Application of knocking out pep4 gene in reducing degradation of lactoferritin by kluyveromyces marxianus

Abstract

The application discloses application of knocking out a PEP4 gene in reducing degradation of lactoferrin by Kluyveromyces marxianus. The application provides application of inhibiting PEP4 protein expression in any one of the following (A1) and (A2): (A1) reducing degradation of lactoferrin by Kluyveromyces marxianus; (A2) reducing degradation of lactoferrin by fermentation supernatant of Kluyveromyces marxianus. Experiments prove that after the coding gene of the PEP4 protein is knocked out in the yeast cell, the degradation amount of lactoferrin can be reduced, and the amount of complete protein is significantly increased. The application has important significance for improving the secretion and expression yield of lactoferrin in Kluyveromyces marxianus.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of PEP4 gene knockout in reducing lactoferrin degradation in Kluyveromyces martensii. Background Technology

[0002] Lactoferrin (LF) is a multifunctional protein with iron-binding / transferring, antibacterial, antiviral, antifungal, anti-inflammatory, and anticancer properties, enabling it to regulate cell growth, scavenge harmful free radicals, and inhibit the formation of several toxic compounds. These functional properties are closely dependent on the structural integrity of human lactoferrin, particularly its higher-order conformation. Lactoferrin also has the ability to regulate lipid metabolism, which not only better regulates the satiety mechanism but also helps combat the tendency for adipose tissue accumulation. Therefore, lactoferrin is considered a novel antibacterial and anticancer agent. Currently, lactoferrin is added to many products, such as infant formula and nutritional supplements. Simultaneously, due to its antioxidant activity, lactoferrin is also frequently used as an important additive in cosmetics. With increasing public awareness of health, researchers are increasingly interested in studying the functional activities of lactoferrin.

[0003] Currently, the most direct method for obtaining lactoferrin is through isolation and extraction from cow's milk, but the lactoferrin content in cow's milk is low. Furthermore, the digestion and absorption of foreign proteins by the human body may have certain negative effects, such as allergic reactions. To address these issues, researchers have employed genetic engineering to construct engineered bacterial strains, which then ferment to obtain large quantities of lactoferrin. Currently, host cells used for lactoferrin production include: *E. coli*, yeast, mammalian cells, and plant cells. *E. coli*, as a prokaryotic model organism, has advantages such as low nutritional requirements, easy growth, and short growth cycle; however, it lacks well-developed organelles and a complete glycosylation modification system, thus failing to produce the bioactive target protein. Mammalian and plant cells, due to their susceptibility to contamination, strict growth environment requirements, and long growth cycles, are unsuitable as basal cells for large-scale lactoferrin production.

[0004] Yeast cells largely overcome the shortcomings of the aforementioned cells and, as the simplest eukaryotes, possess the basic conditions for production. Researchers, by optimizing key components of the expression system, discovered that as the expression level of the target protein increases, the cell secretes a large amount of protease, causing the target protein to degrade and resulting in a significant decrease in its yield. Therefore, to increase the yield of the target protein, the primary solution is to reduce the amount of degradation and increase the yield of the intact target protein. Summary of the Invention

[0005] To address the aforementioned technical problems and alleviate the degradation of lactoferrin in Kluyveromyces martensii, this invention provides a method for knocking out the PEP4 gene, thereby reducing the degradation of lactoferrin by Kluyveromyces martensii.

[0006] In a first aspect, the present invention claims protection for the use of inhibiting PEP4 protein expression in any of the following:

[0007] (A1) Reduces the degradation of lactoferrin by Kluyveromyces martensii;

[0008] (A2) Reduces the degradation of lactoferrin by fermentation supernatant of Kluyveromyces martensii.

[0009] Secondly, the present invention claims protection for the use of a substance capable of reducing the expression level of PEP4 protein in Kluyveromyces martensii in any of the following:

[0010] (A1) Reduces the degradation of lactoferrin by Kluyveromyces martensii;

[0011] (A2) Reduces the degradation of lactoferrin by fermentation supernatant of Kluyveromyces martensii.

[0012] The substance may be an shRNA or a chemically modified shRNA that targets the gene encoding the PEP4 protein, an siRNA or a chemically modified siRNA that targets the gene encoding the PEP4 protein, an expression vector or recombinant microorganism capable of expressing the shRNA or siRNA, or a gene editing tool (such as CRISPR / Cas technology, TALEN technology, etc.) that targets the gene encoding the PEP4 protein.

[0013] In one embodiment of the invention, the substance comprises (or is) a CRISPR / Cas9 editing tool that targets the gene encoding the PEP4 protein in the genome of *Kluyveromyces martensii* receptor bacteria.

[0014] Furthermore, the target sequence of the CRISPR / Cas9 editing tool is shown in SEQ ID No. 5.

[0015] More specifically, the CRISPR / Cas9 editing tool includes a recombinant vector and a homologous recombination fragment; the recombinant vector is capable of expressing the Cas9 protein and the gRNA encoding the gene targeting the PEP4 protein in the genome of *Kluyveromyces masculinus*; the homologous recombination fragment consists of an upstream homologous arm and a downstream homologous arm sequentially from the 5' end to the 3' end. Furthermore, in the recombinant vector, the coding sequence for the spacer region used to express the gRNA is CCCACAAGAAACATTCTCCA (SEQ ID No. 5). Further still, the nucleotide sequence of the upstream homologous arm is shown in SEQ ID No. 3; the nucleotide sequence of the downstream homologous arm is shown in SEQ ID No. 4.

[0016] Thirdly, the present invention claims a method for reducing the ability of Kluyveromyces martensii or its fermentation supernatant to degrade lactoferrin.

[0017] The method for reducing the ability of Kluyveromyces martensii or its fermentation supernatant to degrade lactoferrin, as claimed in this invention, may include the following steps: inhibiting the expression of the gene encoding the PEP4 protein in the Kluyveromyces martensii recipient strain, thereby reducing the ability of Kluyveromyces martensii or its fermentation supernatant to degrade lactoferrin.

[0018] In the method, the expression of the gene encoding the PEP4 protein in the Kluyveromyces martensii recipient strain can be suppressed by CRISPR / Cas9 gene editing technology.

[0019] Further, this is achieved by introducing a CRISPR / Cas9 editing tool into the *Kluyveromyces masculinus* recipient strain. In one embodiment of the invention, the target sequence of the CRISPR / Cas9 editing tool is shown in SEQ ID No. 5. Specifically, the CRISPR / Cas9 editing tool includes a recombinant vector and a homologous recombination fragment; the recombinant vector is capable of expressing the Cas9 protein and the gRNA encoding the gene targeting the PEP4 protein in the *Kluyveromyces masculinus* recipient genome; the homologous recombination fragment consists of an upstream homologous arm and a downstream homologous arm sequentially from the 5' end to the 3' end. Further still, in the recombinant vector, the coding sequence for the spacer region used to express the gRNA is CCCACAAGAAACATTCTCCA (SEQ ID No. 5). Further still, the nucleotide sequence of the upstream homologous arm is shown in SEQ ID No. 3; the nucleotide sequence of the downstream homologous arm is shown in SEQ ID No. 4.

[0020] Fourthly, the present invention claims the use of the method described in the third aspect above in increasing the yield of lactoferrin secreted by Kluyveromyces martensii;

[0021] Furthermore, the application includes the step of introducing a lactoferrin-encoding gene into the *Kluyveromyces martensii* recipient strain, causing it to be secreted and expressed in *Kluyveromyces martensii*.

[0022] Fifthly, the present invention claims a method for constructing a recombinant *Kluyveromyces martensii* strain with reduced ability to degrade lactoferrin.

[0023] The method for constructing a recombinant *Kluyveromyces martensii* strain with reduced lactoferrin degradation capacity, as claimed in this invention, may include the steps described in the third aspect above.

[0024] Sixthly, the present invention claims protection for a recombinant strain of *Kluyveromyces martensii* with reduced ability to degrade lactoferrin.

[0025] The recombinant *Kluyveromyces martensii* strain with reduced lactoferrin degradation capacity claimed in this invention was constructed using the method described in the fifth aspect above.

[0026] Seventhly, the present invention claims protection for any of the following applications:

[0027] (C1) The application of the recombinant strain of Kluyveromyces martensii described in the sixth aspect above in the preparation of compound preparations; the compound preparations contain: a1) the recombinant strain of Kluyveromyces martensii and / or its fermentation products (fermentation supernatant); and a2) lactoferrin;

[0028] (C2) The use of the recombinant *Kluyveromyces martensii* strain and lactoferrin described in the sixth aspect above in the preparation of a compound formulation; the compound formulation contains: a1) the recombinant *Kluyveromyces martensii* strain and / or its fermentation product (fermentation supernatant); and a2) lactoferrin.

[0029] Eighthly, the present invention claims protection for a compound preparation.

[0030] The compound formulation claimed in this invention contains: a1) the recombinant strain of Kluyveromyces martensii as described in the sixth aspect above and / or its fermentation product (fermentation supernatant); and a2) lactoferrin.

[0031] In the aforementioned relevant aspects, the PEP4 protein may be any of the following proteins:

[0032] (D1) A protein with the amino acid sequence of SEQ ID No. 1;

[0033] (D2) A protein derived from Kluyveromyces martensii with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1.

[0034] (D3) has 99%, 95%, 90%, 85% or 80% identity with any of the amino acid sequences defined in (D1)-(D2) and is derived from Kluyveromyces martensii and has the same function.

[0035] (D4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (D1)-(D3).

[0036] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0037] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0038] In all the aforementioned aspects, the gene encoding the PEP4 protein may be any of the following DNA molecules:

[0039] (E1) The DNA molecule shown in SEQ ID No. 2;

[0040] (E2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined by (E1) and encodes the PEP4 protein;

[0041] A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more or more, or 80% or more identity with any of the DNA sequences defined in (E3) and (E1)-(E2) and encodes the PEP4 protein.

[0042] The stringent conditions for the above-mentioned genes can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA. Hybridization can be performed in a mixed solution of EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization can be performed at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 65°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization can be performed in a solution of 6×SSC and 0.5% SDS at 65°C, followed by washing once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0043] For the genes mentioned above, nucleotide sequence identity can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastn as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of nucleotide sequences to calculate the identity value (%), then the identity value can be obtained.

[0044] In the aforementioned genes, the 95% or higher identity can be at least 96%, 97%, 98%, or 99% identity. The 90% or higher identity can be at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or higher identity can be at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 80% or higher identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0045] In all the aforementioned relevant aspects, the *Kluyveromyces martensii* recipient strain is *Kluyveromyces martensii* with the Ura3 gene deleted. Because production requirements prohibit the introduction of resistance selection markers, the Ura3 gene in the genome was knocked out.

[0046] In one embodiment of the present invention, the Kluyveromyces martensii recipient strain is obtained by knocking out the Ura3 gene in the genome of Kluyveromyces martensii CS-01; the Kluyveromyces martensii CS-01 has the accession number CGMCC No.30573 at the China General Microbiological Culture Collection Center.

[0047] Experiments have shown that knocking out the gene encoding the PEP4 protein in yeast cells leads to a decrease in lactoferrin degradation and a significant increase in the amount of intact protein. By using shake-flask fermentation strains and obtaining the supernatant, it was found that knocking out the gene encoding the PEP4 protein significantly alleviated lactoferrin degradation. This invention is of great significance for improving the secretory expression yield of lactoferrin in Kluyveromyces martensii.

[0048] Preservation Instructions

[0049] Classification and nomenclature: Kluyveromyces marxianus;

[0050] Biomaterial from ginseng: CS-01;

[0051] Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures;

[0052] The abbreviation for the depository institution is CGMCC.

[0053] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing;

[0054] Deposit date: May 9, 2024;

[0055] Registered with the China National Collection Center (CGMCC) No. 30573. Attached Figure Description

[0056] Figure 1 Microscopic examination (40x) of Kluyveromyces martensii CS-01.

[0057] Figure 2 The colony PCR results are used to verify the selected target clone strains. The arrows indicate the homozygous strains K. marxianusΔura3,ΔPEP4.

[0058] Figure 3 This is an SDS-PAGE image for the quantitative analysis of lactoferrin. In the image, 1 represents lactoferrin standard; 2 represents lactoferrin added to the supernatant of K. marxianus Δura3 fermentation broth; 3 represents lactoferrin added to the supernatant of K. marxianus Δura3 and ΔPEP4 fermentation broth; and 4 represents lactoferrin added to YG liquid medium. The arrows indicate lactoferrin. Detailed Implementation

[0059] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0060] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0061] The quantitative data involved in the following examples are all obtained from at least three repeated experiments.

[0062] The amino acid sequence of the PEP4 protein involved in the following examples is shown in SEQ ID No. 1, and the nucleotide sequence of its corresponding encoding gene is shown in SEQ ID No. 2.

[0063] Example 1: Isolation and identification of Kluyveromyces marxianus CS-01

[0064] I. Strains Isolation

[0065] The CS-01 strain was isolated from yak yogurt samples from Madoi County, Qinghai Province in August 2022.

[0066] Take 1g of yogurt sample, dilute it with 50ml of sterile water, then dilute it 10-10000 times with sterile water. Take 100μl of the diluted solution and spread it on a yeast solid culture medium YNB (amino-free yeast nitrogen source) plate. Incubate at 30℃ for 3-4 days, and pick single clones.

[0067] II. Strain Identification

[0068] The 18S rDNA method was used for strain identification. Using the genome of strain CS-01 as a template, PCR amplification and sequencing were performed using the universal 18S rDNA primers ITS1 (TCCGTAGGTGAACCTGCG) and ITS4 (TCCTCCGCTTATTTATGG). The obtained 18S rDNA sequence is shown in SEQ ID No. 7. After comparison with known sequences in GenBank, it was found that the 18S rDNA sequence of CS-01 had a 99.71% sequence similarity with Kluyveromyces marxianus strain XJ-50 and Kluyveromyces marxianus isolate ilia21. Therefore, strain CS-01 was identified as Kluyveromyces marxianus.

[0069] Cell morphological observation revealed that the colonies of strain CS-01 were round, milky white, with neat edges. Microscopic observation showed that the yeast cells were oval, approximately 4-8 μm in size, and reproduced by budding, with single, two, or multiple lines adhering together. Figure 1 It has the same cell morphology as Kluyveromyces martensii.

[0070] Based on the above identification, strain CS-01 was identified as Kluyveromyces marxianus, which was deposited at the China General Microbiological Culture Collection Center on May 9, 2024, with the registration number CGMCC No. 30573.

[0071] Example 2: Amplification of donor DNA fragments used to knock out the PEP4 gene

[0072] The gene encoding the vacuolar protease PEP4 in Kluyveromyces marxianus was selected for knockout. Using primers up-PEP4-F and up-PEP4-R (Table 1), PCR amplification was performed using the genome of Kluyveromyces marxianus Δura3 (Kluyveromyces marxianus Δura3 was obtained by knocking out the Ura3 gene (GenBank: KX453285.1) in the genome of Kluyveromyces marxianus CS-01 (CGMCC No. 30573) obtained in Example 1) using CRISPR technology as a template to obtain a fragment containing the upstream homologous arm (SEQ ID No. 3) used to knock out the PEP4 gene.

[0073] Using primers down-PEP4-F and down-PEP4-R (Table 1), PCR amplification was performed using the genome of Kluyveromyces marxianus Δura3 as a template to obtain a fragment containing the downstream homologous arm (SEQ ID No. 4) for knocking out the PEP4 gene.

[0074] Using the two amplification products obtained above as templates, PCR amplification was performed using primers up-PEP4-F and down-PEP4-R to obtain the overlap PCR product. This product is the donor DNA fragment used to knock out the PEP4 gene, which contains, from the 5' end to the 3' end, an upstream homologous arm (SEQ ID No. 3) and a downstream homologous arm (SEQ ID No. 4) for knocking out the PEP4 gene.

[0075] Table 1. Primer sequences for amplifying the target fragment

[0076] Primer name Primer sequence (5'-3') up-PEP4-F TTACTGCGTATATATTTTTTTGCT up-PEP4-R TCGATTTTACATAATAAAAGTTTTACAATAAAGTTAATATTAATTTGA down-PEP4-F AATATTAACTTTATTGTAAAACTTTATTATGTAAAATCGAAAATG down-PEP4-R ATATGAGAGTGATTACTTTCAAAC

[0077] Example 3: Construction of gene editing plasmid LHZ531-PEP4 targeting PEP4

[0078] Using the CRISPR-Cas9 gene editing method, the LHZ531 plasmid (whose full sequence is shown in SEQ ID No. 6, containing the TEF1 promoter, Cas9 gene, CYC1 terminator, Ura3 promoter and its gene, ARS1 terminator, ampicillin gene, guide RNA, and tRNA-gly) was first digested with the restriction endonuclease SapⅠ. The digestion reaction system is shown in Table 2. The reaction conditions were overnight incubation at 37°C followed by inactivation at 75°C for 15 minutes. The large fragment of the vector was then recovered via gel extraction.

[0079] Table 2. Enzyme digestion reaction system

[0080] System Composition Volume (μL) LHZ531 plasmid 10 Restriction endonuclease buffer (10×) 5 Restriction endonuclease SapⅠ 1 <![CDATA[ddH2O]]> 34

[0081] The PAM sequence was selected, with its upstream 20 nt target sequence, namely CCCACAAGAAACATTCTCCA (SEQ ID No. 5), which is the target sequence for CRISPR-Cas9 knockout of the PEP4 gene. Sticky ends were added to the 5' ends of the target sequences on both the sense and antisense strands, and the sequences were synthesized using primers. The synthesized sequences are shown in Table 3.

[0082] Table 3. Synthetic Sequences

[0083] serial number Sequence (5'-3') N20-F TCACCCACAAGAAACATTCTCCA N20-R AACTGGAGAATGTTTCTTGTGGG

[0084] Two primers (N20-F / R) were unwound at 95°C for 15 minutes, then annealed at 12°C for 5 minutes and left at room temperature for 10 minutes. The annealed primers were then ligated with the SapI-digested LHZ531 vector fragment using T4 ligase. The ligation product was then transformed into *E. coli* DH5α competent cells via heat shock transformation. The transformed cells were plated on LB+ ampicillin plates and incubated overnight at 37°C.

[0085] Identification of LHZ531 E. coli transformants containing the PEP4 gene target sequence: Ten transformants were picked and inoculated onto LB + ampicillin plates and incubated overnight at 37°C. Approximately 1 / 4 match head-sized bacterial cells were picked and resuspended in 20 μL of water, incubated in a 100°C water bath for 2 minutes, and then cooled to room temperature. The cells were centrifuged at 13200 rpm for 1 minute, and 2 μL of the supernatant was used as a template. The reaction was performed using the forward primer YY161F (5'-GTCGCTTACAGTGTACTGGTTGTGG-3') and the reverse primer N20-R (5'-AACTGGAGAATGTTTCTTGTGGG-3') containing the target sequence, with KOD-plus-neo enzyme. The PCR products were detected by agarose gel electrophoresis. Transformants yielding the expected PCR band were inoculated into 3 mL of LB + ampicillin liquid medium and incubated overnight at 37°C in a shaker. The bacterial cells were collected, and plasmids were extracted. The plasmid was sequenced using primers M13F. Successfully sequenced plasmids can be used for yeast transformation.

[0086] The final gene-edited plasmid was named LHZ531-PEP4, which was obtained by replacing the small fragment between the two restriction sites Sap I of the LHZ531 plasmid with CCCACAAGAAACATTCTCCA (SEQ ID No. 5).

[0087] Example 4: Yeast chemical transformation of edited plasmid LHZ531-PEP4 and donor DNA

[0088] The transformation recipient was Kluyveromyces marxianus Δura3, which was obtained by knocking out the Ura3 gene (GenBank: KX453285.1) in the genome of Kluyveromyces marxianus CS-01 (CGMCC No. 30573) obtained in Example 1 using CRISPR technology. The Ura3 gene was knocked out due to production requirements prohibiting the introduction of resistance selection markers.

[0089] 1. Select fresh starting strain K. marxianusΔura3 and inoculate it into 4.5 mL of YPD liquid medium. Incubate overnight in a shaker at 30°C until OD (Organic Demand) is reached. 600 Greater than 10.

[0090] 2. Transfer 1.5 mL of bacterial culture to a 1.5 mL centrifuge tube, centrifuge at 13200 rpm for 10 seconds, and discard the supernatant. Take 3 mL of 1M LiAc and 3 mL of 10×TE (formulation: 100 mM Tris-HCl, 10 mM EDTA, adjust pH to 8.0 with HCl), add sterile water to a final volume of 30 mL, and mix well to obtain the LiAc / TE buffer. Resuspend the bacterial culture in 1 mL of LiAc / TE solution, centrifuge at 13200 rpm for 10 seconds, and discard the supernatant. Resuspend the bacterial culture again in 1 mL of LiAc / TE solution, centrifuge at 13200 rpm for 10 seconds, and discard the supernatant.

[0091] 3. Add 5 μL of Carrier DNA (Takara, catalog number 630440), 500 ng of the editing plasmid LHZ531-PEP4 prepared in Example 3, and 1 μg of the donor DNA fragment for knocking out the PEP4 gene prepared in Example 2 to a centrifuge tube. Gently pipette the mixture to mix the bacterial cells and DNA.

[0092] 4. Add 300 μL of LiAc / TE / PEG solution to the centrifuge tube (preparation method: dissolve 40g of PEG in water to the 80mL mark, sterilize at 115℃ for 20min, then add 10mL each of sterile 1M LiAc and 10×TE and mix well), and gently mix by pipetting. Add an appropriate amount of 1mol / L DTT to the centrifuge tube to make the final DTT concentration 10mM, and gently mix by pipetting.

[0093] 5. Place the centrifuge tubes in a 30°C water bath for 15 minutes, and then in a 47°C water bath for 15 minutes.

[0094] 6. Centrifuge at 13200 rpm for 10 seconds and discard the supernatant. Resuspend the bacterial cells in 150 μL of sterile water and spread them on an SD plate.

[0095] 7. After incubation at 30℃ for 2-3 days, transformants were picked and verified using primers check-PEP4-F (5'-TTATAAATCTGGAATGTAAAAATAAC-3') and check-PEP4-R (5'-TAAATTGGTGTGAAAGTATATTGA-3'). The target gene is the PEP4 gene in the genome. The band is 2000bp when the PEP4 gene is not knocked out, and 773bp after knockout.

[0096] amplification results gel image as follows Figure 2 As shown. The final positive strain obtained was K. marxianusΔura3,ΔPEP4. The PEP4 gene in the genome of strain K. marxianusΔura3 was knocked out (specifically, the segment between SEQ ID No. 3 and SEQ ID No. 4 was knocked out), while other sequences remained unchanged.

[0097] Example 5: Detection of lactoferrin degradation in Kluyveromyces marxburghii.

[0098] The positive transformants K. marxianusΔura3 and ΔPEP4 obtained in Example 4 were first cultured in YPD liquid medium (formulation: 4 g / L tryptone, 2 g / L yeast extract, 2 g / L glucose) at 30°C for 12-18 h, and then streaked onto YPD+5-FOA plates (formulation: YPD medium with added 5-fluorouracil and agar powder, final concentration of 5-fluorouracil: 1.25 g / L, final concentration of agar powder: 20 g / L) and incubated at 30°C until single colonies grew. Then, single colonies were picked and cultured in YG liquid medium (formulation: 20 g / L yeast extract, 40 g / L glucose) at 200 rpm and 30°C for 48 h. After 48 hours, centrifugation was performed, and 1 mL of the supernatant was transferred to a 1.5 mL sterile EP tube. Lactoferrin standard was added to the supernatant for reaction. The final concentration of lactoferrin in the supernatant was 0.125 μg / μL. The reaction was carried out at 30℃ for 8 hours. Lactoferrin was quantitatively analyzed using SDS-PAGE. Simultaneously, empty culture medium with the same concentration of lactoferrin and K. marxianusΔura3 strain cultured under the same conditions were set as controls.

[0099] SDS-PAGE diagram as shown Figure 3As shown in the figure, the amount of intact lactoferrin in the supernatant of K. marxianusΔura3 and ΔPEP4 was significantly higher than that in K. marxianusΔura3. Calculations showed that the degradation rate of lactoferrin by K. marxianusΔura3 was 54.3% ± 1.11%, while the degradation rate by K. marxianusΔura3 and ΔPEP4 was 50.7% ± 2.47%. The ability of yeast cells to degrade lactoferrin was significantly reduced after PEP4 gene knockout (P < 0.05).

[0100] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of inhibiting PEP4 protein expression in any of the following: (A1) Reduces the degradation of lactoferrin by Kluyveromyces martensii; (A2) Reduces the degradation of lactoferrin by fermentation supernatant of Kluyveromyces martensii.

2. The application of a substance that can reduce the expression level of PEP4 protein in Kluyveromyces martensii in any of the following: (A1) Reduces the degradation of lactoferrin by Kluyveromyces martensii; (A2) Reduces the degradation of lactoferrin by fermentation supernatant of Kluyveromyces martensii.

3. The application according to claim 2, characterized in that: The substance includes a CRISPR / Cas9 editing tool that targets the gene encoding the PEP4 protein in the genome of the Kluyveromyces martensii receptor strain. Furthermore, the target sequence of the CRISPR / Cas9 editing tool is shown in SEQ ID No.

5.

4. A method for reducing the ability of Kluyveromyces martensii or its fermentation supernatant to degrade lactoferrin, comprising the following steps: inhibiting the expression of the gene encoding PEP4 protein in the Kluyveromyces martensii recipient strain, thereby reducing the ability of Kluyveromyces martensii or its fermentation supernatant to degrade lactoferrin.

5. The method according to claim 4, characterized in that: In the method, the expression of the gene encoding the PEP4 protein in the Kluyveromyces martensii recipient strain is inhibited by CRISPR / Cas9 gene editing technology; Furthermore, this is achieved by introducing a CRISPR / Cas9 editing tool into the Kluyveromyces martensii recipient strain; the target sequence of the CRISPR / Cas9 editing tool is shown in SEQ ID No.

5.

6. The use of the method of claim 4 or 5 in increasing the yield of lactoferrin secreted by Kluyveromyces martensii; Furthermore, the application includes the step of introducing a lactoferrin-encoding gene into the *Kluyveromyces martensii* recipient strain, causing it to be secreted and expressed in *Kluyveromyces martensii*.

7. Any of the following: (B1) A method for constructing a recombinant strain of *Kluyveromyces marxoiris* with reduced ability to degrade lactoferrin, comprising the steps described in claim 4 or 5; (B2) A recombinant strain of *Kluyveromyces martensii* with reduced ability to degrade lactoferrin, characterized in that: The recombinant strain of *Kluyveromyces martensii* was constructed using the method described in (B1).

8. Any of the following applications: (C1) The use of the recombinant *Kluyveromyces martensii* strain as described in claim 7 (B2) in the preparation of a compound formulation; the compound formulation contains: a1) the recombinant *Kluyveromyces martensii* strain and / or its fermentation products; and a2) lactoferrin; (C2) The use of the recombinant Kluyveromyces martensii strain and lactoferrin as described in claim 7 (B2) in the preparation of a compound preparation; wherein the compound preparation contains: a1) the recombinant Kluyveromyces martensii strain and / or its fermentation products; and a2) lactoferrin.

9. A compound preparation comprising: a1) the recombinant strain of Kluyveromyces martensii as described in claim 7 (B2) and / or its fermentation product; and a2) lactoferrin.

10. The application or method, or recombinant *Kluyveromyces martensii* strain or compound preparation according to any one of claims 1-9, characterized in that: The PEP4 protein is any of the following proteins: (D1) A protein with the amino acid sequence of SEQ ID No. 1; (D2) A protein derived from Kluyveromyces martensii with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID No.

1. (D3) has 99%, 95%, 90%, 85% or 80% identity with any of the amino acid sequences defined in (D1)-(D2) and is derived from Kluyveromyces martensii and has the same function. (D4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (D1)-(D3); and / or The gene encoding the PEP4 protein is any of the following DNA molecules: (E1) The DNA molecule shown in SEQ ID No. 2; (E2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined by (E1) and encodes the PEP4 protein; A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more or more, or 80% or more identity with any of the DNA sequences defined in (E3) and (E1)-(E2) and encodes the PEP4 protein; and / or The recipient strain of *Kluyveromyces martensii* is *Kluyveromyces martensii* with the Ura3 gene deleted. Furthermore, the Kluyveromyces martensii recipient strain was obtained by knocking out the Ura3 gene in the genome of Kluyveromyces martensii CS-01; the Kluyveromyces martensii CS-01 has the accession number CGMCC No. 30573 at the China General Microbiological Culture Collection Center.

Images