

[0170] 5. The ASO as described in embodiment 4, wherein the modified sugar moiety is 2'-O-alkylribose.

[0171] 6. The ASO as described in embodiment 1, wherein the ASO has a 2'MOE notched polymer modification.

[0172] 7. The ASO as described in Embodiment 1, wherein the ASO further comprises modified nucleobases.

[0173] 8. The ASO as described in Embodiment 7, wherein the modified nucleobase is 5-methylpyrimidine or 5-propynylpyrimidine.

[0174] 9. The ASO as described in any one of embodiments 1-8, used for treating cancer, wherein the cancer is characterized by elevated MCT4 expression, and wherein the cancer is prostate cancer.

[0175] 10. A pharmaceutical composition comprising (a) an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49; and (b) a pharmaceutically acceptable carrier.

[0176] 11. The pharmaceutical composition of embodiment 10, wherein the ASO further comprises a modified nucleoside interlinking bond.

[0177] 12. The pharmaceutical composition of embodiment 11, wherein the modified internucleotide link is a peptide-nucleic acid link, a morpholino link, an N3' to P5' aminophosphate link, a methylphosphonate link, or a thiophosphate link.

[0178] 13. The pharmaceutical composition of embodiment 10, wherein the ASO further comprises a modified sugar moiety.

[0179] 14. The pharmaceutical composition of embodiment 12, wherein the ASO further comprises a modified sugar moiety.

[0180] 15. The pharmaceutical composition of embodiment 14, wherein the modified sugar moiety is 2'-O-alkylribose.

[0181] 16. The pharmaceutical composition of embodiment 10, wherein the ASO has a 2'MOE notched polymer modification.

[0182] 17. The pharmaceutical composition of embodiment 10, wherein the ASO further comprises a modified nucleobase.

[0183] 18. The pharmaceutical composition of embodiment 14, wherein the modified nucleobase is 5-methylpyrimidine or 5-propynylpyrimidine.

[0184] 19. A reagent kit comprising: a. ASO, which has a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49; and b. Instructions for use in the treatment of cancer, wherein the cancer is characterized by elevated MCT4 expression and wherein the cancer is prostate cancer.

[0185] 20. The kit as described in embodiment 19, wherein the prostate cancer is castration-resistant prostate cancer (CRPC).

[0186] 21. Use of an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49 in the preparation of a medicament for treating cancer, wherein the cancer is characterized by elevated MCT4 expression, and wherein the cancer is prostate cancer.

[0187] 22. The use as described in embodiment 21, wherein the ASO further comprises a modified nucleoside interlinking bond.

[0188] 23. The use as described in embodiment 22, wherein the modified nucleoside internucleotide link is a peptide-nucleic acid link, a morpholino link, an N3' to P5' aminophosphate link, a methylphosphonate link, or a thiophosphate link.

[0189] 24. The use as described in embodiment 21, wherein the ASO further comprises a modified sugar fraction.

[0190] 25. The use as described in embodiment 24, wherein the modified sugar moiety is 2'-O-alkylribose.

[0191] 26. The use as described in embodiment 21, wherein the ASO has a 2'MOE notched polymer modification.

[0192] 27. The use as described in embodiment 21, wherein the ASO further comprises a modified nucleobase.

[0193] 28. The use as described in embodiment 27, wherein the modified nucleobase is 5-methylpyrimidine or 5-propynylpyrimidine.

[0194] 29. The use as described in embodiment 21, wherein the prostate cancer is castration-resistant prostate cancer (CRPC).

[0195] 30. The use as described in embodiment 29, wherein the prostate cancer is nenzalutamide (ENZ) CRPC.

[0196] 31. The use as described in embodiment 21, wherein the ASO is complementary to the mRNA of MCT4.

[0197] 32. The use as described in embodiment 21, wherein the ASO is administered intravenously.

[0198] 33. The use as described in embodiment 21, wherein the ASO is applied topically to the tissue.

[0199] 34. The use as described in embodiment 21, wherein the ASO is mixed with lipid particles prior to application.

[0200] 35. The use as described in embodiment 21, wherein the ASO is encapsulated in liposomes prior to application.

[0201] 36. Use of a combination comprising (a) an antisense oligonucleotide (ASO) and (b) docetaxel in the preparation of a medicament for treating prostate cancer, said antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49.

Claims

1. An antisense oligonucleotide (ASO), wherein the oligonucleotide has a sequence selected from the following: (a) TCCCATGGCCAGGAGGGTTG (SEQ ID NO: 1); (b) AGATGCAGAAGACCACGAGG (SEQ ID NO:5); (c) ATGGCCAGGAGGGTTG (SEQ ID NO:46); (d) CATGGCCAGGAGGGTT (SEQ ID NO:47); (e) CCATGGCCAGGAGGGT (SEQ ID NO:48); and (f) CCCATGGCCAGGAGGG (SEQ ID NO:49).

2. The ASO of claim 1, wherein the ASO further comprises a modified nucleoside internucleotide bond.

3. The ASO of claim 2, wherein the modified internucleotide link is a peptide-nucleic acid link, a morpholino link, an N3' to P5' aminophosphate link, a methylphosphonate link, or a thiophosphate link.

4. The ASO of claim 1, wherein the ASO further comprises a modified sugar moiety.

5. The ASO of claim 4, wherein the modified sugar moiety is 2'-O-alkylribose.

6. The ASO of claim 1, wherein the ASO has a 2'MOE notched polymer modification.

7. The ASO of claim 1, wherein the ASO further comprises modified nucleobases.

8. The ASO of claim 7, wherein the modified nucleobase is 5-methylpyrimidine or 5-propynylpyrimidine.

9. The ASO of any one of claims 1-8, used for treating cancer, wherein the cancer is characterized by elevated MCT4 expression, and wherein the cancer is prostate cancer.

10. A pharmaceutical composition comprising (a) an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49; and (b) a pharmaceutically acceptable carrier.

11. The pharmaceutical composition of claim 10, wherein the ASO further comprises a modified nucleoside interlinking bond.

12. The pharmaceutical composition of claim 11, wherein the modified internucleotide link is a peptide-nucleic acid link, a morpholino link, an N3' to P5' aminophosphate link, a methylphosphonate link, or a thiophosphate link.

13. The pharmaceutical composition of claim 10, wherein the ASO further comprises a modified sugar moiety.

14. The pharmaceutical composition of claim 12, wherein the ASO further comprises a modified sugar moiety.

15. The pharmaceutical composition of claim 14, wherein the modified sugar moiety is 2'-O-alkylribose.

16. The pharmaceutical composition of claim 10, wherein the ASO has a 2'MOE notched polymer modification.

17. The pharmaceutical composition of claim 10, wherein the ASO further comprises a modified nucleobase.

18. The pharmaceutical composition of claim 14, wherein the modified nucleobase is 5-methylpyrimidine or 5-propynylpyrimidine.

19. A reagent kit comprising: a. ASO, which has a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49; and b. Instructions for use in the treatment of cancer, wherein the cancer is characterized by elevated MCT4 expression and wherein the cancer is prostate cancer.

20. The kit of claim 19, wherein the prostate cancer is castration-resistant prostate cancer (CRPC).

21. Use of an antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49 in the preparation of a medicament for treating cancer, wherein the cancer is characterized by elevated MCT4 expression and the cancer is prostate cancer.

22. The use as claimed in claim 21, wherein the ASO further comprises a modified nucleoside interlinking bond.

23. The use as described in claim 22, wherein the modified internucleotide link is a peptide-nucleic acid link, a morpholino link, an N3' to P5' aminophosphate link, a methylphosphonate link, or a thiophosphate link.

24. The use as claimed in claim 21, wherein the ASO further comprises a modified sugar portion.

25. The use as claimed in claim 24, wherein the modified sugar moiety is 2'-O-alkylribose.

26. The use as claimed in claim 21, wherein the ASO has a 2'MOE notched polymer modification.

27. The use as claimed in claim 21, wherein the ASO further comprises a modified nucleobase.

28. The use as claimed in claim 27, wherein the modified nucleobase is 5-methylpyrimidine or 5-propynylpyrimidine.

29. The use as claimed in claim 21, wherein the prostate cancer is castration-resistant prostate cancer (CRPC).

30. The use as claimed in claim 29, wherein the prostate cancer is nenzalutamide (ENZ) CRPC.

31. The use as described in claim 21, wherein the ASO is complementary to the mRNA of MCT4.

32. The use as claimed in claim 21, wherein the ASO is administered intravenously.

33. The use as claimed in claim 21, wherein the ASO is applied topically to the tissue.

34. The use as claimed in claim 21, wherein the ASO is mixed with lipid particles prior to application.

35. The use as claimed in claim 21, wherein the ASO is encapsulated in liposomes prior to application.

36. Use of a combination comprising (a) an antisense oligonucleotide (ASO) and (b) docetaxel in the preparation of a medicament for treating prostate cancer, said antisense oligonucleotide (ASO) having a sequence selected from one or more of SEQ ID NO: 1, 5 and 46-49.

Images