SgRNA, kit and method for detecting mycobacterium tuberculosis based on era-crispr / cas14a

Abstract

The application is suitable for the technical field of Mycobacterium tuberculosis detection, and provides sgRNA, a kit and a method for detecting Mycobacterium tuberculosis based on combination of ERA and CRISPR / Cas14a, wherein the sequence of the sgRNA is shown as SEQ ID NO. 11. The application optimizes the optimal reaction time, the reaction temperature, the sgRNA concentration, the Cas14a protein concentration, the ssDNA concentration and the addition amount of the ERA product in the detection process, explores the specificity and the sensitivity of the detection, finds the optimal reaction condition, establishes a rapid detection method for Mycobacterium tuberculosis with good specificity and high sensitivity, and has the advantages of simple operation, convenience, time saving, no need of large experimental instruments and equipment, and very suitable for personnel without any experimental basis to operate, so that on-site instant detection is realized.

Description

Technical Field

[0001] This invention belongs to the field of Mycobacterium tuberculosis detection technology, and particularly relates to the detection kits and methods for Mycobacterium tuberculosis based on ERA and CRISPR / Cas14a combination. Background Technology

[0002] Tuberculosis (TB) is caused by Mycobacterium tuberculosis (Mycobacterium tuberculosis). Mycobacterium tuberculosis, M.tb Mycobacterium tuberculosis is a zoonotic infectious disease caused by infection. The co-infection with TB and HIV, as well as the emergence of drug-resistant strains, make the development of a rapid, sensitive, specific, and visualized detection method for Mycobacterium tuberculosis an urgent need in the field of public health.

[0003] Currently, the main methods for detecting Mycobacterium tuberculosis include microscopic examination, bacterial culture, immunological detection, and molecular biological detection, as detailed below: Acid-fast bacilli (AFB) smear test: This method is simple and inexpensive, but it has low sensitivity and is easily affected by bacterial load. In particular, it has a high rate of missed detection in patients with low bacterial load. It also lacks good specificity for nontuberculous mycobacteria (NTM) and is difficult to meet the requirements for early diagnosis. Isolation and culture: As the "gold standard" for etiological diagnosis, it has high reliability and standardization, but its growth is slow and the cycle is as long as 4-8 weeks, making it difficult to achieve rapid detection; Immunological testing mainly involves lipoarabinomannan (LAM) antigen detection, tuberculin skin test (TST), interferon gamma release assay (IGRA), and serological tests. LAM testing is a urine test, simple, rapid, and inexpensive, but has low sensitivity and is only suitable for patients with active tuberculosis and severely compromised immune function. TST testing determines the severity of the infection by inducing an immune response through intradermal injection of tuberculin, but this method cannot distinguish between natural infection, BCG vaccination, or NTM infection, has low specificity, and is prone to false negatives. IGRA determines the severity of the infection by detecting the level of interferon gamma released by T cells after stimulation with tuberculin antigen; however, it is costly and requires sophisticated experimental conditions, limiting its application at the primary care level. Serological tests (such as ELISA / EIA) mainly detect specific antibodies produced by the body against Mycobacterium tuberculosis antigens; however, the results are greatly affected by individual immune status, and their stability and accuracy have certain limitations. Molecular biology detection: This method, with its high sensitivity and specificity, has become an important tool for detecting Mycobacterium tuberculosis. It mainly includes: real-time quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), whole-genome sequencing (WGS), and nucleic acid detection technologies based on the CRISPR-Cas system. Among these, PCR technology relies on expensive thermal cyclers and thermostable DNA polymerases, making it unsuitable for on-site detection; isothermal nucleic acid amplification technology requires no complex instruments and can rapidly amplify nucleic acids at a constant temperature; the CRISPR-Cas system can achieve highly specific nucleic acid recognition, but its sensitivity is limited when used alone, and it usually needs to be combined with nucleic acid amplification technologies.

[0004] In summary, existing methods suffer from problems such as long detection cycles, insufficient sensitivity and specificity, or difficulties in field application. There is an urgent need to develop rapid, sensitive, and highly specific methods for detecting Mycobacterium tuberculosis. Summary of the Invention

[0005] The purpose of this invention is to provide a kit and method for detecting sgRNA of Mycobacterium tuberculosis based on a combination of ERA and CRISPR / Cas14a, in order to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution: On the one hand, the present invention provides an sgRNA for detecting Mycobacterium tuberculosis based on a combination of ERA and CRISPR / Cas14a, the sequence of which is shown in SEQ ID NO.11.

[0007] On the other hand, the present invention provides a kit for detecting Mycobacterium tuberculosis based on ERA and CRISPR / Cas14a combination, comprising the above-mentioned sgRNA, Cas14a protein, single-stranded DNA reporter molecule modified with fluorescent and quenching groups, 10×HOLMES Buffer, and upstream and downstream primers for ERA amplification.

[0008] On the other hand, the present invention provides the application of the above-described sgRNA or the above-described kit in the detection of Mycobacterium tuberculosis for non-diagnostic purposes.

[0009] On the other hand, the present invention provides a method for detecting Mycobacterium tuberculosis based on a combination of ERA and CRISPR / Cas14a for non-diagnostic purposes, comprising the following steps: S1. Use the upstream and downstream primers for ERA amplification in the above kit to perform ERA amplification and obtain CRISPR / Cas14a detection nucleic acid samples; S2. Mix all components of the above kit except the primers with the nucleic acid sample to be detected by CRISPR / Cas14a, and react at 37 ℃ for 20 min. S3. Fluorescence intensity is detected during or at the end of the reaction. If the fluorescence intensity is higher than 0 RFU or fluorescence is directly observed with the naked eye, it proves that Mycobacterium tuberculosis has been detected.

[0010] Compared with the prior art, the specific beneficial effects of the present invention are as follows: 1. Higher sensitivity: The detection limits of this invention are 2.07 CFU / mL (bacterial culture) and 3.51 copies / µL (genomic DNA). By using ERA primers designed and screened for the target sequence, the primers can more efficiently identify and bind to the template during ERA amplification, significantly improving the sensitivity of ERA amplification and shortening the ERA reaction time. 2. Faster, with a detection time of only 28 minutes: ERA amplification technology provides a solid foundation for CRISPR detection. The carefully designed sgRNA for the target sequence can guide the Cas14a protein to recognize and bind to the target sequence to the maximum extent, thereby activating the trans-cleavage activity of the Cas14a protein to cut single-stranded DNA, which significantly improves the efficiency of CRISPR detection and shortens the detection time. 3. Cost Reduction: In the entire process of ERA-CRISPR detection, the screening of target sequences and the design of ERA primers and sgRNA are particularly critical. The target sequences screened and the designed ERA and sgRNA of this invention significantly improve the efficiency of ERA amplification and the accuracy of CRISPR detection. In the optimization process, the detection cost is further reduced by adjusting the concentration and volume of relevant reagents. Attached Figure Description

[0011] Figure 1 This diagram illustrates the construction of the pUC57-IS6110 positive recombinant plasmid provided in this embodiment of the invention. A shows the pUC57-IS6110 recombinant plasmid image; B shows the pUC57-IS6110 recombinant plasmid double enzyme digestion electrophoresis image; Lane M: DL-5000 Marker; Lane 1: pUC57-IS6110 recombinant plasmid double enzyme digestion electrophoresis result; Lane 2: pUC57 empty vector plasmid electrophoresis result. Figure 2 Preliminary screening results of four sets of ERA primers for Mycobacterium tuberculosis IS6110 provided in this embodiment of the invention; Lane M: DL-2000 Marker; Lanes 1-3, 4-6, 7-9, and 10-12 correspond to three sets of replicate samples of positive plasmids for primer pairs H-1, H-2, H-3, and H-4, respectively; Lane 13: Negative control; Figure 3The following are the specific screening results of three sets of ERA primers for Mycobacterium tuberculosis IS6110 provided in this embodiment of the invention; A, B, and C are electrophoresis images of the ERA amplification products of primers H-1, H-2, and H-3, respectively; Lane M: DL-2000 Marker; Lanes 1-12: Positive recombinant plasmid, Mycobacterium tuberculosis H37Ra, Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium scrofula, Mycobacterium abscessus, Mycobacterium chrysosum, Mycobacterium kansasii, Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa; Lane 13: Negative control; Figure 4 The sgRNA design process for Mycobacterium tuberculosis IS6110 provided in this embodiment of the invention; Figure 5 For the alignment of the sgRNA sequence of Mycobacterium tuberculosis IS6110 provided in the embodiments of the present invention; Figure 6 The results of fluorescence colorimetric detection and feasibility analysis provided in the embodiments of the present invention are as follows: A is the real-time fluorescence detection result of Mycobacterium tuberculosis ERA-CRISPR / Cas14a; B is the visualization detection result of Mycobacterium tuberculosis ERA-CRISPR / Cas14a; 1-6 are ERA products, without Cas14a protein, without sgRNA, without ssDNA reporter molecules, the target was not amplified, and they are negative controls. Figure 7 The following are the optimized ERA reaction conditions provided in the embodiments of the present invention: A is the optimized ERA reaction time; B is the optimized ERA reaction temperature; M is the DL2000 Marker; in A, 1~11: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 min, 12: negative control; in B, 1~6: 25, 30, 35, 37, 40 and 45 ℃, 7: negative control; Figure 8The following are the optimized results of sgRNA concentration, Cas14a protein concentration, ssDNA probe concentration, and ERA amplification product addition amount provided in the embodiments of the present invention; A, C, E, and G are the real-time fluorescence detection results of ERA-CRISPR / Cas14a after optimizing sgRNA concentration, Cas14a protein concentration, ssDNA probe concentration, and ERA amplification product addition amount, respectively; B, D, F, and H are the visual detection results of ERA-CRISPR / Cas14a after optimizing sgRNA concentration, Cas14a protein concentration, ssDNA probe concentration, and ERA amplification product addition amount, respectively; In A, 1-8: sgRNA concentrations are 300, 250, 200, 150, 100, 50, 25, and 0 nmol / L, respectively; In C, 1-8: Cas14a protein concentrations are 300, 250, 200, 150, 100, 50, 25, and 0 nmol / L, respectively; In E, 1-7: ssDNA The concentrations were 100, 80, 60, 40, 20, 10 and 0 μmol / L, respectively; in G, 1-6: the amounts of ERA amplification products added were 3.0, 2.5, 2.0, 1.5, 1.0, 0.5 and 0 μL, respectively; Figure 9 The specificity results of the Mycobacterium tuberculosis ERA-CRISPR / Cas14a detection method provided in the embodiments of the present invention are as follows: A is the real-time fluorescence detection result of Mycobacterium tuberculosis ERA-CRISPR / Cas14a; B is the visual detection result of Mycobacterium tuberculosis ERA-CRISPR / Cas14a; C is the ERA electrophoresis result of Mycobacterium tuberculosis; Lanes 1-12 are: positive plasmid, Mycobacterium tuberculosis H37Ra, Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium scrofula, Mycobacterium abscessus, Mycobacterium chrysosum, Mycobacterium kansasii, Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa; Lane 13: negative control; Lane M: DL2000 Marker; Figure 10 The sensitivity results of the ERA-CRISPR / Cas14a detection method for Mycobacterium tuberculosis provided in the embodiments of the present invention are as follows: A is the real-time fluorescence detection result of ERA-CRISPR / Cas14a for Mycobacterium tuberculosis; B is the visual detection result of ERA-CRISPR / Cas14a for Mycobacterium tuberculosis; C is the ERA electrophoresis result of Mycobacterium tuberculosis; D is the PCR amplification electrophoresis result of Mycobacterium tuberculosis; In A: Curves 1~7: 3.51×10 6 ~3.51×10 0 copies / μL; Curve 8: Negative control; In B, C, and D: Lane M: DL-2000 Marker; Lanes 1-7: Mycobacterium tuberculosis H37Ra DNA, concentrations of 3.51 × 10⁻⁶ copies / μL; 6~3.51×10 0 copies / μL; Lane 8: negative control. Detailed Implementation

[0012] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0013] This invention is based on the combined use of enzymatic recombination isothermal amplification (ERA) and the CRISPR / Cas14a system. Through isothermal nucleic acid amplification and specific gene recognition, it achieves the synthesis of Mycobacterium tuberculosis (Mycobacterium tuberculosis) Mycobacterium tuberculosis, M.tb The core mechanism of its ultra-sensitive and rapid detection is: ERA amplification: Utilizing recombinase and primers, exponential amplification of the target sequence is achieved under the action of recombinase, single-stranded DNA binding protein (SSB), and DNA polymerase (35-42 °C, 5-20 min). Its advantages include the elimination of the need for a thermal cycler, highly specific enzymes, significantly reduced mismatch and error rates, and faster speed than PCR (typically <20 min). It also boasts high sensitivity (detecting aM-level nucleic acids). This invention selects the IS6110 gene (Mycobacterium tuberculosis gene, GenBank accession number: KP844705.1) as the target gene and designs ERA primers targeting the IS6110 gene. At 35-42 °C, it rapidly amplifies the Mycobacterium tuberculosis gene (IS6110) with a sensitivity of 1-10 copies / reaction. CRISPR / Cas14a detection: The Cas14a-sgRNA complex recognizes the ERA amplification product, activates its associated cleavage activity, and cleaves the fluorescent reporter molecule to release a detectable signal.

[0014] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0015] Example 1: Construction of positive recombinant plasmid: PCR primers were designed for the target gene IS6110 (GenBank accession number: KP844705.1) (IS6110-F: GTCATAGGAGCTTCCGACCG (as shown in SEQ ID NO.1); IS6110-R: TCGACGGCTGATGACCAAA (as shown in SEQ ID NO.2). PCR amplification was performed using the following reaction system (20 μL): 10 μL Premix Taq™ (Ex Taq™ Version 2.0), 0.5 μL each of the upstream and downstream primers (10 μM each), 1 μL genomic DNA template, and 8 μL DEPC water. Reaction conditions: 94 ℃ for 5 min; 94 ℃ for 30 s, 59 ℃ for 30 s, 72 ℃ for 1 min, for a total of 35 cycles; final 72 ℃. After 5 min, the amplification product was purified, and then homologous recombination technology was used to precisely insert the target sequence IS6110 into the pUC57 empty vector plasmid, thereby constructing the required positive recombinant plasmid pUC57-IS6110 (as shown in the figure). Figure 1 As shown), in this process, select EcoR I and Hind III serves as a specific enzyme cleavage site.

[0016] Example 2: Design and screening of ERA primers: 1. Four sets of ERA primers were designed targeting the IS6110 gene of Mycobacterium tuberculosis (as shown in Table 1) using primer design software and ERA primer design principles, and the optimal primers were screened: Table 1. ERA primer design for Mycobacterium tuberculosis IS6110

[0017] 2. Primer screening: Using four sets of ERA primers, DEPC water was used as a negative control, and the positive plasmid pUC57-IS6110 was used as a template for ERA amplification. The amplification conditions were: 37 ℃ for 20 min. The amplification products were then subjected to agarose gel electrophoresis, and the results are as follows: Figure 2 As shown, according to Figure 2 It can be seen that the bands of primers H-1, H-2 and H-3 are clearer and brighter, and there are fewer impurities compared to primer H-4. Therefore, these three sets of primers were selected for the next step of specificity screening. Using primers H-1, H-2, and H-3, respectively, and positive plasmid pUC57-IS6110 as a positive control, DEPC water as a negative control, ERA amplification was performed using the genomes of Mycobacterium tuberculosis, Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium scrofula, Mycobacterium abscessum, Mycobacterium chrysosum, Mycobacterium kansasum, Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, and Pseudomonas aeruginosa as templates. The amplification conditions were: 37 ℃ for 20 min. The amplification products were subjected to agarose gel electrophoresis, and the results are as follows. Figure 3 As shown, according to Figure 3 It can be seen that primer H-3 did not show any obvious mixed bands, and the Mycobacterium tuberculosis group showed the expected bands as well as the positive control group. The other ten non-target strain groups and the negative control group did not show any bands. Therefore, primer H-3 (H-3-F: CTGAGATCCCCTATCCGTATGGTGGATAACGT (as shown in SEQ ID NO.7); H-3-R: GCAAAGCCCGCAGGACCACGATCGCTGATC (as shown in SEQ ID NO.8)) was selected as the ERA primer for subsequent experiments.

[0018] Example 3, sgRNA design: The product sequence amplified using the optimal ERA primer H-3 (H-3-F / R) was used as the target sequence for CRISPR detection. An sgRNA was designed targeting this sequence, and the design process is as follows: Figure 4 As shown, when the CRISPR / Cas14a system functions, sgRNA guides the relevant Cas protein to recognize the PAM sequence, thereby enabling the protein to bind to the double-stranded DNA molecule and perform cleavage. The PAM sequence of the Cas14a protein is TTN (where N is any nucleotide). Based on the Protospacer sequence following the PAM sequence, sgRNA is designed by searching for a continuous TTN sequence on the IS6110 gene sequence and then selecting the 20-25 nt following it to design the target sequence. The selected Protospacer sequence is compared and analyzed using BLAST on NCBI, and the results show that this sequence is only present in the target bacterial species. Mycobacterium tuberculosis , M.tb In the genome of the target bacterium, no overlapping sequences were found in the genomes of other non-target bacteria (e.g., Figure 5 (As shown); the selected sequence is then combined with a fixed hairpin structure sequence to synthesize a complete sgRNA sequence; The final sgRNA sequence is shown in SEQ ID NO.11, specifically (the conserved region of the target sequence IS6110 gene is underlined): 5'-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAAC ggaccaccagcac cuaaccg -3'.

[0019] Example 4: Design of ssDNA reporter molecules: When Cas14a binds to sgRNA and matches a target sequence, it will activate its cleavage activity and cut ssDNA. This principle can be used to detect target sequences. Cas14a has a better cleavage effect on T-rich ssDNA, so the basic sequence of the synthesized ssDNA was chosen to be TTTTTTTT. When designing ssDNA fluorescent reporter molecules, a fluorescent group FAM was attached to the 5′ end of the basic sequence TTTTTTTT and a quenching group BHQ1 was attached to the 3′ end. The designed ssDNA fluorescent reporter molecule is 5′-FAM-TTTTTTTT-BHQ1-3′. Under normal circumstances, the reporter molecule does not produce a fluorescent signal. When the Cas14a protein binds to sgRNA, if the target sequence is present in the system, the complex of the Cas14a protein and sgRNA will recognize the target sequence and activate the cleavage activity of the Cas14a protein. At this time, the ssDNA reporter molecule can be cleaved. After cleavage, the fluorescent group in the ssDNA fluorescent reporter molecule separates from the quenching group, producing a fluorescent signal. Fluorescence will appear under the illumination of a light source of a specific wavelength.

[0020] Example 5: A rapid detection system for Mycobacterium tuberculosis, comprising an ERA reaction system and a CRISPR / Cas14a detection system, wherein: Each 50 μL ERA reaction system contains the following components: 1-20 μM ERA forward primer, 1-20 μM ERA reverse primer, 5-25 μM DNA template of the sample to be tested, 20 μL of DA solvent, 2 μL of MC activator, and DEPC water to make up to 50 μL. The forward primer for ERA is H-3-F, and the reverse primer for ERA is H-3-R. Each 10 μL CRISPR-Cas14a detection system contains the following components: 4 μL 10×HOLMES Buffer, 25–300 nM Cas14a enzyme, 25–300 nM sgRNA, 5–100 μM ssDNA fluorescent reporter molecule, 0.5–3 μL ERA product, and DEPC water to a final volume of 10 μL; the ERA product is the amplification product obtained using the ERA reaction system.

[0021] Example 6: A rapid detection method for Mycobacterium tuberculosis, comprising the following steps: S1, ERA amplification: The amplification system includes: ERA forward primer, ERA reverse primer, genomic DNA template of the sample to be tested, DA solvent, MC activator, and DEPC water; Amplification conditions and procedures: After extracting genomic DNA from the sample to be tested, add each component according to the above amplification system and mix well, then react at 37 ℃ for 8 min; S2 and CRISPR / Cas detection: The reaction system includes: the ERA amplification product obtained from S1, sgRNA, Cas14a, single-stranded DNA reporter molecules modified with fluorescent and quenching groups, DEPC water, and 10×HOLMES Buffer; Reaction conditions: After adding each component according to the above reaction system and mixing well, react at 37 ℃ for 20 min; S3, Signal Reading and Analysis The signal reading in this step can be performed using either quantitative fluorescence or fluorescence visualization. Among them, quantitative fluorescence refers to placing the sample of the CRISPR / Cas detection reaction system under a wavelength of 450-520 nm for quantitative fluorescence analysis. When the fluorescence intensity is higher than 0 RFU, it indicates that Mycobacterium tuberculosis has been detected. Fluorescence visualization refers to placing the sample of the CRISPR / Cas detection reaction system under a light source with a wavelength of 450-520 nm and directly observing the fluorescence with the naked eye. Compared with the negative control (using DEPC water as the negative control), the appearance of green fluorescence indicates that Mycobacterium tuberculosis has been detected. Specifically, in this embodiment, in order to use the fluorescence quantitative function of the fluorescence quantitative PCR instrument, the CRISPR / Cas detection in step S2 is performed directly in the fluorescence quantitative PCR instrument. During the reaction, the fluorescence signal is collected every 30 seconds at a wavelength of 500 nm. If the fluorescence intensity is higher than 0 RFU, it indicates that Mycobacterium tuberculosis has been detected. Alternatively, after the CRISPR / Cas detection reaction is complete, remove the reaction tube and immediately observe the fluorescence directly with the naked eye under a 500 nm light source. The appearance of green fluorescence compared to the negative control (using DEPC water as the negative control) indicates the detection of Mycobacterium tuberculosis.

[0022] Example 6: Fluorescence colorimetric detection and feasibility analysis: After screening the optimal ERA primers in Example 3 and designing and synthesizing sgRNA and ssDNA fluorescent reporter molecules in Example 4, the feasibility of the CRISPR / Cas14a system for detecting Mycobacterium tuberculosis was analyzed, and the results are as follows: Figure 6 As shown, when the CRISPR / Cas14a system is fully functional, it can produce a strong fluorescence signal, which can be used for... M.tb Direct detection of DNA was achieved. However, when the system lacked Cas14a protein, sgRNA, and ssDNA, and the target was not amplified, the real-time fluorescence and visualization results showed no fluorescence, indicating that the method for rapid detection of Mycobacterium tuberculosis based on the ERA-CRISPR / Cas14a system fluorescence method was successfully constructed.

[0023] Example 7: Optimization of ERA amplification reaction conditions: Based on the initial ERA reaction system and reaction temperature, 11 time gradients (4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 min) were set to optimize the ERA reaction time. Furthermore, six temperature gradients (25, 30, 35, 37, 40, and 45 °C) were set to optimize the ERA reaction temperature. The results are as follows: Figure 7 As shown, the bands are clearer and tend to be stable when the ERA amplification time is 8 min or more. To shorten the detection time, the optimal ERA reaction time is determined to be 8 min. Based on the initial ERA reaction system and the optimized reaction time, the results are as follows: Figure 7 As shown, the bands were darker at temperatures of 25, 30, and 35 °C, while amplification products could be obtained at 37, 40, and 45 °C. In the CRISPR / Cas14a detection system, the optimal temperature for Cas14a protein is 37 °C. Therefore, the optimal reaction temperature for ERA was determined to be 37 °C.

[0024] Example 8: Optimization of sgRNA concentration, Cas14a protein concentration, ssDNA probe concentration, and ERA amplification product addition: To screen for the optimal sgRNA concentration, Cas14a protein concentration, ssDNA probe concentration, and ERA amplification product addition amount, the following settings were implemented: sgRNA concentrations of 300, 250, 200, 150, 100, 50, and 25 nmol / L; Cas14a protein concentrations of 300, 250, 200, 150, 100, 50, and 25 nmol / L; ssDNA probe concentrations of 100, 80, 60, 40, 20, 10, and 0 μmol / L; and ERA amplification product addition amounts of 3.0, 2.5, 2.0, 1.5, 1.0, 0.5, and 0 μL. The optimal reaction system was determined by comparing the real-time fluorescence detection and visualization detection effects under different conditions. The results are shown below. Figure 8 As shown, the real-time fluorescence and visualization detection effect of Mycobacterium tuberculosis ERA-CRISPR / Cas14a was best when the sgRNA concentration was 200 nmol / L, the Cas14a protein concentration was 250 nmol / L, the ssDNA probe concentration was 40 μmol / L, and the ERA amplification product was added in an amount of 1.5 μL.

[0025] Example 9: Specificity of the ERA-CRISPR / Cas14a detection method for Mycobacterium tuberculosis: To verify the specificity of the detection reagents provided in Example 5 and the ERA-CRISPR / Cas14a rapid detection method provided in Example 6 for the detection of Mycobacterium tuberculosis, this example performs real-time fluorescence ERA-CRISPR / Cas14a specific detection, visualization of ERA-CRISPR / Cas14a, and agarose gel electrophoresis detection of ERA amplification products on the target strain (Mycobacterium tuberculosis) and 10 other non-target strains (Mycobacterium smegmatis, Mycobacterium marinum, Mycobacterium scrofula, Mycobacterium abscessus, Mycobacterium chrysostomum, Mycobacterium kansasum, Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, and Pseudomonas aeruginosa). The specific process is as follows: First, the genomes of Mycobacterium tuberculosis and 10 other non-target strains were extracted. Then, using the constructed positive recombinant plasmid pUC57-IS6110 as a positive control and DEPC water as a negative control, the genomes of Mycobacterium tuberculosis and the other 10 non-target strains were detected using the ERA-CRISPR / Cas14a detection method. The specific process is as follows: S1. Extract the genomes of Mycobacterium tuberculosis and 10 other non-target strains; S2, ERA amplification: Amplification system: Each 50 μL ERA reaction system contains the components shown in Table 2: Table 2 ERA reaction system for Mycobacterium tuberculosis

[0026] Note: ERA amplification reagent, model: KS101 (Xianda Gene Biotechnology, basic nucleic acid amplification reagent (ERA method)); Amplification conditions and procedure: react at 37 °C for 8 min in a constant temperature metal bath; Part of the ERA amplification product was used for CRISPR / Cas14a detection in step S3, and the other part was directly subjected to agarose gel electrophoresis (results are shown below). Figure 9 (as shown in C). S3 and CRISPR / Cas14a detection systems are shown in Table 3: Table 3 CRISPR / Cas14a detection system for Mycobacterium tuberculosis

[0027] Reaction conditions: A real-time PCR instrument was used, and the reaction was carried out at 37 ℃ for 20 min. During this period, fluorescence signals were collected every 30 s at a wavelength of 500 nm (results are shown in the figure). Figure 9 As shown in Figure A), after the fluorescence signal detection was completed, the reaction tube was immediately removed and the fluorescence intensity was observed under a 500 nm wavelength light source with DEPC water as a negative control (the results are shown in Figure A). Figure 9 (As shown in B) S3. Signal Reading and Analysis: The results are as follows Figure 9 As shown: Figure 9 As shown in Figure A, curve 1 is red (positive recombinant plasmid), curve 2 is blue (Mycobacterium tuberculosis H37Ra), while no fluorescent signal was detected in curves 3-13; Figure 9 As shown in Figure B, tube 1 (positive recombinant plasmid) and tube 2 (Mycobacterium tuberculosis H37Ra) showed obvious green fluorescence, while tubes 3-13 did not show any fluorescence signal. Figure 9 ERA amplification of the C-band plasmid and agarose gel electrophoresis results showed that bands 1 (positive recombinant plasmid) and 2 (Mycobacterium tuberculosis H37Ra) were clear and bright. However, no bands were observed for plasmids 3-13. Right now Figure 9 Results A, B, and C all indicate that, compared to the negative control, only strain 1 (positive recombinant plasmid) and strain 2 (Mycobacterium tuberculosis H37Ra) were detected, while the other 10 non-target strains were not detected. This demonstrates that the detection method using the IS6110 gene as the target gene provided in this embodiment of the invention has good specificity. Among them, the fluorescence quantitative Mycobacterium tuberculosis ERA-CRISPR / Cas14a detection method is the most efficient, and can complete ERA amplification, CRISPR / Cas14a detection, and visualization results within 30 minutes.

[0028] Example 10: Sensitivity of the ERA-CRISPR / Cas14a detection method for Mycobacterium tuberculosis: To verify the sensitivity of the ERA-CRISPR / Cas14a detection method provided in this embodiment of the invention for detecting Mycobacterium tuberculosis, the positive plasmid pUC57-IS6110 was used as a detection template and serially diluted 10-fold, resulting in concentrations of 3.51 × 10⁻⁶. 6 copies / μL, 3.51×10 5 copies / μL, 3.51×10 4 copies / μL, 3.51×10 3 copies / μL, 3.51×10 2 copies / μL, 3.51×10 1 copies / μL and 3.51×10 0 The positive plasmid pUC57-IS6110 was then detected using the same ERA-CRISPR / Cas14a detection method as described in Example 7, with each copy / μL diluted. After the ERA reaction, CRISPR / Cas14a detection was performed using a real-time PCR instrument at 37 °C for 20 min. Fluorescence signals were collected every 30 s under a 500 nm light source. The results are as follows: Figure 10 As shown in A; After the fluorescence signal detection was completed, the reaction tube was immediately removed and the fluorescence brightness was observed under a 500 nm wavelength light source. The results are as follows: Figure 10 As shown in B; Furthermore, agarose gel electrophoresis of the ERA amplification products was used as a control: ERA amplification was performed using the diluted positive plasmid pUC57-IS6110 as a template under the following conditions: 37 ℃ for 8 min, followed by 2% agarose gel electrophoresis. The results are as follows: Figure 10 As shown in C; To compare the sensitivity with the PCR method: The diluted positive plasmid pUC57-IS6110 was used as a template. PCR amplification primers were IS6110-F: GTCATAGGAGCTTCCGACCG (as shown in SEQ ID NO.1); IS6110-R: TCGACGGCTGATGACCAAA (as shown in SEQ ID NO.2) for PCR amplification (the amplification product was the IS6110 target fragment). Amplification conditions: 94 ℃ for 5 min; 94 ℃ for 30 s, 59 ℃ for 30 s, 72 ℃ for 1 min, for a total of 35 cycles; 72 ℃ for 5 min. Product detection: 5 μL of the PCR amplification product was detected by 1% agarose gel electrophoresis. The results are shown below. Figure 10 As shown in D; like Figure 10 The results from the study A showed that when the positive plasmid concentration was 3.51 copies / μL (red curve No. 8), the fluorescence intensity of the ERA-CRISPR / Cas14a detection method for Mycobacterium tuberculosis was higher than that of 0 RFU. like Figure 10 The results from the study showed that, compared with the negative control (reaction tube 9), the ERA-CRISPR / Cas14a detection method showed significantly higher fluorescence intensity for Mycobacterium tuberculosis detection when the positive plasmid concentration was 3.51 copies / μL (reaction tube 8). Although agarose gel electrophoresis of ERA amplification products is a cumbersome and time-consuming procedure, it can serve as a control, such as... Figure 10 The results showed that, compared with the negative control, a more obvious band appeared when the concentration of the positive plasmid was 3.51 copies / μL; That is, Figure 10 Results A, B, and C all showed a positive plasmid concentration of 3.51 × 10⁻⁶. 6 ~3.51×10 0 ERA amplification products can be detected in the range of copies / μL; Compared to Figure 10 The limit of detection for PCR sensitivity in the middle D-phase was 3.51 × 10⁻⁶. 3 copies / μL, the ERA-CRISPR / Cas14a method is 10 times more sensitive than the PCR method. 3 It has a higher sensitivity, which is several times greater.

[0029] Example 11: Detection of Mycobacterium tuberculosis in simulated sputum samples: To evaluate the feasibility and accuracy of the ERA-CRISPR / Cas14a method established in the embodiments of the present invention in actual sample detection, PCR method was selected as a control. First, simulated sputum samples were tested to evaluate the accuracy of the ERA-CRISPR / Cas14a method. Then, sputum samples and nasal swab samples were tested to evaluate the detection effect of the ERA-CRISPR / Cas14a method in clinical samples. (1) Sixty sterile sputum samples with nucleic acid removed were tested using PCR and ERA-CRISPR / Cas14a methods, respectively. Eight samples were randomly selected from the 60 sputum samples for artificial contamination as simulated positive sputum samples, and the other 52 samples were used as simulated negative sputum samples. The testing of the 60 simulated sputum samples was considered as one experiment and was repeated three times. The specific operation of the simulated samples is as follows: Sterilization and removal of nucleic acid: Each 1400 μL sputum sample was autoclaved at 121°C for 15 min. After cooling, 10 μL of nuclease (Benzonase® Nuclease) was added and aseptically homogenized. The sample was then incubated at 37°C for 30 min to obtain a sterile sample with removed nucleic acid. Finally, the sample was heated at 60°C for 10 min to remove the nuclease. Preparation of positive bacterial suspension: Mycobacterium tuberculosis H37Ra ( Mycobacterium tuberculosis The bacterial culture was inoculated into autoclaved nutrient broth and incubated at 37°C for 36 h. Then, a single colony was picked using a disposable sterile inoculation loop and inoculated into 20 mL of autoclaved nutrient broth liquid medium. This medium was then incubated at 37°C with a shaker at 180 rpm for 16 h. Finally, the bacterial concentration was serially diluted 10-fold with sterile water to obtain concentrations of 2.07 × 10⁻⁶. 8 CFU / mL, 2.07×10 7 CFU / mL, 2.07×10 6 CFU / mL, 2.07×10 5 CFU / mL, 2.07×10 4 CFU / mL, 2.07×10 3 CFU / mL, 2.07×10 2 CFU / mL, 2.07×10 1 CFU / mL and 2.07×10 0 CFU / mL bacterial suspension; Simulated sputum positive samples: 600 μL of each of the 8 concentrations of bacterial suspension were evenly added to 8 randomly selected 1400 μL of sterile sputum samples with nucleic acid removed, and mixed thoroughly to serve as the final positive samples for detection. Simulated sputum negative samples: Take 600 μL of DEPC water and add it evenly to the other 52 1400 μL sterile sputum samples with nucleic acid removed, mix thoroughly, and use them as the final negative samples for testing; The above 60 samples (8 simulated sputum positive samples + 52 simulated sputum negative samples) were processed as follows: First, 2 mL of sputum sample was added to 4 mL of 4% NaOH solution, vortexed and mixed until liquefied, centrifuged at 12000 rpm for 3 min, and the supernatant was discarded; 1 mL of sterile physiological saline was added to the precipitate, resuspended and mixed, centrifuged at 12000 rpm for 3 min, and the supernatant was discarded; 50 μL of nucleic acid releasing agent was added to the precipitate, mixed thoroughly, incubated at 85 ℃ for 10 min, centrifuged at 12000 rpm for 3 min, and the supernatant was used as the sample to be tested and stored at -20 ℃ for later use.

[0030] The testing process is as follows: ERA-CRISPR / Cas14a method: After the prepared test samples were taken out of the -20 ℃ freezer, they were thawed naturally at room temperature. After being subjected to instantaneous centrifugation, the samples were tested using the optimized ERA-CRISPR / Cas14a method. The specific detection method and reaction system of ERA-CRISPR / Cas14a were the same as those described in Example 7. PCR method: The prepared test samples were removed from the -20 ℃ freezer and thawed naturally at room temperature. After brief centrifugation, the samples were analyzed using PCR. The PCR primers (IS6110-F: GTCATAGGAGCTTCCGACCG (as shown in SEQ ID NO.1); IS6110-R: TCGACGGCTGATGACCAAA (as shown in SEQ ID NO.2)) and the reaction system (20 μL) specifically included: Premix Taq 10 μL of PCR product, 0.5 μL each of forward and reverse primers (10 μM), 1 μL of genomic DNA template, and DEPC water to a final volume of 20 μL. Reaction program: 94 ℃ for 5 min; 94 ℃ for 30 s, 59 ℃ for 30 s, 72 ℃ for 1 min, for a total of 35 cycles; 72 ℃ for 5 min. Product detection: 5 μL of PCR product was subjected to 1% agarose gel electrophoresis. Using a DL-2000 DNA Marker as a reference, the target band was observed using a gel imaging system to check if it matched the expected result. The detection rate is calculated using the formula: Detection rate = (Number of positive samples / Total number of tests) × 100%. The concordance rate is calculated as follows: Concordance rate = (Number of true positives + Number of true negatives) / (Number of true positives + Number of false negatives + Number of true negatives + Number of false positives) / (Number of true positives + Number of true negatives) / Total number of tests × 100%. The test results are shown in Table 4: Table 4. Detection results of simulated sputum samples

[0031] Table 4 shows the following concordance rates between the two detection methods for 60 manually processed sputum samples: PCR had a concordance rate of 95%; the ERA-CRISPR / Cas14a method had a concordance rate of 100% (detected in all three replicates of each group). The reason for the lower concordance rate of the PCR method compared to the ERA-CRISPR / Cas14a method is that the PCR method can only detect bacterial cultures with a concentration ≥2.07 × 10⁻⁶. 3Simulated sputum samples with CFU / mL, specifically those using 2.07 × 10⁻⁶ CFU / mL. 2 CFU / mL, 2.07×10 1 CFU / mL and 2.07×10 0 Three sputum samples artificially contaminated with CFU / mL bacterial suspension could not be detected by PCR, and this result was consistent in three repeated experiments.

[0032] The above results indicate that the ERA-CRISPR / Cas14a method has high sensitivity and accuracy.

[0033] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for detecting sgRNA in Mycobacterium tuberculosis based on a combination of ERA and CRISPR / Cas14a, characterized in that, The sequence of the sgRNA is shown in SEQ ID NO.

11.

2. A kit for detecting Mycobacterium tuberculosis based on a combination of ERA and CRISPR / Cas14a, characterized in that, It includes the sgRNA as described in claim 1, Cas14a protein, single-stranded DNA reporter molecules modified with fluorescent and quenching groups, 10×HOLMES Buffer, and upstream and downstream primers for ERA amplification.

3. The reagent kit according to claim 2, characterized in that, The sequences of the upstream and downstream primers used for ERA amplification are shown in SEQ ID NO.7-8.

4. The reagent kit according to claim 2, characterized in that, The Cas14a protein is selected from Un1Cas12f1.

5. The reagent kit according to claim 2, characterized in that, The modified single-stranded DNA reporter molecule with fluorescent and quenching groups is 5′-FAM-TTTTTTTT-BHQ1-3′.

6. The use of the sgRNA as described in claim 1 or the kit as described in claim 2 in the detection of Mycobacterium tuberculosis for non-diagnostic purposes.

7. A method for detecting Mycobacterium tuberculosis based on a combination of ERA and CRISPR / Cas14a for non-diagnostic purposes, characterized in that, Includes the following steps: S1. Using the upstream and downstream primers for ERA amplification in the kit as described in claim 2, ERA amplification is performed to obtain CRISPR / Cas14a detection nucleic acid samples; S2. Mix all components of the kit as described in claim 2, except for the primers, with the CRISPR / Cas14a nucleic acid sample and react at 37 °C for 20 min. S3. Fluorescence intensity is detected during or at the end of the reaction. If the fluorescence intensity is higher than 0 RFU or fluorescence is directly observed with the naked eye, it proves that Mycobacterium tuberculosis has been detected.

8. The method according to claim 7, characterized in that, In S1, the ERA amplification system is as follows: 1-20 μM upstream primer for ERA amplification, 1-20 μM downstream primer for ERA amplification, 5-25 μM DNA template of the sample to be tested, 20 μL of DA solvent, 2 μL of MC activator, and DEPC water to a final volume of 50 μL.

9. The method according to claim 8, characterized in that, In S1, the ERA amplification process is as follows: after extracting the DNA template of the sample to be tested, add each component according to the ERA amplification system and mix well, then react at 37 ℃ for 8 min.

10. The method according to claim 7, characterized in that, In S3, the fluorescence intensity detection is specifically performed under illumination by a light source with a wavelength of 450-520 nm.

Images