Use of erf8 gene in delaying flowering of plants

Abstract

The application discloses application of an ERF8 gene in delaying flowering of plants, belongs to the technical field of molecular biology and plant genetic breeding, and utilizes a 12S promoter to drive expression of the ERF8 gene in plants, so that the flowering time of the plants is later than that of corresponding wild type plants and / or the number of rosette leaves of the plants is increased. The application can be applied to crop growth period regulation (extension of a vegetative growth period, improvement of biomass), avoidance of flowering adversity (improvement of stable yield), extension of the flowering period of ornamental plants (improvement of economic value) and molecular breeding (provision of new late-flowering gene resources and tools).

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and plant genetics and breeding technology. Specifically, it relates to the application of the ethylene response factor ERF8 gene in delaying plant flowering and regulating flowering time. Background Technology

[0002] Flowering time is a crucial agronomic trait in crop production, and precise control of flowering time has significant economic value in agriculture and horticulture.

[0003] (1) Extending the vegetative growth period and increasing biomass: Delaying flowering can extend the vegetative growth stage and increase the number of rosette leaves and biomass accumulation. For example, after the PeSVP gene of moso bamboo is transformed into Arabidopsis thaliana, it shows obvious late flowering and an increase in the number of rosette leaves; existing patents have clearly used delayed flowering to "continuously induce the vegetative growth of agricultural plants, thereby increasing the yield of useful parts".

[0004] (2) Avoiding adverse stress: Late flowering can help plants avoid unfavorable environments such as drought and high temperature during the flowering period, thus improving yield stability.

[0005] (3) Extended flowering period of ornamental plants: Transcription factors that regulate flowering time can be used to cultivate ornamental plants with longer flowering periods, thereby enhancing their ornamental and economic value.

[0006] (4) Breeding cycle regulation: By precisely regulating the flowering time through genetic engineering, the traditional breeding cycle can be shortened to meet the needs of different cultivation environments.

[0007] Flowering is a crucial process in plants transitioning from vegetative to reproductive growth. Flowering time is regulated by a combination of exogenous (photoperiod, temperature) and endogenous (age, hormone levels) signals. The main pathways that have been elucidated include: the photoperiodic pathway (CO / FT), the gibberellin (GA) pathway (DELLA inhibits LFY / SOC1), the ethylene pathway (EIN3 / EIL1→ERF1 inhibits FT), autonomous pathways, and vernalization pathways (FLC). Despite extensive research on flowering time regulation, many regulatory factors and mechanisms remain unresolved. Notably, recent studies have clearly indicated that utilizing tissue-specific promoters and conditional regulation to achieve precise control of flowering time is an important strategy for avoiding constitutive pleiotropic effects and optimizing yield traits.

[0008] The shortcomings of existing flowering time regulation technologies:

[0009] (1) Single regulatory means: Existing technologies mostly drive gene overexpression through constitutive promoters (such as 35S), which lacks spatiotemporal specificity and may bring non-target side effects;

[0010] (2) Single regulatory direction: Most gene patents focus on unidirectional regulation that promotes or delays flowering, and gene resources that can achieve precise and controllable late flowering regulation are still limited;

[0011] (3) Limited genetic resources: Existing flowering regulatory genes are concentrated in a few known pathways (FT, SOC1, SVP, etc.), and the discovery of new regulatory genes and mechanisms is still an urgent need;

[0012] (4) The regulation at the promoter level has not been fully developed: existing technologies focus more on coding region operations and there is little research on “specific promoter-driven expression leading to changes in flowering time”; the regulation at the promoter level is expected to provide a more refined and tissue-specific regulatory approach.

[0013] ERF8 (ETHYLENE RESPONSE FACTOR 8), at locus AT1G53170 (located on chromosome 1, a single exon), encodes a transcription factor (185 amino acids) containing a single AP2 domain. It belongs to the ERF / AP2 superfamily and the ERF subfamily B-1 and has transcriptional repressor activity.

[0014] (1) Dual function of ABA signaling and immunity: ERF8 is an ABA-induced transcriptional repressor that participates in ABA signal transduction, positively regulates plant immunity, and is a direct substrate of immune-related kinases MPK4 / MPK11.

[0015] (2) Leaf senescence regulation: ERF4 and ERF8 are both positive regulators of leaf senescence.

[0016] (3) Light-induced anthocyanin synthesis: Other studies suggest that ERF4 / ERF8 are involved in the regulation of light-induced anthocyanin synthesis.

[0017] To date, no published literature has reported that ERF8 is involved in the regulation of flowering time; the official functional annotation of the ERF8 gene only involves "ethylene-mediated signaling pathways and transcriptional regulation", which has no connection with the regulation of flowering time. Summary of the Invention

[0018] The technical problem to be solved by this invention is: how to provide a method for regulating the flowering time of plants.

[0019] The technical solution of the present invention is: a method for regulating the flowering time and / or the number of rosette leaves of plants, which utilizes the 12S promoter to drive the expression of the ERF8 gene in plants, so that the flowering time of the plants is later than that of the corresponding wild-type plants and / or increases the number of rosette leaves of the plants.

[0020] Furthermore, the ERF8 gene is the Arabidopsis thaliana ERF8 gene, and its protein consists of 185 amino acids, the amino acid sequence of which is shown in SEQ ID No. 2.

[0021] Furthermore, the nucleotide sequence of the ERF8 gene is shown in SEQ ID No. 1.

[0022] Furthermore, the nucleotide sequence of the 12S promoter is shown in SEQ ID No. 3.

[0023] Furthermore, the plant is Arabidopsis thaliana or other plants, such as rapeseed, rice, corn, wheat, tomato, or vegetables and ornamental plants.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) Significant and stable late-flowering phenotype: The number of rosette leaves in two independent 12S-ERF8 transgenic lines (#1, #2) increased steadily in independent batch experiments:

[0026] 12S-ERF8#1: The time from sowing to bolting was 34.33 ± 1.37 days (15.17 days later than Col-0 19.17 ± 2.93 days, P < 0.001), and the number of rosette leaves at bolting was 21.80 ± 1.92 (7.00 more than Col-0 14.80 ± 1.30 leaves, P < 0.001).

[0027] 12S-ERF8#2: The time from sowing to bolting was 42.50 ± 2.43 days (23.33 days later than Col-0, P<0.001), and the number of rosette leaves at bolting was 26.80 ± 1.48 (12.00 more than Col-0, P<0.001).

[0028] (2) Unexpected technical effects: This invention demonstrates through systematic comparison of six materials that ERF8 overexpression caused by T-DNA insertion in the promoter region (erf8 insertion line, expression level 12.6×) does not result in late flowering (bolting days 17.17 days vs Col-0 19.17 days, P=0.166; rosette leaves 12.80 vs Col-0). 14.80 pieces, P=0.042, slightly reduced); ERF8 overexpression driven by the 35S constitutive promoter (35S-ERF8#1, #2, expression level 35.8× / 52.6×) did not result in late flowering (no significant difference in bolting days compared with Col-0, P=0.629 / 0.924; no significant difference in rosette compared with Col-0, P=0.29 / 0.11); ERF8 overexpression driven by the 12S promoter (12S-ERF8#1, #2, expression level 142.6× / 91.9×) significantly delayed flowering (P<0.001).

[0029] Of the three ERF8 overexpression modes, only the 12S promoter drives expression to produce late flowering. If the late flowering phenotype were an inevitable result of "ERF8 overexpression," then both the erf8 line (12.6×) and the 35S-ERF8 line (35.8× / 52.6×, where the expression level of #2 is close to 60% of that of 12S-ERF8#2) should exhibit late flowering; however, this is not the case. Moreover, the expression level of 12S-ERF8#2 (91.9×) is lower than that of 12S-ERF8#1 (142.6×), yet the late flowering phenotype is stronger, further ruling out the "dose-effect" hypothesis. This association of "specific promoter (12S) → specific gene → specific phenotype" is something that those skilled in the art could not have predicted using existing technology, constituting a prominent substantial feature and an "unexpected technical effect."

[0030] (3) It is an invention of choice: This invention selects the specific mode of "12S promoter driven expression" from the many possible expression / regulation modes of the ERF8 gene and discovers its unique and beneficial late flowering effect; this selection and its effect have no inspiration in the prior art, and therefore have inventiveness.

[0031] (4) Application value: It can be applied to crop growth period regulation (extending the vegetative growth period and increasing biomass), avoiding flowering period adversity (improving yield stability), extending the flowering period of ornamental plants (enhancing economic value), and molecular breeding (providing new late-flowering gene resources and tools). Attached Figure Description

[0032] Figure 1 : Schematic diagram of T-DNA insertion site of erf8 insertion line; ERF8 (AT1G53170) gene structure: single exon (black box), ATG is located on the right; T-DNA ("erf8") insertion site is located in the promoter region / 5'UTR region upstream of ATG; LP / RP are the primer positions for genotype identification.

[0033] Figure 2 ERF8 expression level identification in four materials (RT-qPCR).

[0034] Figure 3 Statistics on the number of days of bolting.

[0035] Figure 4 Statistics on the number of rosette leaves. Detailed Implementation

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0037] Material acquisition

[0038] 1. The GreenGate cloning system (including the target vector Z005 and the entry vector pGGC, etc.; reference: Lampropoulos A et al. GreenGate – A novel, versatile, and efficient cloning system for plant transgenesis. PLoS One, 2013, 8(12): e83043) is available to the public from CASMA Mall; among them, the laboratory constructed the Z005 vector containing the seed-specific promoter 12S, which is available to the public from Xiangyang Vocational and Technical University and is used for the assembly of the 12S-ERF8 expression vector and the acquisition of 12S overexpression materials.

[0039] 2. Agrobacterium tumefaciens GV3101, reference: Clough SJ, Bent A F. Floral dip: asimplified method for Agrobacterium-mediated transformation of Arabidopsisthaliana. Plant J, 1998, 16(6): 735-743; available to the public from CASMA Mall.

[0040] 3. Colombian ecotype Arabidopsis thaliana (wild type Col-0), reference: Swarup K, et al. Natural allellic variation identifies new genes in the Arabidopsis circadian system. Plant J, 1999; available to the public from CASMA Mall.

[0041] Example 1: Construction of ERF8 expression vector and acquisition of transgenic materials

[0042] 1. Construction of the 12S-ERF8 expression vector

[0043] Step 1: Total RNA was extracted from Arabidopsis thaliana Col-0 wild type and reverse transcribed into cDNA. Using cDNA as a template, the coding region of the ERF8 gene (locus AT1G53170, CDS sequence as shown in SEQ ID No. 1, and encoded amino acid sequence as shown in SEQ ID No. 2) was amplified using ERF8-pGGC-F and ERF8-pGGC-R primer pairs. The PCR amplification products were separated by agarose gel electrophoresis, and the target DNA fragment was recovered and purified.

[0044] ERF8-pGGC-F: 5'-AGTGAAGCTT GGTCTC AGGCTTCATGCCCAACATCACCATGGGTT-3'

[0045] ERF8-pGGC-R: 5'-GCGAGAATTC GGTCTC ACTGATTCCGCCGGAGGAGCTAAGTTA-3'

[0046] The underlined sections indicate the BsaI restriction sites.

[0047] Step 2: The recovered ERF8 coding region fragment and the pGGC vector backbone were digested with BsaI restriction endonuclease, and the digestion products were purified and recovered.

[0048] Step 3: The enzyme-digested ERF8 fragment and the vector backbone obtained in Step 2 are ligated using T4 DNA ligase and purified to obtain pGGC-ERF8.

[0049] Step 4: Mix pGGC-ERF8 with the pGreenGate Z005 target vector containing the seed-specific promoter 12S (sequence shown in SEQ ID No. 3), and perform an enzyme digestion-ligation reaction in the presence of BsaI and T4 DNA ligase to obtain the recombinant expression vector 12S-ERF8 containing the "12S promoter-ERF8 coding region-terminator" expression cassette, and verify it by sequencing.

[0050] 2. Construction of 35S-ERF8 overexpression materials

[0051] Step 1: Extract total RNA from Arabidopsis thaliana Col-0 wild type and reverse transcribe it into cDNA. Using cDNA as a template, perform PCR amplification using primer pair composed of ERF8-1305-F and ERF8-1305-R, and recover the PCR amplification product.

[0052] ERF8-1305-F5`- TCTAGA ATGCCCAACATCACCATGGGTTTG-3`

[0053] ERF8-1305-R5'- GAATTC CTATTCCGCCGGAGGAGCTAAGTT-3'

[0054] The underlined areas indicate the XbaI and EcoRI restriction sites, respectively.

[0055] Step 2: The PCR amplification product from Step 1 is digested with restriction endonucleases XbaI and EcoRI, and the digested products are recovered.

[0056] Step 3: Digest the vector pCAMBIA1305 with the restriction endonucleases XbaI and EcoRI, and recover the vector backbone.

[0057] Step 4: Connect the enzyme digestion product obtained in Step 2 with the vector backbone obtained in Step 3 to obtain the recombinant expression vector 35S-ERF8.

[0058] Step 5: Based on the sequencing results, the recombinant expression vector 35S-ERF8 is structurally described as follows: The small fragment between the XbaI and EcoRI restriction sites of the binary vector pCAMBIA1305 is replaced with the double-stranded DNA molecule shown in the sequence 1 from the 5′ end of nucleotides 1-558 of the sequence listing.

[0059] 3. Construction of transgenic materials: Recombinant expression vectors 12S-ERF8 and 35S-ERF8 were introduced into *Agrobacterium tumefaciens* GV3101 to obtain recombinant *Agrobacterium*. Then, using the floral dip method (Clough and Bent, Floral dip: asimplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. *Plant Journal* 1998, 16: 735-743), the obtained recombinant *Agrobacterium* was used to infect *Arabidopsis thaliana* ecotype, and T0 generation seeds were harvested. After obtaining T0 generation seeds, seeds transformed with plasmids using the pGreenGate Z005 vector as the backbone were screened using 1 / 2 MS medium containing hygromycin; seeds transformed with plasmids using the pCAMBIA1305 vector as the backbone were screened in a greenhouse using BASTA spraying. After obtaining resistant T1 generation seedlings, 3:1 single-plant lines were identified using antibiotic or GUS staining methods. The T1 generation transgenic material, with a single insertion, was propagated for another generation to screen for homozygous lines. The T3 generation transgenic plants, with a single insertion and homozygous line, were used for subsequent experiments. They were named 12S-ERF8#1, 12S-ERF8#2 and 35S-ERF8#1, 35S-ERF8#2.

[0060] 4. Control material: erf8 insertion line obtained from the Arabidopsis Biological Resource Center (ABRC), storage number SAIL_675_F04C. The T-DNA insertion site is located in the promoter region of the ERF8 gene (upstream of ATG). Genotyping (using LP / RP primers for three-primer PCR) and RT-qPCR verification showed that its ERF8 expression level was significantly increased (i.e., it was actually an ERF8 overexpression line), which served as the control material for "ERF8 overexpression".

[0061] Example 2: Identification of T-DNA insertion sites in erf8 insert lines

[0062] Genotyping of erf8 insert lines was performed (LP + RP + T-DNA primer LB1 triple primer PCR) and sequencing of the T-DNA insertion site. Results (corresponding) Figure 1 The T-DNA insertion site is located in the promoter region (upstream of ATG) of the ERF8 gene (AT1G53170). RT-qPCR confirmed that this insertion led to a significant increase in ERF8 expression (see Example 2), indicating that this strain is indeed an ERF8 overexpression strain. This strain was used as a control material for "ERF8 overexpression" and compared with 12S-ERF8 for subsequent flowering phenotype.

[0063] erf8-LP:TTCAAGAATCTGATAAAATCATAGATTG

[0064] erf8-RP:CTTAACCGGATCTCGGATCTC

[0065] LB1: ATTTTGCCGATTTCGGAAC

[0066] Example 3: Identification of ERF8 expression levels in four materials (RT-qPCR)

[0067] 10 mg of freshly harvested Col-0, erf8, 35S-ERF8#1, 35S-ERF8#2, 12S-ERF8#1, and 12S-ERF8#2 seeds were rapidly ground into powder in liquid nitrogen. Seed RNA was extracted using the Novizan Polysaccharide-Polyphenol Plant RNA Extraction Kit. The concentration of the extracted RNA was determined using NanoDrop. 10 μg of total RNA was used for reverse transcription using the Novizan Reverse Transcription Kit to synthesize cDNA. The obtained cDNA was diluted 5-10 times with deionized water; after dilution, it could be used for qPCR quantification. The primer pairs are as follows:

[0068] ERF8-qRT-F 5`-TCGTCGTAAGATCCCGCTTG-3`

[0069] ERF8-qRT-R 5`-ACGTTTCAGACTCGCTCTGG-3`

[0070] ACTIN 8-qRT-F 5`-GCACTTTCCAGCAGATGTGGAT-3`;

[0071] ACTIN 8-qRT-R 5`-GATCCCGTCATGGAAACGATGT-3`.

[0072] The experimental procedure is as follows:

[0073] 1. Prepare the Real-time PCR reaction mixture according to the following volumes: 1.5 μL cDNA template, 10 μL 2×ChamQUniversal SYBR qPCR Master Mix solution, 1 μL each of forward and reverse primers, and add double-distilled water to a final volume of 20 μL.

[0074] 2. After mixing the reaction solution, perform Real-time PCR experiments according to the following procedure: Pre-denaturation stage: 95℃, 30 s for one cycle; Thermal cycling stage: 95℃, 10 s and 60℃, 30 s for 40 cycles; Melting curve stage: 95℃, 15 s; 60℃, 1 min; 95℃, 15 s. The instrument used is a BioRad real-time PCR instrument.

[0075] 3. The CT values ​​obtained in the experiment were converted using the 2^(-ΔΔCt) algorithm to obtain the relative expression of the gene being measured. The internal reference gene was ACTIN8.

[0076] qRT-PCR test results are as follows Figure 2 As shown: Compared with the expression level of the ERF8 gene in newly harvested seeds of wild-type Col-0, with Col set to 1, the erf8 insertion line was approximately 12.6 times, 35S-ERF8#1 was approximately 35.8 times, 35S-ERF8#1 was approximately 52.6 times, 12S-ERF8#25 was approximately 142.6 times, and 12S-ERF8#2 was approximately 91.9 times.

[0077] Example 4: Identification of flowering time patterns

[0078] Under long-day conditions (16 hours of light / 8 hours of darkness), Col-0, erf8 inserts, 35S-ERF8#1, 35S-ERF8#2, 12S-ERF8#1, and 12S-ERF8#2 were planted, with at least 8 plants for each material. The number of days from sowing to bolting and the number of rosette leaves (the number of rosette leaves at bolting) were used as indicators of flowering time, and at least 6 independent batches were replicated.

[0079] Bolting days: Col-0 wild type 19.1 ± 2.9; erf8 insert 17.2 ± 1.5; 35S-ERF8#1 19.8 ± 1.5; 35S-ERF8#2 19.3 ± 2.9; 12S-ERF8#1 34.3 ± 1.4; 12S-ERF8#2 42.5 ± 2.4 ( Figure 3 ).

[0080] Statistical analysis (t-test, compared with Col-0): The bolting time of 12S-ERF8#1 was delayed by 15.17 days compared with Col-0 (P < 0.001), and the bolting time of 12S-ERF8#2 was delayed by 23.33 days compared with Col-0 (P < 0.001), with extremely significant differences; there were no significant differences between the erf8 insert lines and 35S-ERF8 and Col (P > 0.05).

[0081] Number of rosette leaves: Col-0 wild type 14.8 ± 1.3; erf8 inserts 12.8 ± 1.3; 35S-ERF8#1 13.8 ± 1.5; 35S-ERF8#2 13.4 ± 1.1; 12S-ERF8#1 21.8 ± 1.9; 12S-ERF8#2 26.8 ± 1.5 Figure 4 ).

[0082] Statistical analysis (t-test, compared with Col-0): 12S-ERF8#1 had 7.00 more rosettes than Col-0 (P < 0.001); 12S-ERF8#2 had 12.00 more rosettes than Col-0 (P < 0.001); there was no significant difference between the erf8 insert and 35S-ERF8 and Col (P > 0.05), and the number of rosette leaves was even slightly lower.

[0083] Results from multiple batches were consistent, showing a stable late-flowering phenotype. The expression levels and phenotypic data from Example 3 show that the relative expression level of 12S-ERF8#2 (91.9-fold) was lower than that of 12S-ERF8#1 (142.6-fold), but its late-flowering phenotype (bolting delayed by 23.33 days, rosette increased by 12.00 petals) was stronger than that of 12S-ERF8#1 (delayed by 15.17 days, increased by 7.00 petals). Meanwhile, the relative expression level of 35S-ERF8#2 reached 52.6-fold (more than 4 times higher than the 12.6-fold of the erf8 line), yet it did not exhibit late flowering. This indicates that there is no monotonically positive correlation between ERF8 overexpression level and late-flowering phenotype, ruling out a dose-response effect of overexpression. In summary, only 12S promoter-driven ERF8 expression produces a significant and stable late-flowering effect, while constitutive overexpression of 35S and in situ overexpression caused by T-DNA insertion in the promoter region do not result in late flowering.

[0084] Therefore, it can be determined that the late-blooming phenotype is a unique and unexpected technical effect of the specific technique of 12S promoter-driven ERF8 expression, rather than something that ERF8 overexpression itself can predict.

Claims

1. A method for regulating the flowering time and / or the number of rosette leaves in plants, characterized in that, The 12S promoter was used to drive the expression of the ERF8 gene in plants, resulting in later flowering time and / or an increase in the number of rosette leaves compared to the corresponding wild-type plants.

2. The method according to claim 1, characterized in that, The ERF8 gene is the Arabidopsis thaliana ERF8 gene, and its protein consists of 185 amino acids, the amino acid sequence of which is shown in SEQ ID No.

2.

3. The method according to claim 2, characterized in that, The nucleotide sequence of the ERF8 gene is shown in SEQ ID No.

1.

4. The method according to claim 1, characterized in that, The nucleotide sequence of the 12S promoter is shown in SEQ ID No.

3.

5. The method according to any one of claims 1-4, characterized in that, The plant in question is Arabidopsis thaliana.

Images