Application of CDSS1 gene in regulating abiotic stress in rice

Abstract

The application of the CDSS1 gene in regulating non-biological stress of rice belongs to the field of biotechnology, the nucleotide sequence of the gene is shown as SEQ ID NO. 1, the full-length coding sequence is 1728 bp; the function test proves that the CDSS1 gene has a negative regulation effect on the low-temperature, drought and waterlogging stress resistance of rice; after the CDSS1 gene is knocked out by using the CRISPR / Cas9 technology, the survival rate of rice seedlings after low-temperature, 20% PEG6000 simulated drought and waterlogging stress treatment is significantly improved; and overexpression of the gene can reduce the adversity tolerance of rice; the application can be applied to molecular cultivation of cold-tolerant, drought-tolerant and waterlogging-tolerant rice new varieties.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the CDSS1 gene in regulating abiotic stresses (such as low temperature, drought and flooding) in rice. Background Technology

[0002] Rice is widely cultivated in both northern and southern rice-growing regions of my country. Low temperature, drought, and flooding are three common abiotic stresses that frequently occur in rice production, often occurring sequentially within the same growing season. Cold damage causes rice seedling growth to stagnate and tillering to be delayed; drought inhibits photosynthesis and the transport of photosynthetic products, ultimately leading to a decrease in seed setting rate; flooding causes root hypoxia and rot, significantly reducing seedling survival rate. Traditional stress-resistance breeding often focuses on screening materials for single stresses, making it difficult for the resulting varieties to simultaneously resist multiple stresses. Furthermore, plant stress resistance is a complex trait controlled by multiple genes, and improving stress resistance through conventional hybridization breeding is a lengthy process. The WRKY gene family has been confirmed to participate in the rice stress resistance signaling regulatory network, but most WRKY genes that have completed functional verification currently only respond to single stresses, and gene resources that can simultaneously regulate low temperature, drought, and flooding stresses remain relatively scarce. The inventors of this application isolated the WRKY family gene CDSS1 (Cold, Drought, and Submergence sensitive 1) from the rice variety Zhonghua 11. Functional experiments confirmed that this gene plays a negative regulatory role in the multiple stress resistance of rice. After editing the gene to inactivate its function, the rice plants' tolerance to low temperature, drought, and flooding was significantly improved. Currently, there are no publicly reported reports on the related functions of this gene, and this invention focuses on this application of CDSS1. Summary of the Invention

[0003] This invention provides the application of the CDSS1 gene in regulating stress resistance in rice. The CDSS1 gene sequence only needs to meet any of the following conditions:

[0004] (1) The nucleotide sequence from position 1 to 1728 shown in SEQ ID NO.1, i.e. the mRNA sequence of the CDSS1 gene;

[0005] (2) DNA sequences derived from the sequence in condition (1) based on the degeneracy of the genetic code and encoding the same protein;

[0006] (3) Recombinant DNA obtained by linking the sequence of condition (1) or (2) to the promoter.

[0007] The application described in this invention can be achieved through the following methods: using the CDSS1 gene sequence as a probe to screen cDNA or genomic libraries, or using rice RNA as a template and employing RT-PCR amplification technology, the gene and its homologous sequences can be obtained. Introducing the full-length coding sequence of the CDSS1 gene into a plant expression vector and transforming it into rice resulted in overexpression transgenic lines exhibiting decreased tolerance to low temperature, drought, and flooding stress. Using gene editing tools such as CRISPR to inactivate or downregulate the expression level of the endogenous CDSS1 gene in rice resulted in mutants with significantly improved tolerance to the above three stresses. These results demonstrate that the CDSS1 gene is a negative regulator of rice stress resistance.

[0008] Based on the above characteristics, the specific application scheme of the present invention is as follows: by knocking out, inhibiting or silencing the CDSS1 gene, the cold resistance, drought resistance and flood resistance of rice are improved; by increasing the expression level of the CDSS1 gene, the stress resistance of rice is reduced.

[0009] Beneficial effects:

[0010] This study cloned the full-length cDNA of the CDSS1 gene from the rice variety Zhonghua 11, and constructed overexpression lines (COE-1, COE-2) and CRISPR / Cas9 edited mutants (cdss1-1, cdss1-2) (see...). Figure 1 Seedlings at the three-leaf stage were subjected to three stress treatments: 4℃ low temperature, 20% PEG6000 simulated drought, and complete flooding. After the stress ended and the plants recovered, the survival rate of CDSS1 gene knockout mutants was higher than that of wild-type plants, while the survival rate of overexpression lines was lower than that of wild-type plants (see...). Figure 2 ).

[0011] This invention can enhance the multi-stress resistance of rice simply by knocking out the endogenous CDSS1 gene. Therefore, the CDSS1 gene can be directly used as a gene editing target for molecular breeding of multi-stress resistance in rice, and has breeding application value. Attached Figure Description

[0012] Figure 1 Identification of CDSS1 overexpression lines (A) and schematic diagram of the target, mutation sites and mutation modes of CRISPR / Cas9 gene editing of CDSS1 (B);

[0013] Figure 2 To identify the seedling resistance of wild-type (WT), CDSS1 overexpression lines (COE-1, COE-2), and CDSS1 knockout mutants (cdss1-1, cdss1-2). Detailed Implementation

[0014] The experimental methods used in this embodiment are all conventional molecular biology techniques in this field. The CDSS1 transgenic experimental material was provided by the laboratory of the College of Plant Science, Jilin University, located at No. 5333, Xi'an Road, Lvyuan District, Changchun City, Jilin Province, 130062, China. Contact person: Wu Tao.

[0015] Example 1: Construction of CDSS1 gene overexpression lines and mutants

[0016] Total RNA was extracted from three-leaf stage Zhonghua 11 rice seedlings, and cDNA was obtained by reverse transcription. The full-length coding sequence of the CDSS1 gene (1728 bp) was then amplified by PCR. This fragment was cloned into the pCUbi1390 vector driven by the ubiquitin promoter. The recombinant vector was transformed into rice callus tissue via Agrobacterium tumefaciens EHA105. After hygromycin resistance selection and plant regeneration, homozygous overexpression lines COE-1 and COE-2 were obtained. qRT-PCR results showed that the transcriptional abundance of the CDSS1 gene in these two lines was significantly higher than that in wild-type plants (e.g., […]). Figure 1 (As shown in A).

[0017] The CDSS1 gene editing target was selected within the coding region of the gene. Using the Oryza sativav7.0 rice genome database from the National Rice Data Center as a reference, two sgRNA target sequences were designed using the CRISPR-P 2.0 online tool: AGGAGAAGACGGCTCCAATGAGG and GTTCCTCTCCCTCGGCGCAACGG. The target primers were annealed to form double-stranded fragments, which were then ligated into the linearized pCRISPR-zero vector. The ligation product was transformed into competent E. coli cells, and 2-3 single clones were selected on resistance selection plates and sent to Kumei Biotechnology Co., Ltd. for sequencing verification. The correctly sequenced editing vector was transformed into Agrobacterium EHA105 to infect rice callus tissue. Regenerated plants were obtained through differentiation and rooting culture.

[0018] Leaves from regenerated plants were collected, and genomic DNA was extracted using the CTAB method. Primers Primer1 (5'-ATGTCATCCAAGAAGAAGAG-3') and Primer2 (5'-CTACTCATGGGGTGGAAGTG-3') were used to amplify the gene fragment containing the editing target, and the sequence was then sequenced. The sequencing results were compared with the wild-type sequence. Two homozygous mutant materials were ultimately obtained: cdss1-1 had a single T base inserted at position 606; cdss1-2 had two AT bases deleted at position 226. Both mutations caused frameshifts, leading to premature termination of protein translation (e.g., ...). Figure 1 (As shown in B).

[0019] Example 2: Identification of stress resistance in seedlings at the three-leaf stage

[0020] Rice seeds were disinfected with a 2.5% sodium hypochlorite solution for 40 minutes and rinsed five times with distilled water. After soaking and germination at 37℃ for 3 days, the seeds were transferred to hydroponic plates and cultured using Kimura nutrient solution. Culture conditions were set as follows: daytime temperature 28℃, nighttime temperature 25℃, 12h light / 12h dark, and 80% relative humidity. Seedlings at the three-leaf stage were obtained after approximately 14 days of continuous culture and used for stress treatment.

[0021] Stress treatment settings: ① Low temperature stress: 4℃ treatment, overexpression for 3 days, mutant for 5 days; ② Simulated drought stress: cultured in Kimura nutrient solution with 20% PEG6000 added, overexpression for 3 days, mutant for 5 days; ③ Flooding stress: seedlings were completely submerged in water, overexpression for 3 days, mutant for 5 days. After the stress treatment, all materials were restored to normal culture for 7 days, and the survival rate of plants in each group was counted.

[0022] After recovery, the survival rates of the cdss1-1 and cdss1-2 knockout mutants were significantly higher than those of the wild type, with leaves remaining fully expanded and continuing to grow. Wild-type plants showed better stress resistance than the overexpression lines COE-1 and COE-2, while COE-1 and COE-2 exhibited severe yellowing and had the lowest survival rates. The experimental results under the three stress conditions showed a completely consistent trend (Figure 2). These results confirm that downregulating CDSS1 gene expression can improve the overall tolerance of rice to low temperature, drought, and flooding, and that the CDSS1 gene is a negative regulator of multiple stress resistance in rice.

Claims

1. The application of the CDSS1 gene in improving the stress resistance of rice, characterized by: The nucleotide sequence of the CDSS1 gene is shown in SEQ ID NO.1; the method to improve the stress resistance of rice is to knock out the CDSS1 gene using CRISPR / Cas9 gene editing technology, thereby significantly improving the survival rate of rice under low temperature, drought and flooding stress.

Images