Reference gene for ganoderma lucidum hyphae degradation research, primer and application thereof

Abstract

The application belongs to the technical field of molecular biology, and specifically discloses a kind of reference gene for Ganoderma lucidum degenerative hypha research and primer and application thereof.The reference gene is thioredoxin (Thioredoxin, Trx), and its nucleotide sequence is shown as SEQ ID NO.1.The primer pair sequence for detecting the reference gene is shown as SEQ ID NO.2-3.Through multi-strain stability evaluation, the expression stability of the reference gene Trx is optimal among the six candidate reference genes; when the reference gene is used as a reference for qPCR, the consistency of the relative expression amount of the target gene and the transcriptome data is significantly higher than the detection results of using PP2A and cyp5 as the reference.The reference gene and primer pair have the characteristics of high amplification efficiency and good stability, and provide a reliable molecular tool for accurate detection of Ganoderma lucidum degenerative hypha gene expression.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to internal reference genes, primers, and applications suitable for the study of degenerated mycelia of Ganoderma lucidum. Background Technology

[0002] After repeated subculturing, Ganoderma lucidum strains are prone to strain degeneration, with typical phenotypes including a significant decrease in hyphal growth rate, deformed colony edges, and abnormal hyphal color. Analyzing the molecular regulatory mechanisms of Ganoderma lucidum hyphal degeneration at the gene transcription and expression level is a core research approach to revealing the intrinsic mechanisms of strain degeneration. Real-time quantitative PCR (qPCR), with its advantages of high sensitivity, strong specificity, and good reproducibility, has become the mainstream technique for quantitatively detecting gene expression abundance. However, the accuracy of qPCR quantitative results is highly dependent on the screening of stable internal control genes and the rational design of specific amplification primers. Therefore, screening genes stably expressed in degenerated Ganoderma lucidum hyphae as internal controls and designing corresponding specific amplification primers are prerequisites for ensuring the reliability of qPCR quantitative analysis results. Summary of the Invention

[0003] To address the technical problem of insufficient accuracy in detecting gene expression levels in degenerated mycelia due to the lack of stable internal reference genes suitable for the study of degenerated Ganoderma lucidum hyphae in existing technologies, the present invention aims to provide a Ganoderma lucidum internal reference gene and its specific primer pair. The internal reference gene and primer pair have the characteristics of high amplification efficiency and good stability, and can be used for the detection of gene expression levels in degenerated Ganoderma lucidum hyphae.

[0004] To achieve the above objectives, the present invention provides the following solution:

[0005] In a first aspect, the present invention provides an internal reference gene suitable for the study of degenerated mycelia of Ganoderma lucidum. The internal reference gene is thioredoxin (Trx), and its nucleotide sequence is shown in SEQ ID NO.1, specifically:

[0006] Preferably, the internal reference gene is used as an internal reference for detecting the expression level of the target gene in the degenerated hyphae of Ganoderma lucidum.

[0007] Secondly, the present invention provides primer pairs for amplifying the aforementioned internal reference gene, the sequences of which are as follows: Trx_F: TCGTCTCCTCCGTCATCCTA (SEQ ID NO.2); Trx_R: CCTTCTTGTCGTTGGCTTCG (SEQ ID NO. 3).

[0008] Thirdly, the present invention provides the application of the above-mentioned primer pairs in the preparation of products for detecting the expression level of genes in degenerated mycelia of Ganoderma lucidum.

[0009] Preferably, the product includes a reagent kit.

[0010] Fourthly, the present invention provides a kit comprising the primer pairs described above.

[0011] Preferably, the kit further includes at least one of the following: reagents for extracting total RNA from degenerated Ganoderma lucidum hyphae, reverse transcription reagents, and quantitative real-time PCR reagents.

[0012] Preferably, the kit further includes an internal reference gene standard, which is a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.1.

[0013] Preferably, the kit further includes a negative control, which is nuclease-free water.

[0014] Fifthly, the present invention provides the application of the above-mentioned internal reference gene, primer pair or kit in the gene expression analysis of Ganoderma lucidum.

[0015] Preferably, it is used in the detection of gene expression levels in degenerated mycelia of Ganoderma lucidum.

[0016] Sixthly, the present invention provides a method for detecting the expression level of genes in degenerated mycelia of Ganoderma lucidum, comprising the following steps:

[0017] S1: Total RNA extracted from degenerated Ganoderma lucidum hyphae;

[0018] S2: Reverse transcribe the total RNA into cDNA;

[0019] S3: Using the cDNA as a template, perform real-time PCR using the primer pairs described above, and use the internal reference gene as an internal reference to detect the relative expression level of the target gene.

[0020] Preferably, the above-mentioned internal reference gene is used as an internal reference, and the result is obtained by 2...－ΔΔCt The relative expression level of the target gene is calculated using this method.

[0021] The present invention has the following beneficial effects:

[0022] Compared with existing technologies, this invention has obtained a novel internal reference gene Trx and its specific primer pair suitable for the study of degenerated Ganoderma lucidum hyphae through systematic screening. This internal reference gene is stably expressed in different Ganoderma lucidum strains and has the smallest standard deviation, which is significantly better than candidate internal reference genes such as cyp5 and PP2A. When qPCR detection is performed using this internal reference gene as a reference, the consistency between the calculated relative expression level of the gene and the transcriptome data is significantly higher than that of existing internal reference genes. This effectively solves the technical problem of insufficient accuracy in the detection of target gene expression levels caused by the fluctuation of internal reference gene expression in degenerated Ganoderma lucidum hyphae, and provides a stable and reliable molecular tool for the study of the degeneration mechanism of Ganoderma lucidum strains and gene expression analysis. Attached Figure Description

[0023] Figure 1 Agarose gel electrophoresis and melting curves of the amplification products of the Trx_F / Trx_R primer pair.

[0024] Figure 2 Ct values ​​of different primer pairs in hyphae of GL0102 strain (A) and CGMCC5.26 strain (B) at different passage numbers.

[0025] Figure 3 Analysis of the relative expression levels of the target gene based on different internal reference genes. Detailed Implementation

[0026] The following embodiments are further illustrations of the present invention, but not limitations thereof. Specific experimental conditions and methods are not specified in the following embodiments, and the techniques used are generally conventional methods well known to those skilled in the art.

[0027] Example 1: Selection of internal reference gene, primer design and stability verification

[0028] 1. Selection of internal reference genes: Mycelia were obtained from the fruiting bodies of Ganoderma lucidum GL0102 (a Ganoderma lucidum variety 'Zhi 102' recognized by the Fujian Provincial Crop Variety Approval Committee) and designated as G0. These mycelia were then continuously asexually passaged on PDA plates, and the mycelia from generations 2, 9, 16, 23, 30, 37, and 44 (designated as G2, G9, G16, G23, G30, G37, and G44, respectively) were collected for transcriptome sequencing. Genes showing no significant difference in expression levels across all samples (stable TPM, CV < 10%) and with an average expression abundance TPM ≥ 100 were selected as candidate internal reference genes.

[0029] 2. Design of primers for internal reference genes: The gene structure of candidate internal reference genes is manually corrected based on transcriptome data to obtain accurate CDS sequences, and primers are designed accordingly.

[0030] 3. Validation of internal reference gene primers: qPCR amplification was performed on cDNA from Ganoderma lucidum using the above primers at serially 2-fold dilutions. The results were analyzed based on agarose gel electrophoresis and melting curves. Figure 1 The optimal internal reference gene primer pair Trx_F / Trx_R (Table 1) was selected based on indicators such as amplification efficiency. Its product length was 201 bp, and its amplification efficiency was 105.3%. 2 It is 0.9918.

[0031] Table 1. Amplification primer information for different internal reference genes

[0032] 4. Ct value stability verification process:

[0033] (1) RNA was extracted from the hyphae of Ganoderma lucidum GL0102 at different passage numbers (G2, G37 and G44);

[0034] (2) RNA was extracted from the hyphae of Ganoderma lucidum CGMCC5.26 at different passage numbers (G2 and G26);

[0035] (3) After adjusting to the same concentration, reverse transcription is performed to cDNA, and the concentration is adjusted to a suitable range of Ct value between 18 and 23;

[0036] (4) The above-mentioned internal reference gene primer pairs Trx_F / Trx_R and the internal reference genes gapdh, cyp5, RPL4, PP2A and BTU reported in previous literature (Table 1) were used to amplify the above samples by qPCR.

[0037] (5) The reaction system consisted of: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of forward and reverse primers (10 μmol / L), 8.2 μL of double-distilled water, and 1 μL of cDNA. The reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 3 s, 60℃ annealing for 32 s, for 40 cycles; and 72℃ extension for 30 s.

[0038] (6) The stability of the internal reference gene was determined based on the Ct values ​​in different samples: In strain GL0102, PP2A and Trx had the smallest standard deviations and the best stability; in strain CGMCC5.26, Trx and cyp5 had the smallest standard deviations and the best stability (Table 2). Figure 2 In summary, the internal reference gene primer pair of this invention exhibits the best stability.

[0039] Table 2. Standard deviation of Ct values ​​in qPCR amplification of Ganoderma lucidum mycelia using different internal reference gene primer pairs.

[0040] Example 2: Application of internal reference gene primer pairs

[0041] Genes with higher expression levels at G37 and G44 than at G2 (chr11g0199481, an NAD-dependent epimerase / dehydratase) and stable expression levels at G2, G37, and G44 (chr11g0198761, a peptidase S24 gene) were randomly selected. Both gene IDs were based on the GL0102_53 genome (source: http: / / www.gpgenome.com / species / 408). qPCR amplification was performed using the internal reference primer pairs Trx_F / Trx_R and the cyp5 and PP2A primer pairs of this invention. The relative expression levels obtained by the primer pairs provided in this invention showed higher consistency with the transcriptome data.

[0042] The specific method is as follows:

[0043] (1) Based on the transcriptome data of G2, G37 and G44 hyphae, the gene chr11g0199481 (NAD-dependent epimerase / dehydratase) with higher expression levels in G37 and G44 than in G2 was selected; and the gene chr11g0198761 (peptidase S24 gene) with stable expression levels in G2, G37 and G44 was selected.

[0044] (2) Design qPCR primers for the chr11g0199481 and chr11g0198761 genes (Table 3).

[0045] (3) qPCR amplification was performed using the internal reference gene primer pair Trx_F / Trx_R and the cyp5 and PP2A primer pairs of the present invention, respectively, and 2 –ΔΔCt The method for calculating relative gene expression levels showed that the expression levels of the internal reference genes provided in this invention were more consistent with the transcriptome than those of cyp5 and PP2A. Figure 3 ).

[0046] Table 3 qPCR primer information

[0047] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An internal reference gene for detecting gene expression levels in Ganoderma lucidum, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The internal reference gene according to claim 1, characterized in that, The internal reference gene was used as an internal reference to detect the expression level of the target gene in the degenerated hyphae of Ganoderma lucidum.

3. A primer pair for amplifying the internal reference gene of claim 1, characterized in that, It includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO.2 and the nucleotide sequence of which is shown in SEQ ID NO.

3.

4. The application of the primer pair according to claim 3 in the preparation of products for detecting gene expression levels in degenerated mycelia of Ganoderma lucidum.

5. A reagent kit, characterized in that, It includes the primer pair as described in claim 3.

6. The reagent kit according to claim 5, characterized in that, The kit also includes at least one of the following: reagents for extracting total RNA from degenerated Ganoderma lucidum hyphae, reverse transcription reagents, and quantitative real-time PCR reagents.

7. The application of the internal reference gene of claim 1, the primer pair of claim 3, or the kit of claim 5 in the gene expression analysis of Ganoderma lucidum.

8. The application according to claim 7, characterized in that, It is used in the detection of gene expression levels in degenerated mycelia of Ganoderma lucidum.

9. A method for detecting the expression level of genes in degenerated mycelia of Ganoderma lucidum, characterized in that, Includes the following steps: S1: Total RNA extracted from degenerated Ganoderma lucidum hyphae; S2: Reverse transcribe the total RNA into cDNA; S3: Using the cDNA as a template, perform real-time PCR using the primer pair described in claim 3, and use the internal reference gene as an internal reference to detect the relative expression level of the target gene.

10. The method according to claim 9, characterized in that, In step S3, 2 －ΔΔCt The relative expression level of the target gene is calculated using this method.

Images