A gene editing system for treating type v osteogenesis imperfecta and application thereof

Abstract

This disclosure relates to a gene editing system for treating osteogenesis imperfecta type V and its applications. This disclosure provides a gene therapy strategy for human osteogenesis imperfecta type V (OI5). This is achieved by designing specific targeting... IFITM5 The guide RNA for the c.-14C>T gene mutation was precisely corrected in induced pluripotent stem cells derived from the patient using the CRISPR / Cas9 system. After correction, the cells, following in vitro differentiation with MSCs and osteogenic induction, showed restored mineralization capacity and osteogenic gene expression to normal levels, demonstrating normal osteogenic biological function. The gene editing system, gene-repair cells, and their preparation methods disclosed in this disclosure provide new technological means and a clinical translational basis for the treatment of OI5.

Description

Technical Field

[0001] This disclosure pertains to the field of gene therapy and regenerative medicine, specifically relating to a method for repairing hotspot pathogenic gene mutations in osteogenesis imperfecta Type V (OI5) based on CRISPR / Cas9 gene editing technology. IFITM5 Methods, compositions, and applications of the gene c.-14C>T in the preparation of products for the treatment of osteogenesis imperfecta type V. Background Technology

[0002] OI5 is a rare autosomal dominant inherited bone disease, mainly caused by... IFITM5 The specific point mutation c.-14C>T in the 5' untranslated region of the gene causes [1, 2]. This mutation produces a new upstream start codon, leading to an abnormal N-terminus extension of 5 amino acids (MALEP) of the encoded bone-restricting membrane protein BRIL, resulting in increased bone fragility, recurrent fractures, and progressive skeletal deformities (radial head dislocation, forearm interosseous membrane calcification, and hypertrophic callus, etc.) [3]. Currently, the clinical management of OI5 is limited to symptomatic and supportive treatment, such as fracture fixation, surgical correction, and bisphosphonate intervention, and cannot cure the underlying cause [4, 5]. Almost all reported OI5 patients worldwide are heterozygous for the mutated IFITM5: c.-14C>T, so developing a universal gene therapy strategy targeting this mutation site has irreplaceable clinical value and commercial prospects. Summary of the Invention

[0003] gRNA In view of the needs of the art, this disclosure provides a gRNA, wherein the gRNA targets IFITM5 The gene c.-14C>T mutation site.

[0004] gRNA, or guide RNA, is a core RNA molecule in the CRISPR / Cas9 system. Its 5' guide region specifically binds to target DNA sites in the genome through base pairing, guiding the Cas9 nuclease to cleave the target DNA at specific sites. In this disclosure, unless otherwise specified, gRNA specifically refers to the segment that specifically binds to the target gene.

[0005] Target genes (also known as target genes or goal genes) refer to the genes to be bound, cleaved, corrected, or regulated in gene editing, gene therapy, and nucleic acid drug development. They are the specific targets recognized and bound by nucleic acid molecules (gRNA, siRNA, antisense nucleic acids, etc.). The target genes in this disclosure are... IFITM5 Genes or fragments thereof, especially pathogenic point mutations of c.-14C>T.

[0006] In some implementations, the gRNA comprises or is shown in SEQ ID No: 48.

[0007] Gene editing system This disclosure provides a method for repair IFITM5 A gene editing system for the c.-14C>T mutation, comprising: 1) The aforementioned gRNA; 2) Cas9 protein.

[0008] This disclosure also provides a method for repair IFITM5 A gene editing system for the c.-14C>T mutation, comprising: 1) The expression vector for the aforementioned gRNA; 2) Expression vectors for Cas9 protein.

[0009] In some embodiments, the gene editing system of this disclosure optionally includes a donor template, which provides normal... IFITM5 Gene fragments.

[0010] The donor template is a wild-type normal IFITM5 Nucleic acid fragments of gene sequences. After a Cas9-mediated DNA double-strand break occurs in a cell, the homology-directed repair (HDR) mechanism replaces the mutated base with this template, achieving precise repair of the mutation.

[0011] There is no absolute numerical limit to the minimum length requirement for donor templates; the lower limit is usually determined by the length of the homologous arms, which varies depending on the type of donor. For single-stranded oligonucleotide donors: theoretically, a 30 nt homologous arm on one side and 30 nt on each side are generally considered sufficient for recognition; most laboratories use a lower limit of 35 to 40 nt on one side (35 nt on each side, totaling 70 nt homologous sequence), which can be stably edited in most cell lines. The upper limit for synthesis is generally within 200 nt. For linear dsDNA: the lowest observable lower limit is a 50 bp homologous arm on one side (50 bp on each side). For circular plasmid donors, the lowest effective homologous arm is 300 bp on one side, and routine experiments typically use 600–900 bp on one side.

[0012] In one specific embodiment of this disclosure, for repairing single-base mutations, the minimum length of the functional donor template is 70 to 80 nt (with the left or right homologous arm being no less than 30 nt, preferably no less than 35 nt).

[0013] In one specific embodiment of this disclosure, the shortest donor template is, for example, but not limited to, that shown in SEQ ID No: 47.

[0014] In some embodiments, the donor template includes at least positions 35 to 95, 34 to 95, 33 to 95, 32 to 95, 31 to 95, 30 to 95, 29 to 95, 28 to 95, 27 to 95, 26 to 95, 25 to 95, 24 to 95, 23 to 95, 22 to 95, 21 to 95, 20 to 95, ... of the oligonucleotide shown in SEQ ID No: 44. Positions 19 to 95, 18 to 95, 17 to 95, 16 to 95, 15 to 95, 14 to 95, 13 to 95, 12 to 95, 11 to 95, 10 to 95, 9 to 95, 8 to 95, 7 to 95, 6 to 95, 5 to 95, 4 to 95, 3 to 95, 2 to 95, 1 to 95.

[0015] In a preferred embodiment, the donor template is 95 bp in length. The donor template is a single-stranded oligonucleotide (ssODN), the sequence of which is shown in SEQ ID No: 44.

[0016] In some embodiments, the donor template contains at least the oligonucleotide shown in SEQ ID No: 44.

[0017] In some implementations, the gRNA expression vector and the Cas9 expression vector are in the same vector, i.e., a single-vector system.

[0018] As an example, a vector can contain two independent transcriptional elements: a first promoter (such as, but not limited to, CMV, EF1α) initiates the Cas9 coding sequence to express the Cas9 protein; a second promoter (such as, but not limited to, U6 / H1) initiates gRNA to transcribe guide RNA. Single-vector systems only require transfection or transformation of one plasmid, simplifying operation and increasing transfection efficiency; Cas9 and gRNA are synchronized, resulting in stable editing efficiency. However, the plasmid backbone is larger, increasing the difficulty of inserting large fragments, and the amount of Cas9 or gRNA cannot be adjusted individually; their ratio is fixed.

[0019] In some implementations, the gRNA expression vector and the Cas9 expression vector are separate vectors, i.e., a dual-vector system (the Cas9 vector and the gRNA vector are two separate plasmids).

[0020] As an example, the first expression vector contains only the Cas9 expression cassette, and the second expression vector contains only the gRNA transcription cassette. Cells are co-transfected with both plasmids. The dual-vector system allows for flexible adjustment of the ratio of the two vectors to optimize knockout efficiency and reduce off-target effects; it also offers more favorable viral packaging capacity. However, co-transfecting two plasmids reduces the efficiency of cells simultaneously taking up both vectors; an imbalance in the copy numbers of the two vectors can lead to an imbalance in the Cas9 and gRNA ratio, potentially reducing editing activity.

[0021] Whether it is a single-carrier system or a dual-carrier system, technicians can make selections and adjustments based on existing technologies.

[0022] Cas9 is common in the art and is commercially available. As examples, the Cas9 protein includes, but is not limited to, SpCas9, HiFi Cas9, eSpCas9 (1.1), SpCas9-HF1, SpCas9-HF2, CjCas9, evoCas9, HypaCas9, miCas9, NmCas9, St1Cas9, St2Cas9, TdCas9, FnCas9, Sniper-Cas9, SuperFi-Cas9, SpCas9-NG, SpCas9-VQR, SpCas9-VRER, SpCas9-EQR, SpCas9-D1135E, xCas9, SpRYCas9, SaCas9, SaCas9-HF, ScCas9, KKH-SaCas9, SpCas9 nickase variant D10A, SpCas9 nickase variant H840A, and SpCas9 nickase variant D10A+H840A. In a specific embodiment, HiFi Cas9 high-fidelity Cas9 was used.

[0023] Expression vectors for Cas9 and gRNA are common in the art and are commercially available. As some examples, expression vectors are selected from, but are not limited to: pX330, pX458, lentiCRISPR v2, lentiCas9-Blast, lentiGuide-Puro, and pSpCas9(BB)-2A-GFP. pX330 (pX330-U6-Chimeric_BB-CBh-hSpCas9) is an all-in-one single plasmid vector (Cas9 and gRNA in the same vector); pX458 (pSpCas9(BB)-2A-GFP) contains Cas9 from Streptococcus pyogenes with 2A-enhanced green fluorescent protein, along with a clonal backbone for single guide RNA. Those skilled in the art can choose appropriate existing technology vectors that demonstrate Cas9 and gRNA expression functionality in target cells.

[0024] In some implementations, the donor template in the gene editing system is a double-stranded oligonucleotide.

[0025] Pharmaceutical uses This disclosure provides the use of the aforementioned gRNA in the preparation of a drug for the treatment of osteogenesis imperfecta type V.

[0026] This disclosure also provides the use of the aforementioned gene-editing system in the preparation of a drug for the treatment of osteogenesis imperfecta type V.

[0027] The medicament disclosed herein can be conveniently presented in unit dosage form. It includes the step of associating the active ingredient with a pharmaceutically acceptable excipient. Generally, the medicament of this disclosure can be formulated into any suitable dosage form, such as, but not limited to, injections.

[0028] Methods to repair genes This disclosure also provides a repair IFITM5 An in vitro method for detecting the c.-14C>T mutation in the gene, including the following steps: 1) Provide the aforementioned for repair IFITM5 Gene editing systems with c.-14C>T mutations. 2) Introduce the gene editing system into the target cells.

[0029] Gene delivery methods available for gene editing systems (Cas9 / gRNA / donor DNA) include, but are not limited to: chemical transfection, viral delivery, physical transfection, and microbial-mediated delivery.

[0030] Examples of chemical transfection include: • Liposome transfection: Cationic lipids encapsulate plasmid DNA to form a lipid complex, which then enters the cell via endocytosis through the cell membrane.

[0031] • Calcium phosphate coprecipitation transfection: DNA forms tiny precipitate particles with Ca3(PO4)2, which are then phagocytosed by cells.

[0032] ·PEI polyethyleneimine transfection.

[0033] Examples of viral vector delivery include: lentiviruses, such as the lentiCRISPR family of vectors; adenoviruses; adeno-associated viruses; and retroviruses.

[0034] Examples of physical transfection include: electroporation; microinjection; gene gun; ultrasound transfection; and laser transfection.

[0035] In some implementations, the target cells carry IFITM5 Gene c.-14C>T mutation.

[0036] In some implementations, the target cells are derived from subjects with osteogenesis imperfecta type V.

[0037] In some implementations, the target cells are in the form of iPSCs. iPSCs (induced pluripotent stem cells) are pluripotent stem cells obtained by inducing patient somatic cells through reprogramming factors. They possess unlimited proliferation and tri-germ layer differentiation potential, and can be directed to differentiate into osteoblasts in vitro, serving as cell carriers for gene repair of hereditary bone diseases.

[0038] The target cells are induced into iPSCs before being introduced.

[0039] In some implementations, the method of this disclosure further includes the steps of: 3) Induce mesenchymal stem cell induction in the cells obtained in step 2); 4) The cells obtained in step 3) are subjected to osteogenic induction differentiation.

[0040] After gene repair, iPSCs are induced to differentiate into mesenchymal stem cells (MSCs). These MSCs are then further directed to osteogenic differentiation to obtain functional osteoblasts. Methods for iPSC induction, iPSC differentiation into MSCs, and osteogenic differentiation are all well-known in the art. As an example, MSCs are treated with an induction medium containing sodium glycerophosphate, ascorbic acid, and dexamethasone to induce their directed differentiation into mature osteoblasts capable of mineralizing and synthesizing bone matrix.

[0041] In some embodiments, the molar ratio of the gRNA to the Cas9 protein is 1:1 to 5:1, preferably 2:1.

[0042] In some embodiments, the molar ratio of the gRNA expression vector to the Cas9 expression vector is 1:1 to 5:1, preferably 2:1.

[0043] In some embodiments, incubation of the gRNA and the Cas9 protein can form a complex.

[0044] In some embodiments, incubation of the gRNA expressed by the gRNA expression vector and the Cas9 expressed by the Cas9 expression vector can form a complex.

[0045] In some implementations, the gRNA and Cas9 protein in the gene editing system first form a complex before being introduced into the target cells.

[0046] In other embodiments, before the gRNA expression vector and the Cas9 expression vector are introduced into the target cells, the gRNA and Cas9 protein expressed by the expression vector form a complex within the target cells after entering the cells.

[0047] In some embodiments, the molar ratio of the donor template to the complex is 1:1 to 10:1, preferably 5:1.

[0048] In some implementation schemes, each 1×10 6 Each iPSC contacts 2 μg to 5 μg of the complex and 1 μg to 3 μg of the donor template.

[0049] In the specific implementation plan, each 1×10 6 Each iPSC contacted 3 μg of the complex and 2 μg of the donor template. Attached Figure Description

[0050] Figure 1 : IFITM5 A schematic diagram of the structural changes of the c.-14C>T mutant protein, showing a comparison between the wild-type (left) BRIL protein and the mutant (right) protein containing MALEP extension.

[0051] Figures 2A to 2C Identification of iPSCs cell models derived from OI5 patients.

[0052] Figure 2A iPSCs clone bright-field morphology diagram; Figure 2B Immunofluorescence staining image of pluripotency markers; Figure 2C HE staining results of teratoma trilayer differentiation experiment.

[0053] Figures 3A to 3B : A schematic diagram of gRNA design strategy and gene editing system, illustrating the role of gRNA in gene editing. IFITM5 Binding patterns at gene mutation sites and the working principle of repair templates.

[0054] Figure 3B The excerpt is shown as an example only: 5'...ACCAGTCTGAGTGTGAAGAGAGATGGCGCTGGAACCCATGGAC...3'; SEQ IDNo: 45 5'...ACCAGTCTGAGTGTGAAGAGAGACGGCGCTGGAACCCATGGAC...3'; SEQ ID No: 46.

[0055] Figure 4 Results of mutation repair efficiency assays after gene editing, showing the efficiency of mutation repair in normal individuals, patients, and gene-edited iPSCs. IFITM5 Sanger sequencing peak diagram of c.-14C site.

[0056] Figures 5A to 5C iPSCs were induced to identify iMSCs. Figure 5A iMSCs morphology diagram; Figure 5B Results of MSC surface marker fluid dynamics cytology detection; Figure 5C : Staining results of iMSCs trilineal differentiation (osteogenic, chondrogenic, adipogenic).

[0057] Figures 6A to 6C Changes in the expression levels of osteogenic marker molecules in cells before and after repair during osteogenic induction. Figure 6A Changes in the expression of osteogenic marker mRNA during osteogenic induction; Figure 6B Changes in the expression of osteogenic marker proteins during osteogenic induction; Figure 6C Changes in collagen expression during osteogenic induction.

[0058] Figures 7A to 7F Comparison of Alizarin Red staining of cells before and after osteogenic induction differentiation and quantitative results of mineralized nodules. Figure 7A Results of ALP staining and relative expression analysis of ALP. Figure 7B Quantitative analysis results of alizarin red staining. Figure 7C Quantitative analysis results of Oil Red O staining. Figure 7D Quantitative analysis results of alcinocyanine blue staining. Figure 7E : Relative expression levels of adipogenic marker genes. Figure 7F : Relative expression levels of chondrogenic marker genes. Detailed Implementation

[0059] Reagents used in the examples Table 1. Preparation methods of reagents related to cell culture and differentiation induction Table 2. qPCR primer sequences Table 3. IFITM5 c.-14C>T mutation detection primer sequence listing Example 1: Establishment and identification of patient-derived iPSCs OI5 patients diagnosed clinically (carrying) IFITM5(c.-14C>T heterozygous mutation; informed consent and ethical approval met) Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral venous blood. Four reprogramming factors (OCT4, SOX2, KLF4, and c-MYC) were delivered using a Sendai viral vector to reprogram PBMCs into iPSCs. The obtained iPSCs were subjected to immunofluorescence detection of pluripotency markers (such as OCT4, SOX2, SSEA4, and TRA-1-60), teratoma trigerm layer differentiation assays, and karyotype analysis to confirm that the cells possessed complete pluripotency and a normal karyotype. Figures 2A to 2C ).

[0060] Example 2: Targeting IFITM5 Design, screening and activity validation of mutated gRNAs Target gene sequence information: Human wild type IFITM5 In the gene (Gene ID: 387733), the c.-14C>T mutation site is located in the 5' untranslated region, 14 nucleotides upstream of the natural start codon.

[0061] Targeting people IFITM5 Based on the genomic sequence surrounding the c.-14C>T mutation site in the gene, three gRNAs targeting different sites were designed and chemically synthesized (named gRNA1, gRNA2, and gRNA3, respectively). Taking gRNA2 as an example for subsequent gene editing experiments: a pair of gRNA-specific primers (Target F1 / R1 primers) were designed for in vitro transcription synthesis of gRNA2: the forward primer (SEQ ID No: 42) contained the T7 promoter sequence and the gRNA2 targeting sequence, and the reverse primer (SEQ ID No: 43) contained the inverse complementary sequence of the crRNA / tracrRNA constant region. Using this primer pair, a universal template containing an 80bp crRNA / tracrRNA constant region was amplified via overlap PCR, serving as the DNA template for gRNA2. This DNA template contained the T7 promoter, the gRNA2 targeting sequence, and the crRNA / tracrRNA scaffold sequence. Subsequently, the DNA template was transcribed in vitro (IVT) using T7 RNA polymerase to synthesize gRNA2. After purification, the transcripts were pre-assembled with high-fidelity Cas9 protein to form ribonucleoprotein (RNP) complexes for subsequent electroporation delivery. Each gRNA was pre-assembled with high-fidelity Cas9 protein in vitro to form a ribonucleoprotein complex, which was then delivered into the expression center via electroporation. IFITM5Mutated iPSCs from patients. 72 hours after transfection, single clones were screened by limiting dilution culture of iPSCs, and genomic DNA was extracted from each clone. PCR amplification and Sanger sequencing were performed on the target regions to analyze the proportion of insertion and deletion mutations.

[0062] Based on the criteria of high editing efficiency and good target specificity, gRNA2 was found to be significantly more effective than the other two gRNAs and was used in subsequent experiments.

[0063] The sequences targeted by the three candidate gRNAs are as follows: gRNA1 target: CATCTCTTCCACACTCAGACT (PAM: GG; SEQ ID No: 39); gRNA2 targeting: GAGGTGTGGAAGAGATGGCGC (PAM: TGG; SEQ ID No: 40); gRNA3 target: AGAGATGGGCGCTGGAACCCAT (PAM: GG; SEQ ID No: 41).

[0064] Although all three gRNAs target the same gene, gRNA2 is significantly more efficient at editing than the other two.

[0065] Table 3. IFITM5 c.-14C>T Hotspot Mutant Gene Editing Information Example 3: CRISPR / Cas9-based gene repair, monoclonal screening, and osteogenic function validation 1. Reagents used ALP staining: Solarbio alkaline phosphatase (ALP) detection kit (azo coupling method) (G1480); Alizarin red staining: osteoblast mineralization nodule staining kit, Beyotime; Immunofluorescence: Invitrogen Pluripotent StemCell 4-Marker Immunocytochemistry Kit, catalog number A24881.

[0066] Flow cytometry: Anti-human CD90 FITC Invitrogen 11-0909-42, Anti-human CD29 APC Invitrogen 12-0291-82, Anti-human CD73 APC Invitrogen 17-0739-42, Anti-human CD45 FITC Invitrogen 58-0459-42.

[0067] 2. Methods and Results The gRNA (gRNA2) was assembled with high-fidelity Cas9 protein, mixed with the repair template, and then transfected into OI5 patient iPSCs established in Example 1 via electroporation. The molar ratio of gRNA to Cas9 protein ranged from 1:1 to 5:1; as an example, 2:1 was used. The molar ratio of donor template to RNP complex ranged from 1:1 to 10:1; as an example, 5:1 was used.

[0068] Specifically, gRNA (final concentration 100-300 nM) and high-fidelity Cas9 protein (final concentration 50-150 nM) are incubated at room temperature for 10-20 minutes to form an RNP complex, and then a donor template (final concentration 300-1000 nM) is added for electroporation.

[0069] Each 1×10 6 Each iPSC is electroporated using 2-5 μg (e.g., 3 μg) of the RNP complex (containing gRNA and Cas9 protein) and 1-3 μg (e.g., 2 μg) of donor template; electroporation parameters can be referenced as follows: 1400 V, 10 ms, 3 pulses.

[0070] After transfection, at a low density (2×10) 2 Up to 1×10 3 1 cell / 6-well plate; specifically using 4×10 2 Cells were seeded at 10 cells / well 6-well plate and cultured for 10 days. Single clones were mechanically picked and amplified using StemFlex medium (Gibco, catalog number A3349401, supplemented with 10 μM Y-27632 (ROCK inhibitor)). PCR amplification and Sanger sequencing were performed on the target site of each single clone to identify the genotype. Single clones that were wild-type homozygous (i.e., c.-14C>T repaired) were selected as gene repair cell lines. Figure 4 ).

[0071] The group settings are as follows: (1) Normal control group: iPSCs (wild type) from healthy donors IFITM5 ), without performing any gene editing operations; (2) Unrepaired mutation group: iPSCs from OI5 patients (heterozygotes of the variant c.-14C>T) without any gene editing.

[0072] (3) Repair cell group: iPSCs derived from OI5 patients (with the variant c.-14C>T corrected to the normal allele) were subjected to the gene editing operation disclosed herein.

[0073] The repaired cell group, the unrepaired mutant group, and the normal control group underwent simultaneous subsequent MSC induction and osteogenic differentiation experiments. Mesenchymal stem cell (MSC) induction was performed simultaneously on the normal control cell line (control group), the repaired cell line, and the unrepaired mutant cell line. Figures 5A to 5C Then, osteogenic differentiation was induced (using osteogenic medium containing sodium β-glycerophosphate, ascorbic acid, and dexamethasone). After 7 days of induction, alkaline phosphatase (ALP) staining was performed, and after 14 days of induction, Alizarin Red staining was performed. The results showed that the osteogenic differentiation and mineralization capacity of the repaired cell group were lower than those of the unrepaired group, and close to those of the normal control group. Figures 7A to 7F Simultaneously, total RNA was extracted on day 7 of induction for real-time quantitative PCR to detect the expression of osteogenic-related genes. The results confirmed that repair cells... RUNX2 , BSP , OCN , COL1A1 / 2 The expression levels of genes such as isoblasts were not statistically different from those of osteoblasts derived from healthy individuals, suggesting that osteogenic differentiation function has returned to normal. Figures 6A to 6C ).

[0074] Compared to existing technologies, the key advantages of this disclosed method are: 1. Directly repair the pathogenic mutation itself and re-establish normal bone metabolism regulation at the molecular level.

[0075] 2. All OI5 patients worldwide share the same mutation site, and the same set of gRNA and repair template can cover the entire patient population, greatly reducing the complexity and cost of product development.

[0076] 3. The CRISPR / Cas9 editing strategy can significantly reduce the off-target risk; the autologous cell strategy eliminates the need for immune rejection and long-term use of immunosuppressants at the source. Bioinformatics tools such as CRISPR RGEN Tools were used to predict potential off-target sites for gRNA2 across the entire genome, showing a low off-target risk for this gRNA in the human genome. Further sequencing using whole-genome sequencing will be conducted to verify the off-target effects.

[0077] 4. In vitro experiments have demonstrated that the mineralization capacity of osteoblasts after repair mutations can be reversed. RUNX2 , OCN , COL1A1 The restoration of expression of key osteogenic marker genes to normal levels provides direct evidence for improved bone strength in vivo.

[0078] References [1] Cho T J, Lee K E, Lee S K, et al., A single recurrent mutation in the 5'-UTR of IFITM5 causes osteogenesis imperfecta type V[J]. Am J Hum Genet, 2012, 91 (2): 343-8. [2] Semler O, Garbes L, Keupp K, et al., A mutation in the 5'-UTR of IFITM5 creates an in-frame start codon and causes autosomal-dominant osteogenesis imperfecta type V with hyperplastic callus[J]. Am J Hum Genet, 2012, 91 (2): 349-57. [3] Hanagata N, Takemura T, Kamimura K, et al., Effect of immunosuppressants on a mouse model of osteogenesis imperfecta type V harboring a heterozygous Ifitm5 c.-14C > T mutation[J]. Sci Rep, 2020, 10 (1): 21197. [4] Rauch F, Moffatt P, Cheung M, et al., Osteogenesis imperfecta type V: marked phenotypic variability despite the presence of the IFITM5 c.-14C>T mutation in all patients[J]. J Med Genet, 2013, 50 (1): 21-4. [5] Shapiro J R, Lietman C, Grover M, et al., Phenotypic variability of osteogenesis imperfecta type V caused by an IFITM5 mutation[J]. J Bone Miner Res, 2013, 28 (7): 1523-30.

Claims

1. A gRNA, wherein: The gRNA targeting IFITM5 Gene c.-14C>T mutation site; The gRNA is shown in SEQ ID No:

48.

2. A method for repair IFITM5 A gene editing system for the c.-14C>T mutation, comprising: 1) gRNA or gRNA expression vector, which expresses the gRNA of claim 1; 2) Cas9 protein or Cas9 expression vector, which expresses the Cas9 protein; 3) Optionally, the donor template provides normal... IFITM5 Gene fragments; The gRNA expression vector and the Cas9 expression vector are in the same vector, or The gRNA expression vector and the Cas9 expression vector are independent vectors; Preferably, the Cas9 protein is selected from: SpCas9, HiFi Cas9, eSpCas9 (1.1), SpCas9-HF1, SpCas9-HF2, CjCas9, evoCas9, HypaCas9, miCas9, NmCas9, St1Cas9, St2Cas9, TdCas9, FnCas9, Sniper-Cas9, SuperFi-Cas9, SpCas9-NG, SpCas9-VQR, SpCas9-VRER, SpCas9-EQR, SpCas9-D1135E, xCas9, SpRY Cas9, SaCas9, SaCas9-HF, ScCas9, KKH-SaCas9, SpCas9 nickase variant D10A, SpCas9 nickase variant H840A, and SpCas9 nickase variant D10A+H840A; Preferably, the donor template contains at least the oligonucleotide shown in SEQ ID No: 47; More preferably, the donor template is the oligonucleotide shown in SEQ ID No:

44.

3. The method for repair according to claim 2 IFITM5 A gene editing system for c.-14C>T mutations, wherein the donor template is a single-stranded or double-stranded oligonucleotide.

4. Use of the gRNA of claim 1 in the preparation of a medicament for the treatment of osteogenesis imperfecta type V.

5. The repair method according to claim 2 IFITM5 The use of a gene editing system with a c.-14C>T mutation in the preparation of a drug for the treatment of osteogenesis imperfecta type V.

6. A method of repair IFITM5 An in vitro method for detecting the c.-14C>T mutation in the gene, including the following steps: 1) Provide the repair method as described in claim 2 IFITM5 Gene editing systems with c.-14C>T mutations. 2) Introducing the gene editing system into target cells; preferably, the gene editing system is introduced into target cells by electroporation.

7. The method according to claim 6, wherein: The target cells carry IFITM5 Gene c.-14C>T mutation, or The target cells were derived from subjects with osteogenesis imperfecta type V; Preferably, the target cells are in the form of iPSCs; More preferably, the target cells are induced into iPSCs before being introduced.

8. The method according to claim 6, further comprising the step of: 3) Induce mesenchymal stem cell induction in the cells obtained in step 2); 4) The cells obtained in step 3) are subjected to osteogenic induction differentiation.

9. The method according to claim 6, wherein: The molar ratio of the gRNA or the gRNA expression vector to the Cas9 protein or the Cas9 expression vector is 1:1 to 5:1, preferably 2:1; Incubation of the gRNA and the Cas9 protein can form a complex; or incubation of the gRNA expressed by the gRNA expression vector and the Cas9 expressed by the Cas9 expression vector can form a complex. The donor template and the molar ratio of the complex are 1:1 to 10:1, preferably 5:

1.

10. The method according to claim 7 or 9, wherein Each 1×10 6 Each iPSC contacts 2 μg to 5 μg of the complex and 1 μg to 3 μg of the donor template; Preferably, each 1×10 6 Each iPSC contact contains 3 μg of the complex and 2 μg of the donor template.

Images