Biological marker for identifying heart failure type pleural effusion in vitro, detection method and application thereof

Abstract

The application discloses a biomarker and a detection method and application for identifying heart failure type pleural effusion in vitro. The biomarker is composed of miR-142-5p and / or miR-155-5p. The application is application of a reagent for detecting the biomarker in preparation of a product for identifying heart failure type pleural effusion in vitro. The method is to obtain relative expression amount through specific miR-142-5p and miR-155-5p specific upstream primers. The biomarker provided by the application is used for identifying and diagnosing heart failure type pleural effusion in vitro, and has important clinical application value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a biomarker and detection method for in vitro identification of heart failure-type pleural effusion, and its application. Background Technology

[0002] Pleural effusion is a common clinical finding that can be caused by a variety of diseases. The four most common causes of pleural effusion are malignant tumors, heart failure, pneumonia, and tuberculosis. Because the treatment principles for different types of pleural effusion vary greatly, accurate etiological diagnosis is the first and most important step in the standardized management of pleural effusion.

[0003] Differentiating between heart failure-related (HF) pleural effusion and non-heart failure-related pleural effusion is crucial. HF-related pleural effusion does not require further invasive examinations and can be treated with systemic therapies (such as diuretics and anti-heart failure medications). In contrast, tuberculous pleural effusion (TPE), parapneumonic pleural effusion (PPE), and malignant pleural effusion (MPE) require invasive examinations for diagnosis. Traditional methods for diagnosing HF-related pleural effusion are relatively subjective, requiring a combination of patient history, physical examination, imaging studies (echocardiography), and laboratory tests. Among numerous diagnostic methods, detecting biomarkers in pleural effusion offers advantages such as speed, simplicity, low cost, and minimal invasiveness, and is therefore widely used in the diagnosis of HF-related pleural effusion.

[0004] Currently, the most common clinical diagnostic method for heart failure-related pleural effusion is the measurement of NT-proBNP (amino-terminal pro-B-type natriuretic peptide) and BNP (B-type natriuretic peptide). These biomarkers assess the likelihood of heart failure through changes in their concentration in blood or pleural fluid. NT-proBNP or BNP assays involve processing the sample, binding serum or pleural fluid to specific antibodies, and generating a measurable signal through a chemical reaction. The signal intensity is proportional to the concentration of the target substance, ultimately yielding the concentration value of BNP or NT-proBNP. This method requires specialized chemical detection equipment; NT-proBNP testing is relatively expensive and affected by factors such as age and renal function.

[0005] Even with all the methods described above, some patients remain difficult to diagnose. In such cases, therapeutic diagnosis is necessary, which involves first administering antidiuretic therapy and then observing the patient's response to diuretics to determine whether the pleural effusion is new-onset due to heart failure. However, this therapeutic diagnostic approach has its limitations: it can delay diagnosis and may also introduce potential harm. Therefore, it remains essential to explore new diagnostic methods for heart failure-related pleural effusion.

[0006] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of the present invention, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0007] To address the aforementioned problems in the existing technology, this invention provides a biomarker, detection method, and application for in vitro identification of pleural effusion caused by heart failure. The technical problem to be solved by this invention is achieved through the following technical solution: In a first aspect, the present invention provides a biomarker for in vitro identification of pleural effusion due to heart failure, the biomarker being composed of free miR-142-5p and / or miR-155-5p in pleural fluid.

[0008] In one embodiment of the present invention, the in vitro identified sample is a pleural effusion sample, which is taken from a subject with indications of pleural effusion.

[0009] Secondly, the present invention provides the application of a reagent for detecting the above-mentioned biomarkers in the preparation of a product for in vitro identification of pleural effusion caused by heart failure.

[0010] In one embodiment of the present invention, the product is a kit for in vitro identification of pleural effusion caused by heart failure.

[0011] In one embodiment of the present invention, the kit comprises a first detection reagent for detecting the concentration of miR-142-5p in a pleural effusion sample, and / or a second detection reagent for detecting the concentration of miR-155-5p in a pleural effusion sample.

[0012] In one embodiment of the present invention, the first detection reagent includes a specific upstream primer sequence of miR-142-5p, a first internal reference sequence, and a fluorescent probe of miR-142-5p; The second detection reagent includes a specific upstream primer sequence of miR-155-5p, a second internal reference sequence, and a fluorescent probe of miR-155-5p; The specific upstream primer sequence of miR-142-5p is numbered SEQ ID NO.1; The specific upstream primer sequence of miR-155-5p is numbered SEQ ID NO.2.

[0013] In one embodiment of the present invention, both the first internal reference sequence and the second internal reference sequence are SnRNAU6.

[0014] Thirdly, the present invention provides a method for detecting the above-mentioned biomarkers, comprising the following steps: Obtaining ex vivo samples; Total RNA was extracted from the in vitro samples; The miRNAs in the total RNA were reverse transcribed to form a cDNA mixed library; The specific upstream primer sequences for biomarkers miR-142-5p and miR-155-5p were added to the cDNA mixed library, and qPCR amplification was performed to obtain the amplification curve and Ct value; the specific upstream primer sequence for miR-142-5p is numbered SEQ ID NO.1; the specific upstream primer sequence for miR-155-5p is numbered SEQ ID NO.2; The relative expression levels of miR-142-5p and / or miR-155-5p in the sample were calculated based on the amplification curves and Ct values.

[0015] In one embodiment of the present invention, the ex vivo sample is a pleural effusion sample, which is taken from a subject with indications of pleural effusion.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention uses miR-142-5p and / or miR-155-5p as biomarkers for in vitro identification of heart failure-related pleural effusion. These biomarkers are directly derived from pleural fluid samples and can effectively assist clinicians in the etiological diagnosis of patients with pleural effusion, thus having significant application value.

[0017] 2. The detection reagents and kits provided by this invention contain specific primer sequences that can specifically identify and amplify miR-142-5p and miR-155-5p, reducing false positive results caused by non-specific amplification.

[0018] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0019] Figure 1 This is a comparison chart of the relative expression levels of miR-142-5p(A) and miR-155-5p(B) in pleural effusion samples from the HF and NHF groups provided in this embodiment of the invention. Figure 2 This invention provides a method for plotting subject operating characteristic curves based on miR-142-5p, miR-155-5p, and a combination of miR-142-5p and miR-155-5p. Detailed Implementation

[0020] To further illustrate the technical means and effects adopted by the present invention to achieve the intended purpose, the following, in conjunction with the accompanying drawings and specific embodiments, provides a detailed description of a biomarker and detection method for in vitro identification of pleural effusion caused by heart failure, and its application.

[0021] The foregoing and other technical contents, features, and effects of the present invention will be clearly presented in the following detailed description of specific embodiments in conjunction with the accompanying drawings. Through the description of the specific embodiments, a more in-depth and concrete understanding can be gained of the technical means and effects adopted by the present invention to achieve its intended purpose. However, the accompanying drawings are for reference and illustration only and are not intended to limit the technical solutions of the present invention.

[0022] It should be noted that, in this document, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, the terms "comprising," "including," or any other variations are intended to cover non-exclusive inclusion, such that an article or apparatus comprising a list of elements includes not only those elements but also other elements not expressly listed. The term "pleural effusion" refers to an ex vivo specimen or sample; in this specification, it can be understood that pleural effusion collected from a patient with pleural effusion is a pleural effusion sample.

[0023] Example 1 This invention provides a biomarker composed of at least one of miR-142-5p and miR-155-5p. In a specific embodiment of this invention, the expression levels of miR-142-5p and miR-155-5p in pleural fluid samples from patients with heart failure-related pleural effusion are significantly higher than those from patients with non-heart failure-related pleural effusion. Specifically, the relative expression level of miR-142-5p in pleural fluid samples from patients with heart failure-related pleural effusion is approximately 2 to 2.5 times higher than that from patients with non-heart failure-related pleural effusion, and the relative expression level of miR-155-5p is approximately 3 to 4 times higher than that from patients with non-heart failure-related pleural effusion (see [link to relevant documentation]). Figure 1 ).

[0024] In specific clinical applications, after collecting pleural fluid samples from patients with pleural effusion, the concentration levels of miR-142-5p and / or miR-155-5p in the pleural fluid samples are detected using the detection method provided by this invention. When the detection results show high expression characteristics, it can assist clinicians in determining whether the pleural effusion patient has heart failure-related pleural effusion.

[0025] Example 2 This embodiment provides the application of a reagent for detecting biomarkers (miR-142-5p and / or miR-155-5p) in the preparation of a product for in vitro identification of pleural effusion caused by heart failure.

[0026] In one example, the product can be a kit containing a first detection reagent for detecting the concentration of miR-142-5p in a pleural effusion sample and a second detection reagent for detecting the concentration of miR-155-5p in a pleural effusion sample.

[0027] The first detection reagent includes a specific upstream primer sequence for miR-142-5p, an internal control sequence SnRNA U6, and a fluorescent probe for miR-142-5p. The base sequence of the specific upstream primer sequence for miR-142-5p is shown in SEQ ID NO.1, specifically 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGATC-3'. The second detection reagent includes a specific upstream primer sequence for miR-155-5p, an internal control sequence SnRNA U6, and a fluorescent probe for miR-155-5p. The base sequence of the specific upstream primer sequence for miR-155-5p is shown in SEQ ID NO.2, specifically 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCTA-3'.

[0028] The aforementioned detection reagents may also include auxiliary components such as qPCR reaction buffer, dNTP mixture, Taq DNA polymerase, and ROX reference dye. When the detection reagents are provided as a kit, they also include RNA extraction reagents such as TRIzol reagent, chloroform, isopropanol, ethanol, and DEPC water for extracting total RNA from pleural fluid samples, as well as reverse transcriptase, reverse transcription buffer, universal reverse transcription primers, or specific reverse transcription primers for reverse transcription reactions.

[0029] Example 3 This embodiment further illustrates the biomarkers provided by the present invention through specific experiments.

[0030] (1) Sample acquisition and analysis This study recruited patients with undiagnosed pleural effusion who visited the Department of Respiratory and Critical Care Medicine at the Affiliated Hospital of Inner Mongolia Medical University between August 2021 and July 2024. Inclusion criteria were: (I) patients admitted with undiagnosed pleural effusion and (II) patients requiring thoracentesis to determine the etiology. The presence of pleural effusion was confirmed by medical imaging methods (e.g., X-ray, computed tomography, ultrasound). Exclusion criteria were: (i) patients with pleural effusion of a known etiology within the past 3 months; (ii) patients under 18 years of age; (iii) pregnant women; (iv) patients with insufficient pleural fluid samples; (v) patients who developed pleural effusion during treatment; and (vi) pleural effusion caused by trauma or surgery. This study was approved by the Ethics Committee of the Affiliated Hospital of Inner Mongolia Medical University. All participants signed informed consent forms. The Declaration of Helsinki was strictly followed in conducting this study.

[0031] The diagnostic criteria are as follows: Malignant pleural effusion (MPE) is diagnosed based on a positive pleural biopsy or positive pleural fluid cytology. In some patients with a high probability of MPE but negative cytology, and who are unwilling or unable to undergo pleural biopsy, the diagnosis of MPE is based on the primary tumor, after ruling out other causes of pleural effusion. Tuberculous pleural effusion (TPE) is diagnosed based on a positive pleural biopsy, positive Mycobacterium tuberculosis culture, or positive acid-fast staining. In some patients with a high probability of tuberculous pleural effusion but negative etiological evidence, and who are unwilling to undergo pleural biopsy, the diagnosis of tuberculous pleural effusion is based on a pleural fluid adenosine deaminase (ADA) activity greater than 35 U / L, good responsiveness to anti-tuberculosis treatment, and after ruling out other causes of pleural effusion. Parapneumonia pleural effusion (PPE) is diagnosed based on a clinical composite criterion, including the patient's imaging characteristics, microbial culture, physical examination, laboratory tests, medical history, and responsiveness to antibiotic treatment. The diagnostic criteria for heart failure pleural effusion (HF) include clinical manifestations, imaging features, serum NT-proBNP, and response to anti-heart failure treatment.

[0032] Based on the above criteria, a total of 126 patients were included in this study, including 23 patients with heart failure and pleural effusion, 48 patients with malignant pleural effusion, 27 patients with parapneumonic pleural effusion, 22 patients with tuberculous pleural effusion, and 6 patients with pleural effusion caused by other etiologies. Table 1 shows the baseline clinical characteristics of the subjects.

[0033] Table 1. Baseline characteristics of subjects from sample sources

[0034] The 126 patients were divided into two groups: the heart failure pleural effusion group (HF group, including 23 cases of heart failure pleural effusion) and the non-heart failure pleural effusion group (NHF group, including 103 cases). Pleural fluid samples were collected from each group. The specific sample collection and pretreatment included: 1. Sample collection: Before the patient's treatment, pleural effusion is collected in a test tube without any anticoagulant as a pleural fluid sample.

[0035] 2. Centrifugation: After collection, the pleural fluid sample was left to stand at room temperature (25°C) for 4 hours, and then centrifuged at 3000 rpm for 10 minutes.

[0036] 3. Aliquoting and storage: Carefully aspirate the supernatant (pleural fluid clarification) after centrifugation and aliquot it into pre-labeled 0.5mL or 1.5mL EP tubes (centrifuge tubes, Eppendorf tubes), and immediately transfer it to an ultra-low temperature freezer at -80°C for long-term storage.

[0037] (2) Sample testing and data analysis The statistical methods used for data processing in this embodiment of the invention are as follows: continuous variables are expressed as median and interquartile range (IQR), and categorical variables are expressed as absolute numbers and percentages. The Kolmogorov-Smirnov method is used to test the normality of continuous variables. The Mann-Whitney U test or independent samples t-test is used to compare continuous variables between two groups; the Kruskal-Wallis H test or ANOVA is used to compare continuous variables between three or more groups; and the chi-square test or Fisher's exact test is used to compare categorical data. The Spearman method is used to analyze the correlation between miR-142-5p and miR-155-5p. Receiver operating characteristic (ROC) curves are used to evaluate the diagnostic performance of miR-142-5p and miR-155-5p for HF-related pleural effusion. Logistic regression is used to integrate the expression of miR-142-5p and miR-155-5p. All statistical analyses and graphs are performed using SPSS and GraphPad Prism. A two-sided p < 0.05 is considered statistically significant.

[0038] The concentration (relative expression level) of biomarkers in the above pleural effusion samples was detected, including the following steps: S1. Obtain in vitro samples.

[0039] S2. Extract total RNA from the in vitro sample; and reverse transcribe the miRNA in the total RNA to generate a cDNA mixed library.

[0040] In one example, the Thermo Fisher Scientific Total RNA Isolation Kit (Catalog No. A27828) can be used to extract total RNA from pleural fluid samples. In one example, TransScript miRNA First-strand cDNA SynthesisSuperMix (No. AT351) can be used to reverse transcribe miRNAs in total RNA.

[0041] S3. Add the specific upstream primer sequence of biomarker miR-142-5p (sequence number SEQ ID NO.1), the specific upstream primer sequence of miR-155-5p (sequence number SEQ ID NO.2), the internal control sequence, the fluorescent probe of miR-142-5p, and the fluorescent probe of miR-155-5p to the cDNA mixed library, perform qPCR amplification, and obtain the detection results.

[0042] Specifically, the base sequence of SEQ ID NO.1 is CCCCCGATAAAGTAGAAAGCATAT; the base sequence of SEQ ID NO.2 is CCCGTTAATGCTAATCGTGATAGTT; and the internal reference sequence is SnRNA U6.

[0043] The PCR amplification process is shown in Table 2: Table 2. PCR amplification process

[0044] The circulation thresholds (Ct values) of miR-142-5p and miR-155-5p in each pleural effusion sample from the HF and NHF groups are shown in Tables 3 and 4. The circulation thresholds of miR-142-5p and miR-155-5p in each sample in Tables 3 and 4 are the average values ​​of three repeated experiments.

[0045] Table 3. Detection results of biomarkers in pleural effusion samples from the HF group.

[0046] Calculate the intrinsic parameter correction ΔCt1=Ct for miR-142-5p in each sample of the HF group. miR-142-5p –Ct SnRNA U6 The intrinsic parameter correction of miR-155-5p is ΔCt2=Ct. miR-155-5p –Ct SnRNA U6 Then, the relative expression level of miR-142-5p was calculated as RE. miR-142-5p=2^(-ΔCt1); the relative expression level of miR-155-5p is RE miR-155-5p =2^(-ΔCt²). See the statistical results. Figure 1 .

[0047] Table 4. Detection results of biomarkers in pleural effusion samples from the NHF group

[0048] Calculate the internal reference correction ΔCt3=Ct for miR-142-5p in each sample of the NHF group. miR-142-5p –Ct SnRNA U6 The intrinsic parameter correction of miR-155-5p is ΔCt4=Ct. miR-155-5p –Ct SnRNA U6 Then, the relative expression level of miR-142-5p was calculated as RE. miR-142-5p =2^(-ΔCt3); the relative expression level of miR-155-5p is RE miR-155-5p =2^(-ΔCt4). See the statistical results. Figure 1 .

[0049] from Figure 1 The results show that, compared with the NHF group ( Figure 1 Compared with non-HF samples, the expression levels of miR-142-5p and miR-155-5p were significantly upregulated in pleural effusion samples from the HF group (*). P <0.05, ** P <0.01). Receiver operating characteristic (ROC) curves were plotted based on miR-142-5p, miR-155-5p, and a combination of miR-142-5p and miR-155-5p, respectively. See [link to results]. Figure 2 See Table 5. The AUC of miR-142-5p was 0.67 (95% CI: 0.53–0.81), the AUC of miR-155-5p was 0.70 (95% CI: 0.58–0.81), and the combined AUC of the two was 0.69 (95% CI: 0.57–0.82). There is a certain correlation between miR-142-5p and miR-155-5p (according to Spearman test, r=0.74, p<0.001).

[0050] Table 5. ROC curve parameters for assessing HF diagnosis based on miRNAs in pleural effusion samples.

[0051] Note: CI is the confidence interval.

[0052] The above description, in conjunction with specific preferred embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various simple deductions or substitutions can be made without departing from the concept of the present invention, and all such modifications and substitutions should be considered within the scope of protection of the present invention.

Claims

1. A biomarker for in vitro identification of pleural effusion due to heart failure, characterized in that, The biomarker consists of miR-142-5p and / or miR-155-5p.

2. The biomarker for in vitro identification of heart failure-type pleural effusion according to claim 1, characterized in that, The sample used for in vitro identification is a pleural effusion sample.

3. The use of the reagent for detecting the biomarker of claim 2 in the preparation of a product for in vitro identification of pleural effusion caused by heart failure.

4. The application according to claim 3, characterized in that, The product is a kit for in vitro identification of pleural effusion caused by heart failure.

5. The application according to claim 4, characterized in that, The kit contains a first detection reagent for detecting the concentration of miR-142-5p in pleural effusion samples, and / or a second detection reagent for detecting the concentration of miR-155-5p in pleural effusion samples.

6. The application according to claim 5, characterized in that, The first detection reagent includes a specific upstream primer sequence of miR-142-5p, a first internal reference sequence, and a fluorescent probe of miR-142-5p; The second detection reagent includes a specific upstream primer sequence of miR-155-5p, a second internal reference sequence, and a fluorescent probe of miR-155-5p; The specific upstream primer sequence of miR-142-5p is numbered SEQ ID NO.1; The specific upstream primer sequence of miR-155-5p is numbered SEQ ID NO.

2.

7. The application according to claim 6, characterized in that, Both the first internal reference sequence and the second internal reference sequence are SnRNA U6.

8. A method for detecting the biomarker according to claim 1, characterized in that, Includes the following steps: Obtaining ex vivo samples; Total RNA was extracted from the in vitro samples; The miRNAs in the total RNA were reverse transcribed to form a cDNA mixed library; The specific upstream primer sequences for biomarkers miR-142-5p and miR-155-5p were added to the cDNA mixed library, and qPCR amplification was performed to obtain the amplification curve and Ct value; the specific upstream primer sequence for miR-142-5p is numbered SEQ ID NO.1; the specific upstream primer sequence for miR-155-5p is numbered SEQ ID NO.2; The relative expression levels of miR-142-5p and / or miR-155-5p in the sample were calculated based on the amplification curves and Ct values.

9. The method for detecting biomarkers according to claim 8, characterized in that, The ex vivo sample was a pleural effusion sample.

Images