In-del molecular marker closely linked to maize dwarf trait, detection reagent and application thereof

Abstract

The application discloses an InDel molecular marker closely linked to a corn short-stalk character, a detection reagent and application thereof, and belongs to the technical field of molecular genetics. The application identifies an InDel molecular marker closely linked to the corn short-stalk for the first time from a corn No. 3 chromosome, and the InDel molecular marker is named InDel-JZ24 and located between 22,856,489bp and 22,856,490bp of the corn No. 3 chromosome. An insertion of a 4197bp nucleotide fragment exists. The InDel molecular marker can be used for accurately identifying the short-stalk character of corn at a seedling stage, has the advantages of simplicity, high efficiency, high accuracy, good repeatability and the like, and can be used for corn molecular marker assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to an InDel molecular marker, detection reagent, and application that are closely linked to the dwarf trait in maize. Background Technology

[0002] Corn is an important crop for food, feed, and industrial raw materials, and its yield and stability directly affect agricultural production efficiency. With the continuous increase in corn planting density, lodging problems caused by excessive plant height and insufficient stalk mechanical strength are becoming increasingly prominent. Short stalks or appropriately reduced plant height are beneficial for improving the corn plant population structure, enhancing lodging resistance, increasing tolerance to high-density planting conditions, and facilitating mechanized harvesting. Therefore, short stalk traits have become one of the important target traits in corn plant type improvement and high-yield breeding.

[0003] Research and analysis of different dwarf maize materials have shown that maize plant height is regulated by two independent genetic systems: single-gene and multi-gene systems. In the single-gene system, dwarfing plants are controlled by a major gene at a single locus; the presence of even one dwarfing gene significantly reduces plant height. In the multi-gene system, dwarfing plants are determined by the cumulative effect of multiple minor genes; the more genes accumulated, the shorter the plant. To date, more than 60 dwarfing loci with height-reducing effects have been identified, and more than 30 dwarfing genes have been successfully mapped, such as... D1 , D3 , D8 , D9 , BR2 , KN1 , ZmACS7 , ZmTE1 However, most plants carrying the dwarf gene are often accompanied by undesirable agronomic traits (such as reduced biomass or weakened stress resistance), severely limiting their application potential in breeding practices. Currently, there are few dwarf resources available for breeding, and their genetic base is narrow, so further exploration and utilization of new dwarf resources is of great significance.

[0004] For newly discovered maize dwarf mutant materials, since the location of the gene controlling the dwarf trait and the linkage variation are not yet clear, there is usually a lack of molecular markers that can accurately distinguish between the dwarf genotype and the normal genotype, which limits the application of dwarf genes in germplasm identification, genetic analysis, backcrossing and breeding, and molecular marker-assisted breeding. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide an InDel molecular marker, detection reagent, and its application that are closely linked to the dwarf trait in maize. The InDel molecular marker of this invention can be used to detect and identify the dwarf trait in maize, and can be used in breeding practices in a simple, rapid, and high-throughput manner, thus accelerating the maize breeding process.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an InDel molecular marker closely linked to the dwarf trait of maize, the InDel molecular marker being named InDel-JZ24, located between 22,856,489bp and 22,856,490bp on maize chromosome 3, with the reference genome being B73 RefGen_v5; In maize materials exhibiting the dwarf trait, a long insertion exists between 22,856,489bp and 22,856,490bp on chromosome 3. The nucleotide sequence of this long insertion is shown in SEQ ID NO.1. Specifically:

[0007] The molecular marker InDel-JZ24 of this invention is closely linked to the dwarf trait in maize. Using the molecular marker InDel-JZ24 of this invention, maize materials with the dwarf trait can be identified, which is of great significance for maize breeding and germplasm resource screening.

[0008] In a second aspect, the present invention provides the application of the above-mentioned InDel molecular marker in screening or identifying maize materials with dwarf stalk traits.

[0009] A third aspect of the present invention provides a detection reagent comprising: a primer pair for amplifying the aforementioned InDel molecular marker, the primer pair consisting of upstream primer F1 shown in SEQ ID NO.2, upstream primer F2 shown in SEQ ID NO.3, and downstream primer R shown in SEQ ID NO.4; specifically as follows: Upstream primer F1: 5'-TCTGGCATCTTGATGTGCCTTGCTGGAA-3'; (SEQ ID NO.2) Upstream primer F2: 5'-TGGACGATGATGTTGCGACT-3'; (SEQ ID NO.3) Downstream primer R: 5'-GGCCTCACTAGCGGGTGAAACTAACTGA-3'. (SEQ ID NO.4) Furthermore, the detection reagent also includes: DNA template, Taq Master Mix and ddH2O.

[0010] A fourth aspect of the present invention provides the use of the above-described detection reagent in the following (1) or (2): (1) Screening or identifying maize materials with dwarf stalk traits; (2) Marker-assisted breeding of maize.

[0011] In the above applications, the marker-assisted breeding of maize refers to the selection and breeding of maize varieties with dwarf stalk traits.

[0012] In the above applications, the method for screening or identifying maize materials with dwarf stalk traits includes the following steps: Using the genomic DNA of the maize sample as a template, PCR amplification was performed using the upstream primer F1 shown in SEQ ID NO.2, the upstream primer F2 shown in SEQ ID NO.3, and the downstream primer R shown in SEQ ID NO.4. The amplification products were then sequenced or analyzed by gel electrophoresis. If the sequence of the amplified product is as shown in SEQ ID NO.5, or the band on gel electrophoresis is 691 bp, then it is determined to be a maize mutant with dwarf stalk traits; the specific sequence of the amplified product is as follows: (SEQ ID NO.5) If the sequence of the amplified product is as shown in SEQ ID NO.6, or the band on gel electrophoresis is 274 bp, then it is determined to be wild-type maize material; the specific sequence of the amplified product is as follows: TCTGGCATCTTGATGTGCCTTGCTGGAAGCCTTGGGAACTGGAATTTACTTGTATGATCATTCTTTAGGAATTTGTAAATTATCTCCATATCTACATTCAAACATATAGCTTCCCAAAATGCAGCCTCCCTTCACAA GATAGTGTGAGTTTCACCCGCTAGTGAGGCCATGTTACCTGTAAGGGTGAGGCATCAACTATCAATCATACAGCTTCCTGAATGCAGCTTCCCTTTACAAGATAGTGTGTCAGTTAGTTTCACCCGCTAGTGAGGCC. (SEQ ID NO.6) If two bands of 274 bp and 691 bp appear simultaneously on gel electrophoresis, the genotype is identified as heterozygous. Since the dwarf phenotype of this invention is controlled by a recessive single gene, the plant height phenotype of the heterozygous genotype is tall.

[0013] Preferably, the PCR amplification reaction system is as follows: 0.3 μL of 10 μM upstream primer F1 shown in SEQ ID NO.2, 0.3 μL of 10 μM upstream primer F2 shown in SEQ ID NO.3, 0.3 μL of 10 μM downstream primer R shown in SEQ ID NO.4, 1 μL of genomic DNA at a concentration of 100 ng / μl; 5 μL of 2×Taq Master Mix; and 3.1 μL of ddH2O.

[0014] The PCR amplification reaction conditions were as follows: 5℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; and storage at 12℃.

[0015] In this invention, upstream primer F1 is designed before the insertion fragment of the InDel-JZ24 molecular marker, and upstream primer F2 is designed within the insertion fragment of the InDel-JZ24 molecular marker. Therefore, wild-type maize materials contain only upstream primer F1, and the amplified band size is 274 bp. However, dwarf maize materials contain both F1 and F2 sequences. But because of the InDel insertion, the base length between F1 and R sequences is >5000 bp. The PCR reaction conditions used in this invention cannot amplify this fragment. Therefore, the dwarf maize material amplifies a 691 bp band between F2 and R.

[0016] The beneficial effects of this invention are: This invention is the first to screen and identify an InDel molecular marker closely linked to the dwarf trait in maize from chromosome 3. This molecular marker is closely linked to the genetic locus controlling the dwarf trait in maize and can accurately reflect whether the maize material being tested carries the target dwarf allele, providing a new molecular detection tool for the identification and utilization of dwarf maize germplasm.

[0017] Using the InDel molecular marker of this invention, genotyping of maize materials can be performed via PCR amplification, eliminating the need to wait until the plants reach maturity and then judge based on phenotypes such as plant height and internode length. This allows for early prediction and selection of dwarf traits during the seedling stage. The InDel molecular marker detection method of this invention is simple to operate, has a short detection cycle, and the results are easy to interpret. It has advantages such as high detection efficiency, high accuracy, good repeatability, and low detection cost, making it suitable for rapid screening of large batches of maize breeding materials. Attached Figure Description

[0018] Figure 1 Electrophoretic pattern of PCR amplification products of the molecular marker InDel-JZ24 of the present invention in maize material of Example 2. Wherein, T represents the amplification band of homozygous B73 genotype, which is the tall stalk phenotype, and D represents the homozygous... dw407 The amplified band pattern of the genotype is the dwarf phenotype, H is the amplified band pattern of the heterozygous genotype, and M is the marker; CK is the control without DNA.

[0019] Figure 2 Example 2 of this invention: Measurement of plant height of mature maize material. Detailed Implementation

[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0021] Terminology Explanation: Dwarf trait in maize: refers to maize plants whose average plant height is significantly lower than that of non-dwarf control materials or wild-type materials under the same planting conditions and growth stage. Plant height is the natural vertical distance from the ground surface to the tip of the tassel on the main stem at maturity.

[0022] As mentioned earlier, maize plant height is closely related to lodging resistance and tolerance to dense planting. Many of the discovered dwarfing genes are linked to undesirable traits, affecting yield, disease resistance, and other desirable traits, making them difficult to apply in field breeding. Furthermore, the number of currently usable dwarfing genes is limited, resulting in a single genetic background available for dwarfing breeding. Therefore, discovering new dwarfing genes is of great significance for broadening the germplasm resources for maize dwarfing breeding and improving breeding selection efficiency.

[0023] In view of this, this invention has conducted in-depth research on the genes controlling the dwarf trait in maize. This invention uses genetic analysis to determine the inheritance pattern of the dwarf trait and uses map-based cloning technology to locate the dwarf gene between two molecular markers, DW1 and DW6, with a physical distance of 193 kb. Sequencing within the located region revealed that the maize dwarf mutant, compared to the wild type, has an insertion of 4197 nucleotides. This region can serve as a tightly linked InDel molecular marker for maize dwarfism, named InDel-JZ24.

[0024] Because the target Indel fragment insertion is quite long, full-length amplification cannot be achieved through a single PCR. Therefore, this invention designs two forward primers and one reverse primer: forward primer F1 specifically binds to the wild-type normal sequence, while the other forward primer F2 targets the mutant sequence containing the Indel insertion fragment, as detailed below: Upstream primer F1: 5'-TCTGGCATCTTGATGTGCCTTGCTGGAA-3'; Upstream primer F2: 5'-TGGACGATGATGTTGCGACT-3'; Downstream primer R: 5'-GGCCTCACTAGCGGGTGAAACTAACTGA-3'.

[0025] The molecular marker InDel-JZ24 of this invention can accurately identify the dwarf trait of maize at an early stage, which is beneficial for breeding superior varieties with strong lodging resistance and tolerance to dense planting. This invention was proposed based on this.

[0026] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0027] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: The maize dwarf mutant used in this invention dw407 "Recorded in non-patent literature (maize dwarf mutant)" dw407The gene mapping and its application in breeding, Zhang Shuncong, Master's thesis of Shandong Agricultural University, 2022; the public can obtain the biological material from the applicant for use in replicating the invention.

[0028] Example 1: Obtaining InDel molecular markers tightly linked to maize dwarf stalks 1. Obtaining the dwarf mutant: dw407 The mutant is a naturally occurring mutant found in breeding fields, compared to the wild type. dw407 It exhibits slow growth even in its early stages. Under normal field management conditions, the mutant's plant height at maturity is 60%-80% of the wild type, and the dwarf phenotype is stably inherited, preliminarily determining that its phenotype is caused by gene mutation.

[0029] 2. Genetic analysis: use dw407 Both the mutant and the normal inbred line B73 exhibited normal plant height in the F1 generation, indicating that dwarfism is a recessive trait. In the F2 segregating population bred with B73, the ratio of wild-type to mutant plants met a chi-square test of 3:1, indicating... dw407 The mutant trait is controlled by a pair of recessive nuclear genes.

[0030] 3. Preliminary localization of the dwarf gene: F2 segregating populations constructed from inbred line B73 and a dwarf mutant were planted in the field. Phenotypic identification was performed on the segregating populations at the adult stage, and total DNA was extracted from leaves exhibiting the dwarf phenotype. Map-based cloning was used to locate the target gene. First, 208 primer pairs evenly distributed across the 10 chromosomes, published on the MaizeGDB website (https: / / www.maizegdb.org / ), were used to screen for parental polymorphism. Then, five plants with normal phenotypes and five mutant plants were used to construct wild-type and mutant pools, respectively. Preliminary linkage analysis was performed using primers showing polymorphism between parents. Finally, the target gene was located on the short arm of chromosome 3, between molecular markers p-umc1772 and p-bnlg1452, with a region size of 11.2 Mb.

[0031] The base sequences of molecular markers p-umc1772 and p-bnlg1452 are as follows: p-umc1772 Upstream primer: 5'-ACATAATAACAAGCAGGCAGGAGG-3'; Downstream primer: 5'-AAATAACGACTACGGTCACACGGT-3'.

[0032] p-bnlg1452 Upstream primer: 5'-CTCCTCTCCTCCACGATCAC-3'; Downstream primer: 5'-CGCAAACGATCTCTGACCTT-3'.

[0033] 4. Fine mapping of dwarf genes: Continue to expand dw407 The F2 segregating population constructed with B73 was used to densify polymorphic molecular markers within the initial localization region, ultimately locating the target gene within a 193 kb region between molecular markers DW1 and DW6.

[0034] DW1 and DW6 are self-designed markers, and their base sequences are as follows: DW1 Upstream primer: 5'-CGCCTCTTTTCTCGTCACAC-3'; Downstream primer: 5'-GGGTCCTCCTTCGCAACA-3'.

[0035] DW6 Upstream primer: 5'-TGGCTAATACGAGATTGATGTCA-3'; Downstream primer: 5'-AGCCACCTACTTTCCTACACT-3'.

[0036] Finally, in the dwarf mutant dw407 An insertion of 4197 nucleotides (shown in SEQ ID NO.1) was found on chromosome 3 from 22,856,489bp to 22,856,490bp, which was named the molecular marker InDel-JZ24, with the physical location referenced to the B73 RefGen_v5 genome version.

[0037] Example 2: Application of the molecular marker InDel-JZ24 in the identification of dwarf stalk traits in maize Based on the molecular marker InDel-JZ24 screened in Example 1, primer pairs were designed for amplifying the molecular marker. Since the target InDel insert fragment is relatively long, it is difficult to amplify it completely in a single PCR. Therefore, two forward primers and one reverse primer were designed. One forward primer binds to the wild-type original sequence, and the other forward primer specifically binds to the sequence carrying the InDel insert. The designed primer pair sequences are as follows: Upstream primer F1: 5'-TCTGGCATCTTGATGTGCCTTGCTGGAA-3'; (SEQ ID NO.2) Upstream primer F2: 5'-TGGACGATGATGTTGCGACT-3'; (SEQ ID NO.3) Downstream primer R: 5'-GGCCTCACTAGCGGGTGAAACTAACTGA-3'. (SEQ ID NO.4) Using maize inbred line B73 and dw407 Using mutants as parents, new F2 segregating populations were constructed. The dwarf trait of maize materials in the F2 segregating populations was detected using the molecular marker InDel-JZ24 and designed primer pairs, as detailed below: Using the genomic DNA of the maize sample as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and the size of the amplification product was used to determine the amplification result.

[0038] The reaction system for 10 μL PCR amplification is as follows: (1) 0.3 μL of the upstream primer F1 shown in SEQ ID NO.2 at a concentration of 10 μmol / L; (2) 0.3 μL of the upstream primer F2 shown in SEQ ID NO.3 at a concentration of 10 μmol / L; (3) 0.3 μL of the downstream primer R shown in SEQ ID No. 4 at a concentration of 10 μmol / L; (4) 1 μL of DNA template with a concentration of 100 ng / μL; (5) 5μL 2×Taq Master Mix; (6) 3.1 μL ddH2O.

[0039] The PCR amplification procedure is as follows: (1) Pre-denaturation at 95℃ for 5 min; (2) 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; (3) Extend at 72℃ for 10 min; (4) Store at 12℃.

[0040] The amplified fragments were subjected to electrophoresis on a 1% agarose gel, and the dwarf stalk trait of the maize material was identified based on the electrophoretic bands. The identification method is as follows: If a band of 691 bp is amplified, it is identified as maize with the dwarf trait and labeled as D; If a band of 274 bp is amplified, it is identified as wild-type maize, and the plant is tall and marked as T; If two bands of 691 bp and 274 bp are amplified, it indicates that the maize is heterozygous and the plant is tall, marked as H.

[0041] Gel electrophoresis results of some maize materials in the F2 segregating population are as follows: Figure 1 As shown.

[0042] Maize (D), wild-type maize (T), and heterozygous maize (H) identified as having dwarf trait based on the molecular marker InDel-JZ24 were cultured to maturity under the same planting conditions, and their plant height was measured.

[0043] The results are as follows Figure 2 As shown, the results indicate that the plant height of wild-type maize (T) and heterozygous maize (H) was significantly higher than that of maize (D) identified by the molecular marker InDel-JZ24 as having the dwarf gene. The identification results of the molecular marker InDel-JZ24 were consistent with the actual plant height measurements. This demonstrates that using InDel-JZ24 for genotyping of this population is accurate and feasible, and can be easily, rapidly, and with high throughput applied to breeding practices, which will greatly accelerate the process of molecular breeding for dwarf maize genes.

[0044] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. An InDel molecular marker closely linked to the dwarf trait of maize, characterized in that, The InDel molecular marker is named InDel-JZ24 and is located between 22,856,489bp and 22,856,490bp on maize chromosome 3, with the reference genome being B73 RefGen_v5; In maize materials exhibiting the dwarf trait, an insertion of a long gene fragment exists between 22,856,489bp and 22,856,490bp on chromosome 3, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The application of the InDel molecular marker as described in claim 1 in screening or identifying maize materials with dwarf stalk traits.

3. A detection reagent, characterized in that, The detection reagent comprises a primer pair for amplifying the InDel molecular marker of claim 1, the primer pair consisting of upstream primer F1 shown in SEQ ID NO.2, upstream primer F2 shown in SEQ ID NO.3, and downstream primer R shown in SEQ ID NO.

4.

4. The detection reagent according to claim 3, characterized in that, The detection reagent also includes: DNA template, TaqMaster Mix and ddH2O.

5. The use of the detection reagent according to claim 3 or 4 in the following (1) or (2): (1) Screening or identifying maize materials with dwarf stalk traits; (2) Marker-assisted breeding of maize.

6. The application according to claim 5, characterized in that, The marker-assisted breeding of maize is: the selection and breeding of maize varieties with dwarf stalk traits.

7. The application according to claim 5, characterized in that, Methods for screening or identifying maize materials with dwarf stalk traits include the following steps: Using the genomic DNA of the maize sample as a template, PCR amplification was performed using the upstream primer F1 shown in SEQ ID NO.2, the upstream primer F2 shown in SEQ ID NO.3, and the downstream primer R shown in SEQ ID NO.

4. The amplification products were then sequenced or analyzed by gel electrophoresis. If the sequence of the amplified product is as shown in SEQ ID NO.5, or the band of gel electrophoresis is 691 bp, it is determined to be a maize mutant with the dwarf gene; If the sequence of the amplified product is as shown in SEQ ID NO.6, or the band of gel electrophoresis is 274 bp, it is determined to be wild-type maize material; If two bands of 274 bp and 691 bp appear simultaneously on gel electrophoresis, it is determined to be a heterozygous genotype.

8. The application according to claim 7, characterized in that, The PCR amplification reaction system consisted of: 0.3 μL of 10 μM upstream primer F1 (SEQ ID NO.2), 0.3 μL of 10 μM upstream primer F2 (SEQ ID NO.3), 0.3 μL of 10 μM downstream primer R (SEQ ID NO.4), 1 μL of 100 ng / μL genomic DNA, 5 μL of 2×Taq Master Mix, and 3.1 μL of ddH2O.

9. The application according to claim 7, characterized in that, The PCR amplification reaction conditions were as follows: 5℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; and storage at 12℃.

Images