A method for improving pollen low-osmotic stress tolerance of plants by ectopic expression of OsFMT1 gene and application thereof

Abstract

The application discloses a method for improving pollen low-osmotic stress tolerance of plants by ectopic expression of a gene and application thereof. OsFMT1 The application uses a gene coding feruloyl CoA monolignol transferase in rice to improve pollen low-osmotic stress tolerance of plants. OsFMT1 As a genetic target gene for manipulating polymerization of Ferulic acid (FA) in pollen wall phenolic unit, the gene is driven by a pollen-specific promoter to express in rice pollen. OsFMT1 The gene is driven by a pollen-specific promoter Lat52 to express in rice pollen, and under the premise of not affecting plant vegetative growth and pollen fertility of a transgenic line, the pollen wall thickness is increased, and the pollen low-osmotic stress tolerance is improved. OsFMT1 The gene is driven by a pollen-specific promoter Lat52 to express in rice pollen, and under the premise of not affecting plant vegetative growth and pollen fertility of a transgenic line, the pollen wall thickness is increased, and the pollen low-osmotic stress tolerance is improved.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more particularly to a method of expressing genetically modified organisms (GMOs) through ectopic expression. OsFMT1 Methods and applications of gene-based enhancement of plant pollen tolerance to low osmotic stress. Background Technology

[0002] Pollen grains, as the male gametophytes of plants, undergo a series of significant mechanical and osmotic changes during their normal development (Pacini and Dolferus, 2019). Pollination is a crucial process in the plant life cycle. A common protective mechanism against excessive dryness during pollen dispersal is the inward folding of the pollen wall and the blocking of the pollen germination pore to reduce water loss. Once the pollen lands on the stigma, it is rehydrated and returns to an swollen state. Throughout this process, the osmotic pressure within the pollen cells undergoes dramatic changes, relying on the mechanical properties of the cell wall to prevent rupture caused by a sudden increase in turgor pressure. However, when plants encounter rainfall during pollination, the pollen hydration process faces a low osmotic pressure shock, leading to pollen bursting and inactivation, thus affecting the seed setting rate. Taking rice as an example, the critical period of heading and flowering in early rice in southern China is often accompanied by heavy rainfall and high ambient humidity. The low osmotic pressure shock during pollen hydration causes pollen to burst and become inactive, resulting in pollination failure and thus affecting the seed setting rate and reducing rice yield.

[0003] The cell wall dominates the mechanical behavior of plant cells. Plant cell growth and morphogenesis depend on and are regulated by the mechanical properties of the cell wall. The mechanical properties of the cell wall can be regulated by controlling its chemical composition and the degree of covalent cross-linking. Pollen hydration is jointly regulated by the mechanical properties of the cell wall and signaling components (Miller et al., 2022). The cell wall of a pollen grain is mainly composed of a rigid, water-insoluble outer wall. Pollen grains have areas where the outer wall is thinned or missing, known as "germination pores," which serve as channels for water inflow and pollen tube germination (Wang and Dobritsa, 2018). Furthermore, polysaccharides such as cellulose and pectin that make up the inner cell wall may participate in regulating hydration dynamics. The pollen exowall has good elasticity and extensibility, enabling cell wall folding and unfolding. The sporophytic wall, composed of sporophytin, and the pollen exowall enclose reproductive cells, providing mechanical support and water retention, playing a crucial role in the evolution of terrestrial plants (Quilichini et al., 2015). A very small number of spores can achieve long-distance dispersal via air currents or animal transport, while many pollen grains possess strong long-distance dispersal capabilities. Pollen has evolved with a greater drive towards lighter weight. This adaptive need means that the construction of pollen walls must utilize highly robust polymers like sporopollenins more efficiently to enhance cell wall structural strength without significantly increasing mass. In other words, pollen, more than spores, needs to achieve an optimal balance between "lightness" and "strength," thus its structural materials must possess both lightness and excellent mechanical properties. This need may have driven the chemical adaptive evolution of sporopollenins, thereby endowing them with the necessary mechanical toughness and weight control.

[0004] The exowall and inowall of pollen cells provide the main mechanical confinement for pollen cells. Therefore, enhancing the mechanical properties of rice pollen cell walls is expected to improve pollen's tolerance to low osmotic stress, which is of great significance for stable rice yield, ecosystem stability, and its response to climate change. Currently, traditional crop breeding techniques cannot precisely target the physical and chemical characteristics of pollen cell walls for molecular design breeding. However, transgenic breeding technology, without clearly defined target genes, can directionally manipulate the chemical composition of pollen walls to enhance pollen's tolerance to low osmotic stress without affecting plant vegetative growth and pollen development. Summary of the Invention

[0005] In view of this, the present invention utilizes the gene in rice that encodes feruloyl–coenzyme A monolignol transferase (FMT). OsFMT1 As a genetic target gene for manipulating the polymerization of ferulic acid (FA), a phenolic unit in pollen walls, it is driven by a pollen-specific promoter.OsFMT1 The gene was expressed in rice pollen, which increased the pollen wall thickness and improved the pollen's tolerance to low osmotic stress without affecting the vegetative growth of the transgenic line.

[0006] This invention provides a method for improving the tolerance of plant pollen to low osmotic stress through ectopic expression. OsFMT1 The gene achieves this by increasing the thickening of the pollen cell wall and the pollen's tolerance to low osmotic stress.

[0007] Furthermore, the aforementioned OsFMT1 Ectopic gene expression is driven by pollen-specific promoters. OsFMT1 Genes are expressed in rice pollen.

[0008] Furthermore, the ectopic expression OsFMT1 The genetic approach includes the following steps: 1) The pollen-specific promoter Lat52 and OsFMT1 The gene coding region was constructed into an Agrobacterium binary transformation vector, and the Agrobacterium containing the binary transformation vector was used to infect the transformation recipient plant; the Agrobacterium-infected transformation recipient plant was a transgenic plant obtained by regeneration through callus tissue infection of the recipient plant. 2) The result obtained in step 1) Lat52:OsFMT1 Transgenic positive plants, i.e., T0 generation plants, are planted and cultured. After maturity, seeds are harvested, and seedlings are generated to obtain T1 generation plants, which are then screened. OsFMT1 Transgenic plants with high expression were planted, and seeds were harvested after maturity (T2 generation). These were then selected to obtain... OsFMT1 Highly expressed homozygous transgenic plants.

[0009] Furthermore, the base vector for the binary conversion vector in step 1) is pCambia1300.

[0010] Furthermore, the method for constructing the binary transformation carrier is as follows: Molecular cloning primers for Lat52-OsFMT1 were designed, and the target fragment was amplified using a PCR reaction system. The fragment was then ligated with the vector pC1300-GFP, which had been digested with PstI and XbaI enzymes, to obtain the ligation product. The ligation product was then transformed into E. coli DH5α to obtain transformants. The plasmid of the transformants was extracted and sequenced to confirm its correctness, thus obtaining a binary transformation vector.

[0011] Furthermore, the sequence of the forward primer F of the molecular cloning primer is: GCTTGCATGCCTGCAGCGACATACTCGACTCAGAAGGT (SEQ.ID.NO.3); the sequence of the reverse primer R is: CGGGGATCCTCTAGATATGAAGGCCTTCATCTCATCT (SEQ.ID.NO.4).

[0012] Specifically, the plant described in this invention is a monocotyledonous plant or a dicotyledonous plant.

[0013] Specifically, the plant is selected from any one of the following: rice, corn, sorghum, millet, barley, wheat, rye, oats, buckwheat, Job's tears, sugarcane, asparagus, bamboo shoots, leeks, yam, soybean, potato, pea, mung bean, adzuki bean, broad bean, cowpea, kidney bean, lentil, mandarin bean, chickpea, cassava, sweet potato, rapeseed, cotton, beet, eggplant, peanut, tea, mint, coffee, sesame, sunflower, castor bean, perilla seed, safflower, tomato, chili pepper, cucumber, bok choy, lettuce, spinach, garlic, cabbage, mustard greens, water chestnut, scallion, winter melon, zucchini, loofah, Chinese cabbage, radish, onion, watermelon, grape, carrot, cauliflower, pumpkin, tobacco, forage grass, elephant grass, foxtail grass, Sudan grass, orchid, lily, tulip, or alfalfa. The plant used in this invention experiment is rice, but because... OsFMT1 Genes are conserved in other angiosperms, so it can be expected that they will also apply to the plants mentioned above.

[0014] This invention also provides OsFMT1 Application of genes in genetic breeding to improve plant pollen cell wall thickening and / or pollen tolerance to low osmotic stress.

[0015] Inventive concept: This invention first clarifies that the phenolic unit ferulic acid (FA) can serve as a chemical target for the chemical modification of pollen walls. Pollen walls typically consist of an intima and an exowall (Ariizumi and Toriyama, 2011). The intima is composed of cellulose, hemicellulose, and pectin; the exowall is composed of sporophytin, a complex polymer containing fatty acids and phenolic compounds. Ferulic acid (FA) is one of the conserved components of the phenolic units in angiosperm sporophytin, and also one of the phenolic modification units of hemicellulose in the pollen intima. Therefore, ferulic acid (FA) can serve as a chemical target for the chemical modification of both the pollen exowall and intima.

[0016] This invention uses a gene in rice that encodes feruloyl-CoA monomeric lignin transferase. OsFMT1 It is a genetic target gene that manipulates the polymerization of ferulic acid (FA), a phenolic unit in pollen walls. Studies have reported that FA can participate in free radical coupling reactions. FMTGenes couple lignin monomers to feruloyl-CoA, an intermediate in the lignin monomer biosynthesis pathway, and incorporate them into the lignin backbone or crosslink glucuronic acid arabinoxylan with lignin. The phenolic structural units of sporophytin are also major components of lignin. Sporophytin and lignin, two polymers that form different protective barriers, share three common characteristics: (1) their phenolic structural units are derived from the phenylpropane metabolic pathway (Wallace et al., 2011; Halpin, 2019); (2) the oxidative polymerization process of sporophytin precursors involves reactive oxygen species, similar to the known oxidative polymerization process of lignin (Matveyeva et al., 2012; Jacobowitz et al., 2019; Grienenberger and Quilichini, 2021); (3) phenolic compounds are integrated in sporophytin, which is consistent with the widespread presence of lignin in vascular plants (Weng and Chapple, 2010b). These results suggest that the polymerization mechanism of phenolic sporophytes may have undergone a certain degree of convergent evolution with the polymerization mechanism of lignin monomers. Therefore, the gene for feruloyl-CoA (CoA) monomer lignin transferase... FMT It may participate in both the polymerization of phenolic units (FA) in the pollen exwall and the integration of FA in the hemicellulose of the pollen in the pollen insole.

[0017] The beneficial effects of this invention are: The inventors created a pollen-expressing gene using transgenic technology through experiments. FMT The transgenic rice plants containing the gene showed normal pollen viability and seed setting rate. Under low osmotic pressure stress, compared to the wild type, the transgenic plants exhibited a maximum increase of approximately 3.5 times in pollen viability maintenance time and a maximum increase of approximately 19.16% in pollen inner wall thickness. Therefore, expressing the gene in the pollen... OsFMT1 This gene can increase the thickness of pollen cell walls, effectively buffering the internal turgor pressure during pollen hydration and enhancing the pollen's ability to withstand low osmotic shocks, thereby stabilizing pollen viability and germination capacity. This invention utilizes pollen-specific promoters driven by transgenic technology. OsFMT1 High expression of this substance in rice pollen alters the degree of ferulic acidification and cell wall thickness, thereby enhancing the ability of rice pollen to resist hypoosmolar stress and providing a new approach for plant genetic breeding in this direction. Attached Figure Description

[0018] Figure 1 A schematic diagram illustrating the construction of the vector pCambia1300-Lat52-OsFMT1-GFP for rice genetic transformation; Figure 2OsFMT1 is expressed in the pollen of transgenic lines; the pollen-specific Lat52 promoter drives the expression of the OsFMT1-eGFP fusion protein in the pollen of transgenic plants; green fluorescence signal indicates the presence of the OsFMT1-eGFP fusion protein in the pollen; Figure 3 Expression in pollen OsFMT1 The gene does not alter pollen fertility or in vivo germination; where A represents wild-type and transgenic lines. Lat52:OsFMT1-eGFP Pollen germination in vivo experiment, aniline blue staining of pistils 6 hours after pollination; B is I2-KI staining analysis of wild-type and transgenic lines. OsFMT1 pollen fertility; Figure 4 Expression in pollen OsFMT1 The gene does not affect the vegetative growth and seed setting rate of rice; where A represents wild-type and transgenic lines. Lat52:OsFMT1-eGFP Phenotypic comparison of rice plants at the seed-filling stage; B represents wild-type and transgenic lines. OsFMT1 Comparison of spikelet phenotypes at the grain-filling stage; Figure 5 Expression in pollen OsFMT1 Genes enhance pollen's tolerance to low-osmotic shock during in vitro hydration; wild-type and transgenic lines Lat52:OsFMT1-eGFP Mature pollen grains were incubated in distilled water containing fluorescein diacetate (FDA), with the FDA dye indicating pollen viability. Figure 6 for OsFMT1 Ultrastructure of pollen cell walls in transgenic lines; where A represents transmission electron microscopy observations of wild-type and transgenic lines. OsFMT1 B shows the structure of the pollen cell wall; B compares the outer cell wall thickness of wild-type and transgenic OsFMT1 pollen cells; C compares the outer cell wall thickness of wild-type and transgenic OsFMT1 pollen cells. OsFMT1 Pollen cell inner wall thickness. Detailed Implementation

[0019] The embodiments of the present invention will be described in detail below with reference to specific examples. These examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Rather, they should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the invention. Unless otherwise specified, the instruments, reagents, and materials used in the following examples are commercially available, and the experimental methods are conventional methods in the art.

[0020] Example 1: Using the pollen-specific promoter Lat52 to drive the expression of the OsFMT1 gene in rice pollen Rice endogenous OsFMT1 Genes are only expressed in roots, stems, and leaves; in order to obtain high pollen expression... OsFMT1 Transgenic rice, driven by the pollen-specific promoter Lat52OsFMT1 Gene expression, making OsFMT1 Highly expressed in pollen, it promotes the expression of the pollen-specific promoters Lat52 and... OsFMT1 The gene coding region was constructed into the Agrobacterium binary transformation vector pCambia1300. The Agrobacterium-containing vector was then used to infect the recipient plants using the Agrobacterium infection method. Further, the recipient plants infected with Agrobacterium were used to regenerate transgenic plants through callus tissue infection.

[0021] get Lat52:OsFMT1 Transgenic positive plants, i.e., T0 generation plants, are planted and cultured. After maturity, seeds are harvested, and seedlings are generated to obtain T1 generation plants, which are then screened. OsFMT1 Transgenic plants with high expression were planted, and seeds were harvested after maturity (T2 generation). These were then selected to obtain... OsFMT1 Highly expressed homozygous transgenic plants were selected for subsequent use.

[0022] The coding region sequence of the wild-type rice OsFMT1 (Os05g0278500) gene is as follows: The sequence of the tomato wild-type Lat52 promoter is as follows: CGACATACTCGACTCAGAAGGTATTGAGGAATGATCGATTCTGGGTCATTTGTGTGGTTAATCACCCTCCAAATCAACTAAGTCATCCTGAAGGACAATATCCTATTTTTTCTCTCGTAGGTTTATCATTTAAATTACTATCGCGTGATAATTTTGTAACGTAGAAAAATAATACCATTAATCCAAACGTTATATTCATTAAAATAATTATGATACATTTAAAAATATTTCGTGACCTCTCAATTATTGCAAATTCTAAGCCATCCCAAGTTTTGAGGCTAATTTTTTTTACTATACTATTTTTACAACCACAAAAACATAAAAAATAAAAAATAAAAAAAATAAACCGAGTCAATTGCTACAATCACTTCATTATTAATTTTAATTAATATTATGTGGTTATATATGAAACTGTTAGAGAAATAATAGCTCCACCATATTTTTTTCTCAATTTATTTTCACTATAAAAAGGCTATTTCATTATAATCAAAACAAGACACACACAAAGAGAAGGAGCAATAAAATAAAAGTAAACAACAATTTGTGTGTTTAAAAAAAAAAAAAAAGTACACACACCAAAAAAAAAAATTCCAATTTAAA(SEQ.ID.NO.2) 1) Vector construction The pCambia1300-Lat52-OsFMT1-GFP vector is constructed, based on Lat52 and OsFMT1The sequence was synthesized by the company for this fusion DNA fragment. Molecular cloning primers F / R for Lat52-OsFMT1 were designed, and the target fragment was amplified using Phusion high-fidelity DNA polymerase. The PCR system and procedure are shown in Tables 1 and 2, respectively. After the reaction, DNA agarose gel electrophoresis was performed to check whether the size of the obtained PCR product band matched the target size. The Lat52-OsFMT1 fragment was recovered using an agarose gel DNA recovery kit and ligated to the vector pC1300-GFP digested with PstI and XbaI using the Gibson ligation method. The Gibson ligation system is shown in Table 3. After mixing, the mixture was incubated at 50℃ for 30 min, and then transferred to ice to terminate the reaction, yielding the ligation product. The ligation product was transformed into *E. coli* DH5α to obtain transformants. The plasmid of the transformants was extracted, and sequencing confirmed its correctness, yielding the vector, named pCambia1300-Lat52-OsFMT1-GFP. Figure 1 ).

[0023] Table 1. Phusion high-fidelity DNA polymerase PCR system

[0024] Table 2 Phusion High-Fidelity DNA Polymerase PCR Program

[0025] Table 3 Gibson Connection System

[0026] The forward primer F sequence is: GCTTGCATGCCTGCAGCGACATACTCGACTCAGAAGGT (SEQ.ID.NO.3). The reverse primer R sequence is: CGGGGATCCTCTAGATATGAAGGCCTTCATCTCATCT (SEQ.ID.NO.4).

[0027] 2) Rice genetic transformation The obtained pCambia1300-Lat52-OsFMT1-GFP binary vector was transformed into Agrobacterium tumefaciens EHA105, and then into the callus tissue of the recipient plant, Zhonghua 11, using recombinant bacteria. After culturing at 25°C in the dark for 3 days, resistant transgenic plants were screened on selective medium containing 50 mg / L hygromycin. The screened resistant callus was cultured on predifferentiation medium containing 50 mg / L hygromycin for about 10 days. The predifferentiated callus tissue was then transferred to differentiation medium and cultured under light conditions. After about one month, transgenic plants with hygromycin resistance were obtained. The transgenic plants were planted in the field as T0 generation plants. After maturity, seeds were harvested, and seedlings were generated to obtain T1 generation rice plants.

[0028] Example 2 Lat52:OsFMT1-eGFP Molecular identification of transgenic rice plants get Lat52:OsFMT1-eGFP Transgenic positive plants, i.e., T0 generation plants, were planted and cultured, and RT-qPCR technology was used to analyze the transgenic rice pollen. OsFMT1 Gene expression levels were measured, and the presence of GFP signal in transgenic rice pollen was analyzed using laser confocal microscopy, indicating the expression level of the OsFMT1-GFP fusion protein. Selected... OsFMT1 Transgenic plants with strong gene expression and OsFMT1-GFP fusion protein signal were harvested for seeds after maturity, and seedlings were obtained to produce T1 generation plants. Seeds were harvested after maturity to obtain T2 generation plants. Homozygous transgenic plants with high OsFMT1 expression were obtained through hygromycin resistance screening for subsequent analysis.

[0029] Specific methods and results: Total RNA was extracted from the spikelets of rice at the 12th stage using the TRIzol method. The total RNA, after genomic DNA removal by gDNA Eraser treatment, was used as a template. cDNA was synthesized via reverse transcription using Oligo dT primers and the PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). OsFMT1 RT-qPCR primers F / R for the gene. Analysis using RT-qPCR. OsFMT1 Gene expression levels in spikelets of each independent transgenic line were measured, and two transgenic lines with significantly elevated expression levels were selected. Lat52:OsFMT1-eGFP #1 and Lat52:OsFMT1-eGFP #16 (hereinafter referred to as) OsFMT1-1 and OsFMT1-16 Further observation and analysis of the fluorescence intensity of GFP in pollen using laser confocal microscopy revealed that the OsFMT1-GFP fusion protein was present in transgenic plants. OsFMT1-1 and OsFMT1-16 Pollen expresses ( Figure 2 ).

[0030] The upstream primer RT-F sequence is as follows: TGACTGTGACAGCAATAGCTG(SEQ.ID.NO.5); The downstream primer RT-R sequence is: GTGAATGGTATGATGTGATTAGGTG (SEQ.ID.NO.6).

[0031] Example 3: Transgenic Rice Lat52:OsFMT1-eGFP Pollen viability determination, pollen fertility and seed set rate analysis Pollen viability assay: The survival status of different pollen genotypes during hydration under low osmotic pressure conditions was detected using FDA (Fluorescein diacetate) fluorescence staining. 50 µL of FDA staining solution was added to a microscope slide. A wheat floret about to bloom was selected, and the anthers were exposed at the base of the flower using tweezers. The pollen was gently released into the water droplet, ensuring an appropriate pollen density. The slide was inverted so the water droplet was facing down and placed in a humidified culture chamber at 25°C. After standing for 1 min, 20 min, and 30 min, fluorescence signals were detected using a laser confocal microscope (LSM 710, Zeiss). The excitation wavelength was 488 nm, and the emission wavelength was 505–530 nm. The viability of different pollen genotypes under low osmotic pressure stress was determined by the FDA fluorescence signal.

[0032] Pollen fertility testing method: Add approximately 50 µL of I2-KI staining solution to a glass slide. Place a nearly flowering rice spikelet on the slide, remove the glumes and pistil, and separate the anthers. Immerse the anthers thoroughly in the staining solution, and use a dissecting needle to cut open the anthers to release the pollen. Immediately cover with a coverslip and let stand at room temperature for 3–5 minutes. Observe and photograph under a microscope. Unstained or yellowish-brown pollen indicates weak viability, colorless pollen indicates inactive pollen, and highly viable pollen appears black.

[0033] Method for calculating seed setting rate: The seed setting rate of rice panicles at maturity was calculated. The independent biological samples included 15 mature panicles.

[0034] Experimental method for pollen germination in vivo: Select rice panicles about to flower and place them in 50 mL centrifuge tubes. Add a small amount of distilled water to the bottom, cover the tubes, and maintain stable humidity. After the anthers emerge from the spikelet glumes, place the rice ovaries (1 hour after pollination) in FAA fixative for 24 hours, then transfer them to 70% ethanol solution for storage. Before observation, remove the fixed ovaries and rehydrate them with 50%, 30%, and 10% graded ethanol solutions. Then, soften the ovaries in 2 mol / L NaOH for 12 hours, wash them twice with distilled water, and stain them with 0.05% aniline blue solution for 12 hours. Finally, place the softened ovaries on a glass slide, add a drop of glycerol, cover with a coverslip, and observe and photograph them under a fluorescence microscope (DM6000 B, Leica).

[0035] The experimental results are as follows: Select homozygous transgenic lines OsFMT1-1 and OsFMT1-16 Further analysis was conducted on pollen viability and seed setting rate. The process of pollen tube elongation to the ovule and attachment to wild-type and transgenic lines was observed one hour after pollination. OsFMT1-1 and OsFMT1-16 The pollen on the stigma germinated normally and the pollen tube successfully extended into the ovule, indicating ectopic expression. OsFMT1 It did not affect pollen viability. Figure 3 A). Pollen fertility was indicated by I2-KI staining, and the results showed that the transgenic line... OsFMT1-1 and OsFMT1-16 There was no significant difference in pollen fertility compared to the wild type. Figure 3 B). Phenotypic characteristics of fully mature rice panicles show that the transgenic lines OsFMT1-1 and OsFMT1-16 Normal fruit set, with no difference in fruit set rate compared to wild type. Figure 4 ).

[0036] Example 4: Expression in pollen OsFMT1 Enhancing the tolerance of pollen to low osmotic pressure shocks during in vitro hydration Pollen hydration is a necessary prerequisite for pollen germination. During hydration, rice pollen volume increases, and its shape changes from elliptical to spherical. To better track the dynamic changes in pollen hydration and viability, this invention optimizes a method for quantitatively analyzing changes in pollen volume and viability during in vitro hydration. Fresh pollen is placed in a glass-bottomed culture dish for imaging, and images are recorded immediately after adding 50 μL of fluorescein diacetate (FDA) solution. FDA dye is a cell membrane-permeable esterase substrate that indicates cell viability. Any visibly ruptured pollen is excluded from the analysis.

[0037] The specific methods and procedures are as follows: The viability of pollen of different genotypes during hydration was detected using the FDA fluorescence staining method. First, a humidified culture chamber was prepared: approximately 100 mL of water was added to an empty 200 µL pipette tip holder, and eight pipette tips were inserted as slide supports. Fully moistened filter paper was placed between the tips to maintain a high humidity environment. Then, 50 µL of water was added to a microscope slide. A rice spikelet about to flower was selected, and the anther was exposed at the base of the flower using tweezers. The pollen was gently released into the water droplet, ensuring an appropriate pollen density. The slide was inverted so that the water droplet faced downwards and placed in the humidified culture chamber, where it was incubated at 25°C. After standing for 1 min, 20 min, and 30 min, fluorescence signals were detected using a laser confocal microscope (LSM710, Zeiss). The excitation wavelength was 488 nm, and the emission wavelength was 505–530 nm. The viability of pollen of different genotypes during hydration was determined using the FDA fluorescence signal.

[0038] The results are as follows Figure 5 As shown, when hydration lasted for 1 minute, the activity of wild-type pollen and that of the transgenic line... OsFMT1-1 and OsFMT1-16 No significant difference; when hydration lasted for 20 minutes, the percentage of viable pollen in the wild type decreased to 44%, while in the transgenic line... OsFMT1-1 and OsFMT1-16 The hydration rates were 98.3% and 96.9%, respectively; when hydration continued for 30 minutes, most of the wild-type pollen burst, with only 10.2% remaining viable, while the transgenic line... OsFMT1-1 and OsFMT1-16 Pollen viability remained at a high level, at 96% and 92.9%, respectively. These results indicate that pollen expresses... OsFMT1 It can enhance the low osmotic pressure shock resistance of rice pollen.

[0039] Example 5: Analysis of the physical structure characteristics of pollen exwall based on transmission electron microscopy. Select Lat52:OsFMT1-eGFPAnthers from transgenic positive plants and wild-type plants at the twelfth stage were punctured with a dissecting needle and placed in a fixative solution of 2.8% glutaraldehyde and Triton X-100. The solution was gently vacuum-sealed until no air bubbles settled, and incubated overnight at 4°C. The samples were then washed three times with 0.1 mol / L phosphate buffer, 15 min each time. Post-fixation was then performed by adding 1% osmium tetroxide and Triton X-100 fixative, and incubated overnight in the dark at 4°C. The samples were then washed three times with 0.1 mol / L phosphate buffer, 15 min each time. Further dehydration was performed using an ethanol gradient of 30%, 40%, 50%, 70%, 80%, 90%, 100%, 15 min each time, repeated several times, 15 min each time. The EP tubes containing the samples were then fixed on a gyroscope for resin infiltration. The acetone to Spurr embedding agent ratios and infiltration times were as follows: 3:1, 2-4 h; 1:1, overnight; 1:3, 12 h; 0:1, overnight-12 h-overnight. After complete infiltration, the resin was separated under a stereomicroscope and placed in an embedding tank containing Spurr embedding agent to secure the position. Air bubbles were then removed. The tubes were then placed in a 65°C oven for polymerization for 48 h. After complete resin polymerization, the samples were first positioned using semi-thin sections, followed by sectioning using ultrathin sections. The sectioned samples were then double-stained using 3% uranium acetate-lead citrate.

[0040] The results showed that the composition of the mature pollen cell wall structure of the transgenic line OsFMT1 was no different from that of the wild type. Figure 6 (A) However, the average pollen inner wall thickness of the transgenic lines OsFMT1-1 and OsFMT1-16 was 817.08 nm and 760.16 nm, respectively, compared to 685.71 nm for the wild type, representing increases of approximately 19.16% and 10.86% respectively. Figure 6 B); Transgenic line OsFMT1-1 and OsFMT1-16 The average pollen exwall thickness was 893.02 nm and 893.31 nm, respectively, compared to 892.34 nm for the wild type, representing increases of 0.08% and 0.11% compared to the wild type. Figure 6 C).

[0041] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for improving the tolerance of plant pollen to low osmotic stress, characterized in that, The method is through ectopic expression OsFMT1 The gene achieves this by increasing the thickening of the pollen cell wall and the pollen's tolerance to low osmotic stress.

2. The method for improving plant pollen tolerance to low osmotic stress as described in claim 1, characterized in that, The OsFMT1 Ectopic gene expression is driven by pollen-specific promoters. OsFMT1 Genes are expressed in rice pollen.

3. The method for improving plant pollen tolerance to low osmotic stress as described in claim 2, characterized in that, The ectopic expression OsFMT1 The genetic approach includes the following steps: 1) The pollen-specific promoter Lat52 and OsFMT1 The gene coding region was constructed into an Agrobacterium binary transformation vector, and the Agrobacterium containing the binary transformation vector was used to infect the transformation recipient plant; the Agrobacterium-infected transformation recipient plant was a transgenic plant obtained by regeneration through callus tissue infection of the recipient plant. 2) The result obtained in step 1) Lat52:OsFMT1 Transgenic positive plants, i.e., T0 generation plants, are planted and cultured. After maturity, seeds are harvested, and seedlings are generated to obtain T1 generation plants. Transgenic plants with high OsFMT1 expression are screened and planted. After maturity, seeds are harvested, i.e., T2 generation plants, and further selection is performed to obtain... OsFMT1 Highly expressed homozygous transgenic plants.

4. The method for improving plant pollen tolerance to low osmotic stress as described in claim 3, characterized in that, Step 1) The base vector for the binary conversion vector is pCambia1300.

5. The method for improving plant pollen tolerance to low osmotic stress as described in claim 4, wherein the binary transformation vector is constructed as follows: Molecular cloning primers for Lat52-OsFMT1 were designed, and the target fragment was amplified using a PCR reaction system. The fragment was then ligated with the vector pC1300-GFP, which had been digested with PstI and XbaI enzymes, to obtain the ligation product. The ligation product was then transformed into E. coli DH5α to obtain transformants. The plasmid of the transformants was extracted and sequenced to confirm its correctness, thus obtaining a binary transformation vector.

6. The method for improving plant pollen tolerance to low osmotic stress as described in claim 5, characterized in that, The sequence of the forward primer F of the molecular cloning primers is: GCTTGCATGCCTGCAGCGACATACTCGACTCAGAAGGT (SEQ.ID.NO.3); the sequence of the reverse primer R is: CGGGGATCCTCTAGATATGAAGGCCTTCATCTCATCT (SEQ.ID.NO.4).

7. The method for improving plant pollen tolerance to low osmotic stress as described in any one of claims 1 to 6, characterized in that, The plant is a monocotyledonous plant or a dicotyledonous plant.

8. The method for improving plant pollen tolerance to low osmotic stress as described in any one of claims 1 to 6, characterized in that, The plant is selected from any one of the following: rice, corn, sorghum, millet, barley, wheat, rye, oats, buckwheat, Job's tears, sugarcane, asparagus, bamboo shoots, leeks, yams, soybeans, potatoes, peas, mung beans, adzuki beans, broad beans, cowpeas, kidney beans, lentils, mandarins, chickpeas, cassava, sweet potatoes, rapeseed, cotton, beets, eggplant, peanuts, tea, mint, coffee, sesame, sunflower, castor beans, perilla seeds, safflower, tomatoes, peppers, cucumbers, bok choy, lettuce, spinach, garlic, cabbage, mustard greens, water chestnuts, scallions, winter melon, zucchini, loofah, Chinese cabbage, radishes, onions, watermelons, grapes, carrots, cauliflower, pumpkins, tobacco, forage grass, elephant grass, foxtail grass, Sudan grass, orchids, lilies, tulips, or alfalfa.

9. OsFMT1 Application of genes in genetic breeding to improve plant pollen cell wall thickening and / or pollen tolerance to low osmotic stress.

Images