Enrofloxacin aptamer, screening method and application thereof

Abstract

The application discloses an enrofloxacin aptamer as well as a screening method and application thereof, and belongs to the field of food safety detection and functional nucleic acid design. The nucleotide sequence of the aptamer is shown as SEQ ID NO. 9. The application further provides a colorimetric-fluorescent dual-mode detection system based on the combination of the aptamer and a metal organic framework material. The screening method is designed by performing molecular docking and interaction analysis on a known high-affinity template, identifying active bases and fragments, implementing multi-template fusion, non-key region truncation and key base directional optimization, combining secondary virtual screening and experimental verification, and obtaining the aptamer with significantly improved affinity. The method breaks the randomness of the traditional screening method and realizes rational design based on structural information. It is verified that EN46 has excellent selectivity and binding stability for enrofloxacin, can be effectively used for dual-mode detection, and provides a reliable recognition element for rapid detection of enrofloxacin residues.

Description

Technical Field

[0001] This invention relates to the fields of food safety testing and functional nucleic acid design, and in particular to an enrofloxacin nucleic acid aptamer, its screening method, and its application. Background Technology

[0002] Enrofloxacin (ENR) is a fluoroquinolone antibacterial drug widely used in livestock and aquaculture. Developing sensitive, rapid, and easily constructible recognition elements for enrofloxacin residues in animal-derived foods and related samples is of great significance. Nucleic acid aptamers, composed of specific oligonucleotide sequences, can specifically bind to targets through their spatial conformation. They are easy to synthesize, easy to modify, and have good stability, making them suitable as molecular recognition elements for enrofloxacin detection systems.

[0003] Traditional nucleic acid aptamers are typically obtained from random nucleic acid libraries using SELEX (Systematic Evolution of Ligands by Exponential Enrichment) screening strategies. The core of this method lies in multiple rounds of binding, separation, and enrichment, and the screening process is highly experimentally dependent and somewhat random. For small molecule targets such as enrofloxacin, relying solely on random library screening often fails to fully utilize the effective binding structures already formed in existing high-affinity sequences.

[0004] With the development of molecular structure prediction and molecular docking technology, computational methods can be used to predict the binding conformation between nucleic acid aptamers and small molecules and obtain molecular docking scores (affinity). However, if molecular docking is only used as a scoring tool for candidate sequences without further analysis of the specific nucleotides, active fragments, binding sites, and interaction types involved in binding in known superior aptamers, the generation of new sequences may still depend on empirical combinations or random variations, failing to fully utilize the structural information contained in existing high-affinity templates.

[0005] Therefore, it is necessary to establish a nucleic acid aptamer design and screening method that progresses step by step from "known template - binding information analysis - directed sequence design - batch virtual screening - experimental verification - dynamic mechanism verification" to obtain high-affinity enrofloxacin nucleic acid aptamers and overcome the randomness and experience dependence of traditional SELEX screening. Summary of the Invention

[0006] The purpose of this invention is to provide an enrofloxacin nucleic acid aptamer, its screening method, and its application, to address the problems existing in the prior art. This method involves molecular docking and interaction analysis of known high-affinity aptamers to identify active bases and fragments. It then implements multi-template fragment fusion, non-critical region truncation, and key base orientation optimization. Combined with secondary virtual screening and experimental verification, aptamers with significantly enhanced affinity are obtained. This method overcomes the randomness and empirical dependence of traditional SELEX screening, achieving rational design based on structural information. The obtained aptamers can be applied to a colorimetric-fluorescence dual-mode detection system, providing a highly efficient recognition element for enrofloxacin residue detection.

[0007] To achieve the above objectives, the present invention provides the following solution: The present invention provides an enrofloxacin nucleic acid aptamer, the nucleotide sequence of which is shown in SEQ ID NO.9.

[0008] The present invention also provides the application of the enrofloxacin nucleic acid aptamer in the preparation of enrofloxacin detection products.

[0009] Preferably, the detection product includes a colorimetric detection kit or a fluorescence detection kit.

[0010] The present invention also provides an enrofloxacin detection system comprising the aforementioned enrofloxacin nucleic acid aptamer and a metal-organic framework material.

[0011] Preferably, the detection system is a colorimetric-fluorescence dual-mode detection system. In the colorimetric mode, the colorimetric mode utilizes the metal-organic framework material to catalyze the colorimetric system for color development. In the fluorescence mode, FAM-labeled enrofloxacin aptamers are used. Based on the fluorescence quenching of adjacent FAM labels by the metal-organic framework material, enrofloxacin induces a conformational change in the enrofloxacin aptamers, thereby releasing the FAM-labeled enrofloxacin aptamers and restoring the fluorescence signal.

[0012] This invention also provides a method for designing and screening the enrofloxacin nucleic acid aptamers, comprising the following steps: Multiple known enrofloxacin nucleic acid aptamers and their affinity data were obtained, and aptamers with affinity meeting preset conditions were selected as templates. The template was constructed with a tertiary structure and molecularly docked with enrofloxacin. The tertiary structure with the highest molecular docking score was obtained, which is the optimal binding conformation. Interaction analysis was performed on the optimal binding conformation, the nucleotides that directly participate in enrofloxacin binding were labeled as active bases, and active nucleotide fragments were defined based on the active bases and their adjacent sequences. Based on the active nucleotide fragments, the active regions of multiple templates are combined across templates, and non-critical regions are truncated to construct an initial candidate sequence library; The sequences in the initial candidate sequence library are subjected to key base orientation optimization and repeatability screening to obtain a candidate sequence library; The sequences in the candidate sequence library were reconstructed using a tertiary structure and molecularly docked with enrofloxacin again. Virtual screening was performed using molecular docking scores as an indicator to obtain virtual-screened candidate sequences. The candidate sequences after virtual screening were subjected to experimental affinity verification, and the sequence with the highest affinity was selected as the target enrofloxacin nucleic acid aptamer.

[0013] Preferably, the aptamer whose affinity meets the preset condition is an aptamer with a dissociation constant Kd < 100 nM.

[0014] Preferably, the template includes a main template and a sub-template, wherein the main template is SEQ.A52 and Apt58, and the sub-template is SEQ.A5, Apt6, SEQ11, SEQ.A6, SEQ10, and SEQ13; The nucleotide sequences of SEQ.A52 and Apt58 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the nucleotide sequences of SEQ.A5, Apt6, SEQ11, SEQ.A6, SEQ10 and SEQ13 are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0015] Preferably, the interaction analysis includes the number of hydrogen bonds, π-π hydrophobic interactions, π-alkyl hydrophobic interactions, and the interaction distance and type of halogen bonds.

[0016] Preferably, the key base orientation optimization is performed by: retaining key bases, directionally replacing and reconstructing sequences in the initial candidate sequence library based on the position, interaction type and interaction distance of the active bases; The affinity verification in the experiment was performed using the graphene oxide fluorescence quenching method, and the dissociation constant Kd was calculated by nonlinear fitting.

[0017] The present invention discloses the following technical effects: (1) A high-affinity enrofloxacin nucleic acid aptamer EN46 is provided: The EN46 aptamer obtained by rational design screening in this invention has a dissociation constant Kd value of 6.42±3.07 nM, which is lower than most existing enrofloxacin aptamers (such as template SEQ.A52 with Kd of 11.07 nM), and has excellent target binding affinity, providing a more sensitive recognition element for enrofloxacin detection.

[0018] (2) The "docking score ranking" is further improved to "template binding information reverse analysis": After performing molecular docking on the template aptamer, this invention not only records the molecular docking score, but also systematically extracts information such as the specific bases involved, the location of the interaction, the distance between the interaction and the interaction, the enrofloxacin functional group, as well as hydrogen bonds, π-related hydrophobic interactions and halogen bonds, providing a clear structural basis for subsequent sequence design.

[0019] (3) Establishment of a method for multi-template active fragment fusion, truncation, and key base orientation optimization: This invention does not generate candidate sequences through random mutation, but rather performs cross-template fragment combination and truncation optimization based on the active nucleotides, dominant fragments, and key interactions identified by the docking of multiple template aptamers with enrofloxacin molecules. Taking EN46 as an example, it is obtained through active fragment fusion, non-critical region truncation, and dominant base orientation optimization, based on SEQ.A52, SEQ10, and Apt6 as specific sequence sources, and is supported by clear template structure information.

[0020] (4) Rapid virtual pre-screening can be performed on a large candidate sequence library: The implementation of this invention designs 94 initial sequences based on the structural information of 8 templates. After directional optimization and deduplication, 85 candidate aptamers are obtained. Batch evaluation is completed through the second round of molecular docking. Then, 9 advantageous sequences are selected from them for experimental verification, thereby compressing a large candidate sequence library into a small number of wet experimental objects.

[0021] (5) The calculation results were experimentally verified: multiple sequences with scores superior to the best template appeared at the virtual molecular docking level; the final optimized AutoDock Vina molecular docking score of EN46 was -9.375 kcal / mol, which was more favorable than the -8.172 kcal / mol of the template SEQ.A52. GO fluorescence quenching experiments further showed that the Kd of EN46 was 6.42±3.07 nM, which was lower than the 11.07 nM of SEQ.A52 reported using the same type of GO fluorescence quenching method, indicating that the directional design and stepwise screening strategy of the present invention can obtain enrofloxacin nucleic acid aptamers with high practical affinity.

[0022] (6) Forming a closed-loop technical route of "static structural design - experimental affinity verification - dynamic mechanism verification": Further 100 ns molecular dynamics simulations were performed on the EN46-enrofloxacin complex system to evaluate its dynamic binding stability from the perspectives of RMSD, RMSF, Rg, SASA, hydrogen bonds, and MM / PBSA binding free energy, providing mechanistic support for the screening results. This invention not only obtained the enrofloxacin nucleic acid aptamer EN46 with high binding capacity, but also constructed a dual-mode verification system using Ce / Cu-BDC functional materials, demonstrating that EN46 has good recognition ability and application value through colorimetric signal conversion and fluorescence quenching recovery mechanisms. This invention forms a complete technical chain from computational design, experimental screening, mechanism analysis to application verification. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is a schematic diagram of the representative molecular docking conformation and interaction between the enrofloxacin nucleic acid aptamer of SEQ.A52 template and enrofloxacin; Figure 2 A schematic diagram showing the representative molecular docking conformation and interaction between the Apt58 template enrofloxacin nucleic acid aptamer and enrofloxacin; Figure 3 This is a schematic diagram of the representative molecular docking conformation and interaction between the enrofloxacin nucleic acid aptamer of SEQ.A5 template and enrofloxacin; Figure 4 A schematic diagram showing the representative molecular docking conformation and interaction between the Apt6 template enrofloxacin aptamer and enrofloxacin; Figure 5 This is a schematic diagram of the representative molecular docking conformation and interaction between the enrofloxacin nucleic acid aptamer of SEQ.A6 template and enrofloxacin; Figure 6 This is a schematic diagram of the representative molecular docking conformation and interaction between the enrofloxacin nucleic acid aptamer of SEQ10 template and enrofloxacin; Figure 7 This is a schematic diagram of the representative molecular docking conformation and interaction between the enrofloxacin nucleic acid aptamer of SEQ11 template and enrofloxacin; Figure 8 This is a schematic diagram of the representative molecular docking conformation and interaction between the enrofloxacin nucleic acid aptamer of SEQ13 template and enrofloxacin; Figure 9A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN46 and enrofloxacin; Figure 10 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN56 and enrofloxacin; Figure 11 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN61 and enrofloxacin; Figure 12 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN63 and enrofloxacin; Figure 13 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN50 and enrofloxacin; Figure 14 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN52 and enrofloxacin; Figure 15 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN47 and enrofloxacin; Figure 16 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN36 and enrofloxacin; Figure 17 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN59 and enrofloxacin; Figure 18 A schematic diagram of the molecular docking conformation and interaction between the newly designed candidate aptamer EN35 and enrofloxacin; Figure 19 The nonlinear fitting curves for determining the binding affinity of the newly designed candidate aptamer to enrofloxacin using the GO fluorescence quenching method are shown; A represents EN46, B represents EN63, C represents EN56, and D represents EN50. Figure 20 The nonlinear fitting curves for determining the binding affinity of the newly designed candidate aptamer to enrofloxacin using the GO fluorescence quenching method are shown; A represents EN52, B represents EN47, C represents EN36, and D represents EN35. Figure 21 The nonlinear fitting curves for determining the binding affinity of the newly designed candidate aptamer to enrofloxacin using the GO fluorescence quenching method are shown; A represents EN59, and B represents EN61. Figure 22 The 100 ns molecular dynamics simulation results are used to optimize the aptamer EN46 and enrofloxacin complex system, where A is RMSD, B is SASA, C is RMSF, and D is radius of gyration Rg. Figure 23The 100 ns molecular dynamics simulation results are used to optimize the aptamer EN46 and enrofloxacin complex system; where A represents the number of hydrogen bonds and B represents the energy composition analysis of MM / PBSA. Figure 24 Figure 1 shows the results of a dual-mode functional verification system based on the EN46 aptamer and Ce / Cu-BDC functional materials. A represents the colorimetric response of Ce / Cu-BDC catalysis, B represents the verification of the specificity of the EN46 aptamer through changes in the colorimetric signal, C represents the fluorescence quenching recovery response of FAM-EN46, and D represents the verification of the specificity of the EN46 aptamer through changes in the fluorescence signal response. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] This invention uses reported high-affinity enrofloxacin aptamers as template information. Through molecular docking, it analyzes the key binding sites, active nucleotide fragments, and non-covalent interaction characteristics between the template aptamer and enrofloxacin. Further, it performs multi-template active fragment fusion, sequence truncation, and key base orientation optimization. Combining secondary molecular docking of candidate sequences, GO fluorescence quenching affinity determination, and molecular dynamics simulations, it achieves targeted design and screening of enrofloxacin aptamers. Based on the obtained preferred aptamer EN46, a detection and verification system is constructed using Ce / Cu-BDC functional materials. Its application performance is evaluated through colorimetric and fluorescence response tests, as well as specificity experiments. The above technical solutions are further described below with specific embodiments.

[0031] Example 1: Establishment, structure construction and molecular docking of template aptamers 1. Template adapter selection A total of 47 reported enrofloxacin nucleic acid aptamers and their affinity data were collected through a review of publicly available literature. The Kd value reported in the publicly available literature was used as the initial screening indicator. Eight aptamers with Kd < 100 nM were selected from the 47 known sequences as subsequent design templates, namely SEQ.A52, Apt58, SEQ.A5, Apt6, SEQ11, SEQ.A6, SEQ10, and SEQ13. The Kd values, nucleotide sequences, AutoDock Vina molecular docking scores, and active bases of the eight templates are shown in Table 1.

[0032] Among them, SEQ.A52 has a Kd of 11.07 nM and Apt58 has a Kd of 14.19 nM, showing better affinity among the eight templates. Therefore, SEQ.A52 and Apt58 were selected as the main templates, and the remaining six aptamers were used as secondary templates to supplement the active nucleotide fragments and beneficial binding base information in different sequence frames.

[0033] 2. Structural preparation of the template adapter and enrofloxacin The three-dimensional chemical structure of enrofloxacin was obtained from the PubChem database and converted into a structural file for molecular docking. The template aptamer was used for tertiary structure prediction using the AlphaFold program. The predicted three-dimensional structure was then input into Discovery Studio for visualization and conversion into PDB format.

[0034] AutoDock Tools was used to perform pre-docking processing on eight template aptamers, including adding polar hydrogen, recording charge, determining atom types, and saving in PDBQT format. Enrofloxacin was added with Gasteiger charge, and after detecting five rotatable bonds, the data was saved in PDBQT format.

[0035] The three-dimensional structures of the eight template aptamers were observed using PyMOL, and the center coordinates and side lengths of the docking box were determined based on the spatial dimensions and potential binding regions of each template. Subsequently, AutoDock Vina was used to perform molecular docking of the eight template aptamers with enrofloxacin. Ten candidate binding conformations were generated for each system, and the conformation with the best molecular docking score was selected for subsequent interaction analysis.

[0036] 3. Reverse analysis of template binding sites, interactions, and active fragments The optimal docking conformations of each template were imported into Discovery Studio for interaction visualization. Statistical analysis was performed on the nucleotides involved in enrofloxacin binding and their interactions with different functional groups of enrofloxacin. The analysis included classical hydrogen bonds, non-classical hydrogen bonds, π-π hydrophobic interactions, mixed π / alkyl hydrophobic interactions, and halogen bonds.

[0037] In this embodiment, the representative interaction distance of classical hydrogen bonds is mainly located between 2.0 and 3.0 Å. For example, in SEQ.A52, the interaction distance between DG4 and the carboxyl group of enrofloxacin is about 2.60 Å; in Apt58, the interaction distance between DT27 and the carboxyl group is about 2.96 Å, and the interaction distance between DG75 and the carbonyl group is about 2.97 Å; in SEQ.A6, the interaction distances between DG16 and DG17 and the carboxyl group are about 2.66 Å and 2.73 Å, respectively.

[0038] The representative interaction distances of non-classical hydrogen bonds are mainly located in the range of 3.0–4.0 Å; π-π hydrophobic interactions are mainly located in the range of 4.0–6.0 Å; and mixed π / alkyl hydrophobic interactions are mainly located in the range of 4.5–5.5 Å. Because enrofloxacin contains fluorine atoms, some templates also form halogen bonds. For example, in SEQ.A52, the interaction distances between DG3 and DG4 and the F atom are approximately 3.16 Å and 3.68 Å, respectively; and in Apt58, the interaction distances between DT74 and DG75 and the F atom are approximately 2.94 Å and 3.44 Å, respectively.

[0039] Based on the above analysis, the nucleotides that directly participate in enrofloxacin binding and form a relatively favorable effect in the optimal template docking conformation are marked as active bases, and the active nucleotide fragments are defined in conjunction with their adjacent sequences. This step allows subsequent design to no longer rely solely on the complete template sequence, but rather to utilize local structural information from different templates that have already shown binding contributions. Figures 1-8 The docking conformations and local interactions of the eight templates are shown, and Table 1 summarizes the corresponding active bases.

[0040] Table 1 Template aptamer affinity, sequence, molecular docking score and active base Note: "Active bases" in the table refer to nucleotide residues (i.e., key binding sites) that directly interact with the enrofloxacin (ENR) target in molecular docking simulation. For example, DG2 in the first row indicates that the second deoxyguanine in the corresponding sequence is an active base.

[0041] Example 2: Novel sequence design based on multi-template active fragment fusion, truncation, and key base orientation optimization 1. Optimization of active fragment fusion and truncation In the overall candidate library design, templates with superior affinity, such as SEQ.A52 and Apt58, were used as the primary information sources, combined with active nucleotide fragments and dominant base information provided by other templates. Based on the active bases and active nucleotide fragments obtained in Example 1, effective local sequences from different templates were combined across templates, retaining the active fragments and their adjacent bases, and truncating non-critical regions lacking effective binding information, thereby constructing a new nucleic acid aptamer sequence framework.

[0042] Using the aforementioned active fragment fusion and aptamer truncation optimization strategy, a total of 94 initially designed enrofloxacin nucleic acid aptamers were obtained. Unlike random mutation, the sequence changes in this stage were based on the active nucleotide fragments already identified during template docking.

[0043] 2. Targeted optimization of key bases Further analysis was conducted on the bases in the eight templates that formed superior interactions with different functional groups of enrofloxacin. Based on the active base positions, interaction types, and interaction distances obtained from docking analysis, key bases were preserved, directional substitutions were performed, and necessary sequence reconstructions were carried out on the candidate frameworks formed in the first stage, so that the candidate sequences could simultaneously inherit the structure of the active fragment and the information of the dominant bases.

[0044] After completing the key base orientation optimization, the sequences underwent a repeatability check to remove identical repetitive sequences, ultimately yielding 85 candidate enrofloxacin nucleic acid aptamers, which constituted the candidate sequence library for the second round of virtual screening. The 85 candidate sequences and their subsequent AutoDock Vina molecular docking scores are shown in Table 2.

[0045] Table 2. Novel candidate enrofloxacin aptamer sequences and molecular docking scores 3. The specific multi-template fusion, truncation, and orientation optimization process for the preferred aptamer EN46 To further illustrate the aptamer design process based on template-based reverse parsing of information, the preferred aptamer EN46 obtained in the final embodiment will be used as an example.

[0046] The design of EN46 was not obtained through random mutation, but rather through targeted combination optimization based on active nucleotide fragments obtained from molecular docking analysis of multiple high-affinity template aptamers. First, SEQ.A52, SEQ11, and Apt6 were used as the primary sources of sequence information.

[0047] The AGGGGGACCCGCCA fragment (SEQ ID NO. 94) at the 5′ end of the EN46 sequence is derived from SEQ. A52; the GGGGG fragment is derived from SEQ. 11; the CAGGGGGC fragment is derived from SEQ. A52; and the subsequent GTCTAGCAAACGAGACTCAGGCTAGGATAGGTCGGCAGCTGTATCTTGTCTCC fragment (SEQ ID NO. 95) is derived from Apt6. These binding-contributing active fragments were fused to obtain the initial design sequence: 5'-AGGGGGACCCGCCAGGGGGCAGGGGGCGTCTAGCAAACGAGACTCAGGCTAGGATAGGTCGGCAGCTGTATCTTGTCTCC-3' (SEQ ID NO. 96).

[0048] Based on the initial fusion sequence, regions that do not contain effective active nucleotide fragments were truncated and optimized according to the template molecule docking results. Among them, the GGTCGGCAGCTGTATCTTGTCTCC region (SEQ ID NO.97) does not contain key binding contributing fragments, and therefore was optimized as a non-critical region to reduce sequence length and improve structural efficiency.

[0049] Further optimization of key base positions was performed based on the interaction information between the template aptamer and enrofloxacin. The optimization criteria included: A(1), G(2), G(3), G(4), G(5), C(13), A(15), G(16), G(17), G(18), T(27), A(28), A(51), A(56), T(74), T(75).

[0050] Among them, GGG at positions 2, 3, and 4 and GCC at positions 11, 12, and 13 are derived from the active nucleotide fragment in SEQ.A52; GGGG at positions 15, 16, 17, and 18 are derived from the active nucleotide fragment in SEQ.11; and AG at positions 51 and 52 and TA at positions 55 and 56 are derived from the active nucleotide fragment in Apt6.

[0051] Through a three-level design strategy of "multi-template active fragment fusion - non-critical region truncation optimization - critical base orientation optimization", the optimal enrofloxacin nucleic acid aptamer EN46: 5'-AGGGGGACCCGCCAAGGGGCAGGGGGTATCTAGCAAACGAGACTCAGGCTAGGATA-3' (SEQ ID NO.9) was finally obtained.

[0052] This design process demonstrates that the present invention utilizes effective structural information from known aptamers to guide the generation of new sequences, achieving rational design driven by template information.

[0053] Example 3: Second-round molecular docking and virtual pre-screening of candidate aptamers The 85 candidate aptamers obtained in Example 2 were reconstructed in three dimensions, and molecular docking was performed with enrofloxacin using AutoDock Vina. The molecular docking score (Affinity, kcal / mol) of the optimal conformation was used as a virtual screening index. Under the same scoring system, a more negative Affinity value indicates a more favorable predicted binding.

[0054] The results showed that several candidate aptamers with molecular docking scores superior to the optimal template SEQ.A52 (-8.172 kcal / mol) emerged in the newly designed sequences. For example, EN46 scored -9.375 kcal / mol, EN56 -9.282 kcal / mol, EN63 -8.812 kcal / mol, EN50 -8.768 kcal / mol, EN52 -8.719 kcal / mol, EN47 -8.625 kcal / mol, and EN36 -8.58 kcal / mol. These results demonstrate that, by designing directional sequences based on the active fragment of the template and the dominant base, new sequences with predicted binding advantages can be obtained at the virtual screening level.

[0055] Figures 9-18 The binding conformation and local interactions between representative novel design sequences and enrofloxacin are shown. Based on the second round of molecular docking scoring, the top 10 sequences from 85 candidate sequences were selected for synthesis and experimental affinity determination, thus narrowing down the large candidate library to at least a small number of wet experimental validation targets.

[0056] Example 4: Determination of Kd values ​​of candidate aptamers and enrofloxacin using GO fluorescence quenching method 1. Affinity Measurement Method The affinity of candidate aptamers obtained from virtual screening was verified experimentally using the GO fluorescence quenching method. The candidate aptamers were labeled with fluorescent groups, and the aptamer-enrofloxacin binding was determined by quenching the fluorescence of the free aptamers with graphene oxide and by changes in the fluorescence response induced by enrofloxacin binding.

[0057] Aptamer concentration gradients of 10, 20, 30, 40, 50, 60, 70, and 80 nM were used for affinity determination. Preliminary experiments were conducted using GO concentration to determine suitable fluorescence quenching conditions. After determining the conditions, the aptamer solution was mixed with the GO solution, and then enrofloxacin solution was added to bring the final GO concentration to 10 μg / mL and the final enrofloxacin concentration to 200 μM. An ultrapure water control was included. The excitation wavelength for fluorescence detection was 492 nm, and the emission wavelength was 518 nm.

[0058] The fluorescence response data corresponding to different aptamer concentrations were nonlinearly fitted, and the dissociation constant Kd was calculated according to the following formula: Y = Bmax × X / (Kd + X) Where Y represents the fluorescence response, Bmax represents the maximum binding response, and X represents the aptamer concentration. A smaller Kd indicates a higher experimental binding affinity between the aptamer and enrofloxacin.

[0059] 2. Experimental Affinity Results Figures 19-21 The nonlinear fitting results for Kd of 10 newly designed candidate aptamers are presented. Based on the combined measurement results, in the experimental data finally adopted in this invention, the Kd of EN46 is 6.42 ± 3.07 nM. The literature report for template SEQ.A52 states a Kd of 11.07 nM; according to the experimental method used in that literature, its Kd was also obtained by GO fluorescence quenching affinity determination, which is the same type of method used in this embodiment. Therefore, the Kd values ​​of the two can be compared at the methodological level. The Kd value of EN46 is lower than that of SEQ.A52, indicating that it has a higher experimental binding affinity.

[0060] Meanwhile, EN46's affinity score in the second round of molecular docking was -9.375 kcal / mol, which is more favorable than SEQ.A52's -8.172 kcal / mol. Therefore, from the perspective of virtual prediction of static molecular docking and the Kd value obtained by the same type of GO fluorescence quenching method, EN46 shows an advantage over the original template, indicating that the directional sequence design strategy based on reverse analysis of template binding information in this invention is effective.

[0061] Based on the above results, EN46 was identified as the representative preferred enrofloxacin nucleic acid aptamer of the present invention, and its nucleotide sequence is: 5′-AGGGGGACCCGCCAAGGGGCAGGGGGTATCTAGCAAACGAGACTCAGGCTAGGATA-3′ (SEQ ID NO. 9).

[0062] Example 5: Molecular dynamics simulation and mechanism verification of the EN46-enrofloxacin complex To further verify the dynamic stability of the optimized aptamer EN46 after binding with enrofloxacin, the optimal molecular docking conformation of EN46 and enrofloxacin was used as the initial complex structure. A 100 ns molecular dynamics simulation was performed, and the simulated trajectory was analyzed for RMSD, SASA, RMSF, Rg, number of hydrogen bonds, and MM / PBSA binding free energy. The results are as follows: Figures 22-23 As shown.

[0063] (1) RMSD analysis: During the 100 ns molecular dynamics simulation, the EN46-enrofloxacin complex underwent a certain degree of conformational adjustment in the initial stage, and then entered a relatively stable fluctuation stage. The RMSD did not show a continuous upward trend throughout the simulation, indicating that the complex system did not undergo significant structural drift, and that EN46 and enrofloxacin can maintain good overall stability after binding.

[0064] (2) SASA analysis: During the simulation, the solvent-accessible surface area of ​​the system remained within a relatively stable range without any obvious abrupt change, indicating that the EN46-enrofloxacin complex did not undergo large-scale structural expansion and the system had good compactness in the bound state.

[0065] (3) RMSF analysis: Different nucleotide regions of EN46 showed differentiated flexibility characteristics. Some regions had high conformational fluctuations, while the key regions involved in enrofloxacin binding maintained low fluctuations, indicating that EN46 can maintain stable binding through local flexibility regulation.

[0066] (4) Rg analysis: The radius of gyration of the EN46-enrofloxacin composite system remained relatively stable during the 100 ns simulation, indicating that the overall spatial conformation of the aptamer did not undergo significant expansion or collapse, and the composite structure has good compactness.

[0067] (5) Hydrogen bond analysis: During the simulation, dynamic hydrogen bonds continuously formed between EN46 and enrofloxacin. The number of hydrogen bonds changed over time but did not completely disappear, indicating that hydrogen bond interactions participated in maintaining the stability of the composite system. (6) MM / PBSA analysis: The total binding free energy of the EN46-enrofloxacin composite system was approximately -29.71 kcal / mol, indicating that the binding process of the two has a thermodynamically stable trend. Among them, van der Waals interaction was approximately -39.5 kcal / mol, which was the main beneficial contribution, indicating that hydrophobic interaction and close intermolecular contact played an important role in the binding process; electrostatic interaction and polar solvation interaction were somewhat offset, but did not affect the overall stable binding.

[0068] The aforementioned molecular dynamics results further validated the stable binding of EN46 to enrofloxacin from the perspectives of dynamic conformation and energy contribution. These results corroborated the molecular docking and experimental Kd results, forming a complete screening chain of "template analysis—new sequence-oriented design—secondary virtual screening—experimental affinity verification—molecular dynamics mechanism verification".

[0069] In summary, this invention utilizes molecular docking and reverse interaction analysis of known high-affinity template aptamers to directly apply the key bases, active nucleotide fragments, and dominant interactions obtained from docking to the design of new sequences. Taking EN46 as an example, the active fragments of SEQ.A52, SEQ.10, and Apt6 are fused together. Candidate sequences are obtained through non-critical region truncation, dominant base orientation optimization, and sequence reconstruction. EN46 is then confirmed through a second round of molecular docking and experimental Kd-level screening, and its binding stability is verified using molecular dynamics simulations. This method forms a complete technical chain of "template analysis—multi-template directional design—batch virtual screening—experimental affinity verification—dynamic mechanism verification," providing a feasible implementation scheme for the batch and rational design of enrofloxacin nucleic acid aptamers.

[0070] Example 6: Validation of Dual-Mode Detection Functionality of EN46 Aptamer Based on Ce / Cu-BDC Functional Materials To verify the actual recognition ability and application performance of the enrofloxacin nucleic acid aptamer EN46 obtained by screening in this invention, EN46 was compositely assembled with Ce / Cu-BDC functional materials to construct a colorimetric-fluorescence dual-mode detection system based on aptamer recognition. Its detection performance was evaluated through enrofloxacin response experiments and structural analog interference experiments.

[0071] 1. Construction of Ce / Cu-BDC functional material composite system with EN46 aptamer In this embodiment, Ce / Cu-BDC metal-organic framework material was selected as the functional material. The Ce / Cu-BDC metal-organic framework material was dispersed in a pure water system to prepare a homogeneous and stable Ce / Cu-BDC dispersion. During the construction of the composite system, Ce / Cu-BDC was added to the detection system to achieve a final concentration of 100 μg / mL. Subsequently, the nucleic acid aptamer EN46 obtained in this invention was added to achieve a final concentration of 100 nM. The mixture was incubated at 25 °C for 20 min to allow EN46 to fully adsorb onto the surface of the Ce / Cu-BDC material, forming a Ce / Cu-BDC-EN46 composite system. Because the Ce / Cu-BDC material surface has the ability to interact with single-stranded nucleic acids, EN46 can be loaded onto the material surface. When enrofloxacin was added to the system, EN46 bound to the target molecule through its specific binding structure, causing a change in the spatial conformation of the aptamer and further affecting the interaction between EN46 and Ce / Cu-BDC, thereby realizing the conversion of the target molecule recognition event into a detection signal.

[0072] 2. Colorimetric verification of Ce / Cu-BDC catalytic performance An enrofloxacin-responsive colorimetric detection system was established utilizing the peroxidase-like catalytic activity of Ce / Cu-BDC materials. A 96-well plate was used as the detection platform, and a reaction system with a total volume of 200 μL was constructed as follows: Ce / Cu-BDC material (final concentration 100 μg / mL), EN46 aptamer (final concentration 100 nM), 3,3',5,5'-tetramethylbenzidine (TMB) (final concentration 0.4 mM), and hydrogen peroxide (H2O2) (final concentration 4 mM) were added to the system. Then, enrofloxacin standard solution (final concentration 100 nM) was added, and the reaction was carried out at 25 ℃ for 20 min. After the reaction, the absorbance change was detected using a microplate reader at 652 nm. By recording the color changes and absorbance changes at 652 nm under different conditions, the effect of EN46 recognition of enrofloxacin on the Ce / Cu-BDC catalytic colorimetric system was evaluated.

[0073] like Figure 24 As shown in Figure A, the results show that after the addition of enrofloxacin, the Ce / Cu-BDC-EN46 system produced a significant colorimetric response, and the system absorbance signal changed. This indicates that enrofloxacin can regulate the catalytic signal output of Ce / Cu-BDC by specifically binding to EN46, thereby achieving a visual colorimetric response of the target molecule.

[0074] 3. Validation of fluorescence quenching-recovery detection based on the FAM-EN46 / Ce / Cu-BDC system To further verify the specific recognition ability of EN46 for enrofloxacin, a fluorescence recovery detection system based on FAM fluorescent labeling of EN46 was constructed.

[0075] First, a FAM fluorophore was attached to the 3' end of the EN46 aptamer to obtain the FAM-EN46 aptamer. Then, FAM-EN46 was added to a Ce / Cu-BDC material dispersion system to construct the FAM-EN46 / Ce / Cu-BDC composite system. The final concentration of FAM-EN46 was 100 nM, the final concentration of Ce / Cu-BDC was 200 μg / mL, and the total reaction volume was 3 mL. The system was incubated at 25 °C for 20 min to allow FAM-EN46 to fully adsorb onto the Ce / Cu-BDC material surface. Because the Ce / Cu-BDC material can quench the adjacent FAM fluorophore, the FAM-EN46 / Ce / Cu-BDC system exhibited a low fluorescence signal. Enrofloxacin was then added to a final concentration of 100 nM, and the reaction was carried out under the same conditions. Due to the specific binding between EN46 and enrofloxacin, the binding induced a conformational change in EN46, causing some FAM-EN46 to be released from the Ce / Cu-BDC surface. This increased the distance between the FAM phosphor and the material, thereby reducing the quenching effect and achieving fluorescence signal recovery. Detection was performed using a fluorescence spectrophotometer with an excitation wavelength of 492 nm and an emission wavelength of 520 nm. The response of EN46 to enrofloxacin was evaluated by comparing the changes in fluorescence intensity before and after the addition of enrofloxacin.

[0076] like Figure 24 As shown in Figure C, without the addition of enrofloxacin, FAM-EN46 adsorbs onto the Ce / Cu-BDC surface, and the fluorescence signal is significantly suppressed. After the addition of enrofloxacin, due to the specific binding of EN46 to enrofloxacin, FAM-EN46 is released from the Ce / Cu-BDC surface, and the fluorescence intensity of the system is significantly enhanced. This indicates that the system can achieve a functional response to enrofloxacin through the mechanism of "material adsorption quenching - target-induced binding - aptamer release - fluorescence recovery".

[0077] 4. Verification of EN46 aptamer specificity To evaluate the selectivity of the EN46 aptamer for enrofloxacin, specificity verification experiments were further conducted. Structurally similar fluoroquinolone antibacterial drugs, including ofloxacin (OFX), norfloxacin (NOR), ciprofloxacin (CIP), and a mixed standard, were selected as interfering agents and compared with enrofloxacin (ENR) under the same experimental conditions. The concentration of each target agent was set to 100 nM. The above target agents were added to the Ce / Cu-BDC-EN46 colorimetric system and the FAM-EN46 / Ce / Cu-BDC fluorescence system, respectively, and the changes in absorbance at 650 nm and the changes in fluorescence recovery intensity at 520 nm were detected.

[0078] like Figure 24 As shown in Figures B and D, compared with structurally similar drugs, enrofloxacin can induce more significant colorimetric signal changes and fluorescence recovery responses, while ofloxacin, norfloxacin, and ciprofloxacin only produce weaker responses, indicating that the EN46 aptamer obtained in this invention has good recognition specificity for enrofloxacin.

[0079] In summary, this embodiment utilizes Ce / Cu-BDC functional materials to construct a dual-mode functional verification system based on the EN46 aptamer. The colorimetric system utilizes Ce / Cu-BDC to catalyze the TMB / H2O2 colorimetric reaction, achieving signal conversion for the enrofloxacin binding event. The fluorescence system utilizes the fluorescence quenching effect between FAM-EN46 and Ce / Cu-BDC, as well as the enrofloxacin-induced aptamer release mechanism, to achieve a fluorescence recovery response. Simultaneously, the selectivity of EN46 for enrofloxacin was verified through structural analog interference experiments. These results demonstrate that the EN46 aptamer obtained through molecular docking-assisted design in this invention not only possesses stable binding ability but can also serve as an effective recognition element to bind with functional materials, enabling the functionalization verification of target molecules. This further proves the effectiveness and application value of the aptamer-oriented design and screening method of this invention, demonstrating high selectivity for enrofloxacin.

[0080] Therefore, Example 6 demonstrates that EN46 obtained by the method of the present invention not only has good binding ability and structural stability, but can also be used as an effective identification element in functionalized detection systems, providing an application basis for rapid detection of enrofloxacin, and is of great significance for the detection of enrofloxacin residues in animal-derived foods and related samples.

[0081] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An enrofloxacin nucleic acid aptamer, characterized in that, The nucleotide sequence of the enrofloxacin aptamer is shown in SEQ ID NO.

9.

2. The application of the enrofloxacin nucleic acid aptamer as described in claim 1 in the preparation of enrofloxacin detection products.

3. The application as described in claim 2, characterized in that, The detection products include colorimetric detection kits or fluorescence detection kits.

4. An enrofloxacin detection system, characterized in that, It includes the enrofloxacin nucleic acid aptamer as described in claim 1 and the metal-organic framework material.

5. The enrofloxacin detection system as described in claim 4, characterized in that, The detection system is a colorimetric-fluorescence dual-mode detection system. In the colorimetric mode, the colorimetric mode utilizes the metal-organic framework material to catalyze the colorimetric system. In the fluorescence mode, FAM-labeled enrofloxacin aptamers are used. Based on the fluorescence quenching of the adjacent FAM label by the metal-organic framework material, enrofloxacin induces a conformational change in the enrofloxacin aptamer, thereby releasing the FAM-labeled enrofloxacin aptamer and restoring the fluorescence signal.

6. A method for designing and screening enrofloxacin nucleic acid aptamers as described in claim 1, characterized in that, Includes the following steps: Multiple known enrofloxacin nucleic acid aptamers and their affinity data were obtained, and aptamers with affinity meeting preset conditions were selected as templates. The template was constructed with a tertiary structure and molecularly docked with enrofloxacin. The tertiary structure with the highest molecular docking score was obtained, which is the optimal binding conformation. Interaction analysis was performed on the optimal binding conformation, the nucleotides that directly participate in enrofloxacin binding were labeled as active bases, and active nucleotide fragments were defined based on the active bases and their adjacent sequences. Based on the active nucleotide fragments, the active regions of multiple templates are combined across templates, and non-critical regions are truncated to construct an initial candidate sequence library; The sequences in the initial candidate sequence library are subjected to key base orientation optimization and repeatability screening to obtain a candidate sequence library; The sequences in the candidate sequence library were reconstructed using a tertiary structure and molecularly docked with enrofloxacin again. Virtual screening was performed using molecular docking scores as an indicator to obtain virtual-screened candidate sequences. The candidate sequences after virtual screening were subjected to experimental affinity verification, and the sequence with the highest affinity was selected as the target enrofloxacin nucleic acid aptamer.

7. The method as described in claim 6, characterized in that, The aptamer whose affinity meets the preset condition is an aptamer with a dissociation constant Kd < 100 nM.

8. The method as described in claim 6, characterized in that, The template includes a main template and a sub-template, the main template being SEQ.A52 and Apt58, and the sub-templates being SEQ.A5, Apt6, SEQ11, SEQ.A6, SEQ10, and SEQ13; The nucleotide sequences of SEQ.A52 and Apt58 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the nucleotide sequences of SEQ.A5, Apt6, SEQ11, SEQ.A6, SEQ10 and SEQ13 are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

9. The method as described in claim 6, characterized in that, The interaction analysis includes the number of hydrogen bonds, π-π hydrophobic interactions, π-alkyl hydrophobic interactions, and the interaction distance and type of halogen bonds.

10. The method as described in claim 6, characterized in that, The key base orientation optimization is as follows: based on the position, interaction type and interaction distance of the active base, the sequence in the initial candidate sequence library is subjected to key base retention, directional replacement and sequence reconstruction. The affinity verification in the experiment was performed using the graphene oxide fluorescence quenching method, and the dissociation constant Kd was calculated by nonlinear fitting.

Images