MiRNA and use thereof

Abstract

The application belongs to the technical field of pest control, and discloses a kind of miRNA and its application, specifically discloses the application of Ghr-miR167a and Ghr-miR396a in pest control and / or preparation of pest control product.The application first finds that injecting Ghr-miR167a and Ghr-miR396a from Gossypium hirsutum into pests (such as cotton bollworm larvae) can significantly reduce their survival rate and food intake, and inhibit growth and development.Young larvae are effective for pest control.The above research results prove that the above-mentioned miRNA can be used to control cotton bollworm larvae, and has the potential to be applied by constructing transgenic plants (such as cotton, corn, etc.).

Description

Technical Field

[0001] This invention belongs to the field of pest control technology, specifically relating to a miRNA and its applications. Background Technology

[0002] cotton bollworm ( Helicoverpa armigera The noctuid moth (Noctuidae) belongs to the order Lepidoptera and the family Noctuidae. Originally from southern Africa, it has now spread to Asia, Africa, Europe, Oceania, and the Americas, becoming a major pest of dozens of crops worldwide, including cotton, corn, wheat, tomatoes, and tobacco. This insect possesses biological characteristics such as an extremely wide host range, strong migratory and dispersal capabilities, a short generation cycle, and high environmental adaptability. Furthermore, it has developed varying degrees of resistance to many chemical pesticides, causing enormous economic losses to global agricultural production. It has been listed as one of the world's major agricultural pests by the Food and Agriculture Organization of the United Nations (FAO).

[0003] The main pest control strategies include agricultural control, physical control, biological control and chemical control. (1) Agricultural control: Reduce the pest population through reasonable cultivation and management measures, such as crop rotation, intercropping, manual removal of egg masses and killing of larvae. In recent years, the push-pull strategy has attracted attention as an ecological control method, that is, by planting crops with repellent effect in the field to "push" away pests, and planting crops with attraction effect around the field to "pull" together pests, thereby interfering with their host positioning behavior. However, the above measures are labor-intensive and inefficient, and are difficult to meet the needs of large-scale agricultural production. (2) Physical control: Use sugar-vinegar wine liquid, yellow sticky traps and frequency-vibration insecticidal lamps to attract and kill adult insects. However, such methods have obvious ecological side effects. While trapping and killing pests, insect traps will also kill a large number of natural enemies and neutral insects, which will disrupt the ecological balance of farmland. In addition, the installation, maintenance and cleaning costs of the equipment are high, and it is only effective against adult insects and cannot control the damage during the larval stage. (3) Biological control: Control is achieved by using natural enemy insects (such as Trichogramma wasps and lacewings), pathogenic microorganisms (such as Bacillus thuringiensis Bt), or insect viruses. However, this strategy is limited by factors such as the immaturity of large-scale breeding technology for natural enemy insects, high production costs, complex field release operations, and unstable control effects, which pose significant challenges to its practical application. (4) Chemical control: Control is achieved by using chemical insecticides such as organophosphates, pyrethroids, and diamides. Due to their rapid effectiveness and ease of operation, this is still the most widely used method. However, long-term excessive use of chemical pesticides has led to severe resistance of cotton bollworms to various pesticides, and has also caused a series of serious problems such as pesticide residues, environmental pollution, non-target biological toxicity, and food safety.

[0004] Developing efficient, specific, and environmentally friendly novel pest control technologies has become an urgent need for sustainable agricultural development. RNA interference (RNAi) technology silences key pest genes by specifically degrading target mRNA or inhibiting its translation, exhibiting high target specificity and environmental safety. Plant-derived miRNAs can enter insects through ingestion, exerting gene regulatory functions in insect cells, affecting key physiological processes such as growth and development, immune responses, and metabolic detoxification, and even leading to pest death. Utilizing endogenous plant miRNAs for pest control has advantages such as natural sources, high public acceptance, and easy stable expression through transgenic crops. Therefore, screening and identifying safe and efficient insect-resistant plant-derived miRNAs will contribute to the promotion and application of green control strategies. Summary of the Invention

[0005] The first aspect of the present invention aims to provide the application of Ghr-miR167a and Ghr-miR396a related biomaterials in pest control and / or the preparation of pest control products.

[0006] The second aspect of the present invention is to provide a product.

[0007] The third objective of this invention is to provide a method for controlling pests.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the invention provides the use of any one of the substances shown in (1)-(6) in pest control and / or in the preparation of pest control products; (1) Ghr-miR167a or Ghr-miR396a; (2) Precursors to Ghr-miR167a or Ghr-miR396a; (3) Ghr-miR167a mimics or Ghr-miR396a mimics; (4) DNA molecules encoding Ghr-miR167a or Ghr-miR396a as described in (1); (5) DNA molecules encoding the precursors of Ghr-miR167a or Ghr-miR396a described in (2); (6) An expression cassette, recombinant vector or transgenic cell containing the DNA molecule described in (4) or (5).

[0009] In some embodiments of the present invention, the nucleotide sequences of the Ghr-miR167a or Ghr-miR396a are as shown in SEQ ID NO:2-3.

[0010] In some embodiments of the present invention, the Ghr-miR167a or Ghr-miR396a includes a functional equivalent of the constitutive nucleic acid molecule, i.e., a variant, which retains the same function as the complete Ghr-miR167a or Ghr-miR396a nucleic acid molecule and can be mutated by deletion, substitution or insertion of nucleotide residues.

[0011] As is known to those skilled in the art, to ensure the stability of miRNA, protective bases (such as TT) can be added to one or both ends of the miRNA, allowing modification of the miRNA bases without affecting its function. Therefore, sequences obtained by modifying the bases of Ghr-miR167a or Ghr-miR396a or by adding bases to both ends, without affecting the function, are also included within the scope of protection of this invention; that is, Ghr-miR167a or Ghr-miR396a can be any form in which one or more ribonucleotides in the sequence are modified.

[0012] In some embodiments of the present invention, the Ghr-miR167a or Ghr-miR396a is a mature miRNA, a precursor miRNA, or a primary transcript.

[0013] In some embodiments of the present invention, the nucleic acid molecules of Ghr-miR167a or Ghr-miR396a can exist in single-stranded or double-stranded form. Mature Ghr-miR167a or Ghr-miR396a is mainly in single-stranded form, while the precursor portion is self-complementary and can form a double-stranded structure. The nucleic acid molecules of Ghr-miR167a or Ghr-miR396a can be in the form of RNA, DNA, PNA, or LNA.

[0014] In some embodiments of the present invention, the pests include lepidopteran insects.

[0015] In some embodiments of the present invention, the pest is the cotton bollworm.

[0016] In some embodiments of the present invention, the pest is a larval stage pest.

[0017] In some embodiments of the present invention, the product is an insecticide or insecticidal drug.

[0018] In some embodiments of the present invention, the product can be prepared into conventional dosage forms for use, such as dry powder, wettable powder, emulsifiable concentrate, microemulsion, paste, granules or suspension.

[0019] In some embodiments of the present invention, the substance achieves pest control by inhibiting pest feeding, inhibiting pest growth and development, and / or killing pests.

[0020] In some embodiments of the present invention, the substance delays the growth of pests, preventing them from completing metamorphosis and thus causing them to die.

[0021] Since Ghr-miR167a or Ghr-miR396a originates from upland cotton and is safe for humans, it can be used as a safe and effective novel insecticide for cotton bollworm. It can be used directly or for constructing transgenic plants. Therefore, transgenic plants overexpressing Ghr-miR167a or Ghr-miR396a also have practical application value in the control of cotton bollworm.

[0022] A second aspect of the present invention provides a product comprising any one of the substances shown in (1)-(6) below: (1) Ghr-miR167a or Ghr-miR396a; (2) Precursors to Ghr-miR167a or Ghr-miR396a; (3) Ghr-miR167a mimics or Ghr-miR396a mimics; (4) DNA molecules encoding Ghr-miR167a or Ghr-miR396a as described in (1); (5) DNA molecules encoding the precursors of Ghr-miR167a or Ghr-miR396a described in (2); (6) An expression cassette, recombinant vector or transgenic cell containing the DNA molecule described in (4) or (5).

[0023] In some embodiments of the present invention, the nucleotide sequences of the Ghr-miR167a or Ghr-miR396a are as shown in SEQ ID NO:2-3.

[0024] In some embodiments of the present invention, the product includes at least one of a reagent, a drug, or an insecticide.

[0025] In some embodiments of the present invention, the product further includes a pharmaceutically acceptable carrier, including but not limited to diluents, buffers, suspensions, emulsions, granules, encapsulation agents, excipients, fillers, binders, sprays, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, flavoring agents, or adsorbents.

[0026] A third aspect of the present invention provides a method for controlling pests, comprising applying the substance described in the first aspect of the present invention or the product of the second aspect of the present invention to pests or pest habitats.

[0027] In some embodiments of the present invention, the method includes treating pests, their food (such as cotton, corn, tomatoes, peppers, wheat, sorghum, soybeans, peanuts, etc.), and their habitat (soil, area, material, or environment where the pest is growing or can grow, or materials, cultivated plants, plant propagation materials such as seeds, soil surface, etc., to be protected from pest attack or infestation) with the substance or product. For example, transgenic plants expressing Ghr-miR167a and / or Ghr-miR396a or their mimics or precursors can be constructed for pest control; or, for example, Ghr-miR167a and / or Ghr-miR396a or their mimics or precursors can be directly introduced into the pest's body by spraying or injection (e.g., injection into the lateral abdomen between the penultimate abdominal segment and the second penultimate abdominal segment of the cotton bollworm).

[0028] In some embodiments of the invention, an effective dose of the substance described in the first aspect of the invention or the product of the second aspect of the invention is applied to the pest or the pest's habitat.

[0029] Generally, "effective amount" refers to the amount of active ingredient required to achieve an observable insecticidal effect, including effects such as necrosis, death, inhibition, prevention, removal, destruction, or reduction of the presence and activity of target organisms. For the Ghr-miR167a or Ghr-miR396a or their mimics used in this invention, the effective amount can vary depending on key factors such as the desired insecticidal effect and duration, climatic conditions, target species, application location, and application method.

[0030] In some embodiments of the present invention, the pests include lepidopteran insects.

[0031] In some embodiments of the present invention, the pest is the cotton bollworm.

[0032] The beneficial effects of this invention are: This invention is the first to discover that injecting upland cotton-derived Ghr-miR167a or Ghr-miR396a into pests (such as bollworm larvae) significantly reduces their survival rate and food intake, and inhibits their growth and development. Early-stage larvae are the most effective period for pest control. These research results demonstrate that the aforementioned miRNAs can be used to control bollworm larvae and have the potential for application through the construction of transgenic plants (such as cotton and corn).

[0033] Specifically, by artificially synthesizing mimics and injecting them into 4th instar larvae of the cotton bollworm, it was found that both Ghr-miR167a and Ghr-miR396a had strong insecticidal effects. Compared with the control group (DEPC water and NC mimics), the 168-hour survival rate of cotton bollworm larvae injected with Ghr-miR167a and Ghr-miR396a was significantly reduced, their total food intake was significantly decreased, and their growth trend was significantly delayed.

[0034] To investigate the molecular mechanisms by which Ghr-miR167a and Ghr-miR396a cause death or growth inhibition in cotton bollworms, whole-insect transcriptome sequencing analysis was performed 48 h after injection. The results showed that, compared with the control group, 277 genes were significantly downregulated in larvae injected with Ghr-miR167a mimics, and 568 genes were significantly downregulated in larvae injected with Ghr-miR396a mimics. KEGG pathway enrichment analysis further revealed that Ghr-miR167a mainly regulates fatty acid synthesis and metabolism, the AMPK signaling pathway, the PPAR signaling pathway, protein digestion and absorption, and amino acid synthesis and metabolism; while Ghr-miR396a mainly affects carbohydrate metabolism, fatty acid synthesis and metabolism, protein digestion and absorption, and vitamin digestion and absorption. These pathways are all essential nutritional and energy metabolism pathways for insects to maintain normal life activities.

[0035] In summary, Ghr-miR167a and Ghr-miR396a disrupt the normal nutrient uptake, energy supply, and growth and development of the cotton bollworm by inhibiting a wide range of gene groups related to its life activities (including energy metabolism, protein metabolism, lipid metabolism, and carbohydrate metabolism), thereby leading to delayed larval growth and even death. Therefore, Ghr-miR167a and Ghr-miR396a are promising pest control molecules that can be applied to the green control of cotton bollworm through transgenic plant expression or exogenous application. Attached Figure Description

[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 Survival rate of cotton bollworm 168 h after injection of different plant-derived miRNAs.

[0037] Figure 2 Phenotypic analysis of *Bollworm* 168 h after injection of Ghr-miR167a and Ghr-miR396a. In the figures, A shows the survival rate curve of *Bollworm* during the treatment period; B shows the cumulative food intake of *Bollworm* 168 h after treatment; C shows a representative phenotypic diagram of *Bollworm* 168 h after treatment; and D shows the percentage distribution of different body lengths of *Bollworm* 168 h after treatment. NC represents the control group.

[0038] Figure 3 Transcriptome analysis of cotton bollworm larvae 48 h after injection of Ghr-miR167a and Ghr-miR396a. In this analysis, A represents the statistical analysis of differentially downregulated genes; B represents the intersection analysis of significantly downregulated genes with previously predicted potentially lethal genes.

[0039] Figure 4 KEGG pathway enrichment analysis of genes significantly downregulated after injection of Ghr-miR167a into cotton bollworm.

[0040] Figure 5 KEGG pathway enrichment analysis of genes significantly downregulated after injection of Ghr-miR396a into cotton bollworm. Detailed Implementation

[0041] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0042] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0043] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0044] Example 1: Screening of plant-derived miRNAs for bollworm control 1. Experimental Methods (1) miRNA target prediction method Three target prediction software programs were used to predict insect targets: RNAhybrid (http: / / bibiserv.techfak.uni-bielefeld.de / rnahybrid / ), PITA (https: / / genie.weizmann.ac.il / pubs / mir07 / mir07_data.html), and miRanda (http: / / www.microrna.org / ). The evaluation criteria were as follows: RNAhybrid (mfe ≤ 20 kcal / mol p Value ≤ 0.05); PITA (seed region 7-8 bp complete base pairing, ddG ≤ 10 kcal / mol);miRanda (score≥150, Energy≤ (20 kcal / mol). Target genes predicted by three different software programs and whose binding sites differ by less than 20 bp were selected as potential target genes.

[0045] (2) GO and KEGG analysis methods GO and KEGG analyses were performed on the predicted target genes. First, GO and KEGG annotation background files for *Helicoverpa armigera* were obtained from the EggNOG (http: / / eggnog-mapper.embl.de / ) and KEGG (https: / / www.kegg.jp / kegg / ) websites. Then, the GO and KEGG enrichment functions were used on the Kiddio Bioinformatics Cloud Platform according to the instructions.

[0046] 2. Experimental Results and Analysis To discover plant-derived small RNAs that can be used for the control of cotton bollworm, this example first used three software programs—miRanda, PITA, and RNAhybrid—to perform target gene prediction analysis on upland cotton stress-resistance-related miRNAs and cotton bollworm whole mRNA databases. The results showed that these miRNAs can target a variety of genes crucial to insect life activities, including acetylcholine receptor subunits, γ-aminobutyric acid receptors, and potassium voltage-gated channels related to nerve signal transduction; ecdysone-induced proteins related to hormone regulation; and cytochrome P450 and glutathione S-transferase related to metabolic detoxification. In addition, they also target calcium / calmodulin-dependent protein kinases, the AP-1 complex, ATP synthase subunits, epidermal proteins, chitinases, and various transcription factors (Table 1). These target genes are widely involved in key physiological processes in insects, such as nerve conduction, molting development, detoxification metabolism, energy supply, and epidermal formation. Therefore, this invention selects a series of miRNAs (including Ghr-miR167a, Ghr-miR396a, Ghr-miR2905, Ghr-miR166b, Ghr-miR166d and Ghr-miR160) from upland cotton miRNAs that target a large number of the aforementioned lethal or developmental key genes, synthesizes their mimics, and injects them into cotton bollworm larvae to further identify their insect-resistant activity.

[0047] Table 1. Prediction analysis of target genes from upland cotton stress-related miRNAs and bollworm whole mRNA databases.

[0048] Example 2: Identification of the insecticidal effects of Ghr-miR167a and Ghr-miR396a 1. Experimental Materials cotton bollworm ( Helicoverpa armigera The strain was purchased from Henan Keyun Biological Pesticide Co., Ltd. The larvae were reared in an artificial climate chamber for an extended period, and after more than 30 generations of stable reproduction, the rearing conditions were: 26 ℃, a photoperiod of 14 h light: 10 h darkness, and a relative humidity of 60%, fed with an artificial culture medium. The artificial culture medium formula (per liter) was as follows: 300 g soybean meal, 300 g corn meal, 60 g yeast powder, 21 g agar powder, 7.5 g vitamin C, 6 g sodium benzoate, 3 g sorbic acid, 3 g methylparaben, and 45 mL acetic acid. Adults were fed with 10% honey water.

[0049] 2. Experimental Methods Treatment of miRNAs and mimics The miRNA mimics used for injection were synthesized by Gemma Gene Co., Ltd. The positive strand sequences of the mimics used in this experiment are as follows: the control (NC) mimic sequence is UUCUCCGAACGUGUCACGUTT (SEQ ID NO:1), the Ghr-miR167 mimic sequence is UGAAGCUGCCAGCAUGAUCUA (SEQ ID NO:2), and the Ghr-miR396a mimic sequence is UUCCACAGCUUUCUUGAACUG (SEQ ID NO:3).

[0050] Several healthy, uniformly grown fourth-instar cotton bollworm larvae were selected and briefly anesthetized on ice. Intracavitary injections were performed using a microsyringe: each larva in the control group was injected with 1 μL of DEPC water or 10 μg of NC mimics (dissolved in 1 μL of DEPC water); each larva in the experimental groups was injected with 10 μg of Ghr-miR167a mimics, Ghr-miR396a mimics, Ghr-miR2905 mimics, Ghr-miR166b mimics, Ghr-miR166d mimics, and Ghr-miR160 mimics (dissolved in 1 μL of DEPC water), respectively. The injection site was the lateral abdomen between the first and second abdominal segments from the bottom. After injection, each larva was individually housed in a plastic cup, and its survival rate, food intake, and growth were observed and recorded regularly. After 48 hours, three cotton bollworms from each group were randomly selected for sampling for subsequent experiments.

[0051] 3. Experimental Results and Analysis To determine the insecticidal effect of host plant-derived miRNAs on cotton bollworm, this study selected candidate miRNAs with a high number of lethal genes from upland cotton miRNAs, synthesized mimics, and injected them into 4th instar 1-day-old cotton bollworm larvae. By measuring the survival rate 168 h after injection, it was found that Ghr-miR167a and Ghr-miR396a from upland cotton significantly reduced the survival rate of cotton bollworm larvae. Figure 1 Therefore, this invention selected these two miRNAs for further identification of insect resistance and phenotypic analysis.

[0052] When cotton bollworm larvae were injected with Ghr-miR167a mimics and Ghr-miR396a mimics, respectively, the larvae injected with both Ghr-miR167a mimics and Ghr-miR396a mimics showed a significant decrease in survival rate compared with the control group. Figure 2 In the middle A), the total food intake decreased significantly during the 168-hour period ( Figure 2 (B), and the growth trend is significantly delayed ( Figure 2 (C and D). The above results indicate that Ghr-miR167a and Ghr-miR396a have good insecticidal effects against cotton bollworm, suggesting the potential to control the corresponding pest by expressing plant-derived miRNAs in crops or by exogenous application.

[0053] Example 3: Transcriptome analysis of the insect resistance mechanisms of Ghr-miR167a and Ghr-miR396a After demonstrating the insect-resistant effects of Ghr-miR167a and Ghr-miR396a in Example 2, this example further analyzes the possible reasons for the insect-resistant effects of Ghr-miR167a and Ghr-miR396a through transcriptome analysis, that is, to investigate the insect-resistant mechanism of Ghr-miR167a and Ghr-miR396a against cotton bollworm.

[0054] 1. Experimental Methods The same experimental method as in Example 2 was used for miRNA mimics treatment. Furthermore, whole-stalk transcriptome sequencing was performed on cotton bollworm larvae injected with DEPC water, Ghr-miR167a mimics, and Ghr-miR396a mimics for 48 h, respectively. KEGG pathway enrichment analysis was then performed on genes significantly downregulated in the larvae after injection of the two miRNA mimics.

[0055] 2. Experimental Results and Analysis To investigate the resistance mechanisms of Ghr-miR167a and Ghr-miR396a against cotton bollworm, whole-span transcriptome sequencing was performed on cotton bollworm larvae injected with DEPC water, Ghr-miR167a mimics, and Ghr-miR396a mimics for 48 h, respectively. The results showed that compared with the control group injected with DEPC water, 277 genes were significantly downregulated in larvae injected with Ghr-miR167a mimics, and 568 genes were significantly downregulated in larvae injected with Ghr-miR396a mimics. Figure 3 (A). Target gene prediction analysis showed that these significantly downregulated genes did not overlap with previously predicted potentially lethal genes. Figure 3 (B) This suggests that Ghr-miR167a and Ghr-miR396a may not directly act on the reported lethal genes, and their insect resistance mechanism may have other causes.

[0056] To investigate the insect-resistant mechanisms of Ghr-miR167a and Ghr-miR396a, KEGG pathway enrichment analysis was performed on genes significantly downregulated in larvae injected with the two miRNA mimics. The results showed that in larvae injected with Ghr-miR167a mimics, the significantly downregulated genes were mainly enriched in pathways such as fatty acid synthesis and metabolism, AMPK signaling pathway, PPAR signaling pathway, protein digestion and absorption, and amino acid synthesis and metabolism. Figure 4 In larvae injected with Ghr-miR396a mimics, the significantly downregulated genes were mainly enriched in pathways such as carbohydrate metabolism, fatty acid synthesis and metabolism, protein digestion and absorption, and vitamin digestion and absorption. Figure 5 These pathways are crucial for the normal life activities of insects, suggesting that the insecticidal effects of Ghr-miR167a and Ghr-miR396a on cotton bollworm larvae may be achieved by inhibiting a broad range of life-related gene groups, rather than directly acting on previously reported lethal genes. Therefore, these results provide a new approach for screening insect-resistant plant-derived miRNAs based on targeting genes required for life activities such as energy metabolism, proteins, lipids, and carbohydrates.

[0057] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The use of any one of the substances shown in (1)-(6) below in pest control and / or in the preparation of pest control products; (1) Ghr-miR167a or Ghr-miR396a; (2) Precursors to Ghr-miR167a or Ghr-miR396a; (3) Ghr-miR167a mimics or Ghr-miR396a mimics; (4) DNA molecules encoding Ghr-miR167a or Ghr-miR396a as described in (1); (5) DNA molecules encoding the precursors of Ghr-miR167a or Ghr-miR396a described in (2); (6) An expression cassette, recombinant vector or transgenic cell containing the DNA molecule described in (4) or (5).

2. The application according to claim 1, characterized in that, The nucleotide sequences of Ghr-miR167a or Ghr-miR396a are shown in SEQ ID NO:2-3.

3. The application according to claim 1, characterized in that, The pests include lepidopteran insects; The preferred pest is the cotton bollworm.

4. The application according to any one of claims 1-3, characterized in that, The substance achieves pest control by inhibiting pests from feeding, inhibiting their growth and development, and / or killing them.

5. The application according to claim 4, characterized in that, The pests mentioned are pests in their larval stage.

6. A product comprising any one of the substances shown in (1)-(6) below; (1) Ghr-miR167a or Ghr-miR396a; (2) Precursors to Ghr-miR167a or Ghr-miR396a; (3) Ghr-miR167a mimics or Ghr-miR396a mimics; (4) DNA molecules encoding Ghr-miR167a or Ghr-miR396a as described in (1); (5) DNA molecules encoding the precursors of Ghr-miR167a or Ghr-miR396a described in (2); (6) An expression cassette, recombinant vector, or transgenic cell containing the DNA molecule described in (4) or (5); Preferably, the nucleotide sequences of the Ghr-miR167a or Ghr-miR396a are as shown in SEQ ID NO:2-3.

7. The product according to claim 6, characterized in that, The product includes at least one of reagents, drugs, and pesticides.

8. A method for controlling pests, comprising applying the substance of claim 1 or the product of claim 6 or 7 to the pests.

9. The method according to claim 8, characterized in that, The method includes treating pests, their food, and their habitat with the substance or product.

10. The method according to claim 8 or 9, characterized in that, The pests include lepidopteran insects; Preferably, the pest is the cotton bollworm.

Images