InDel molecular marker for identifying salvia rosmifolia and application thereof

Abstract

The application discloses an InDel molecular marker for identifying Chamaesyce humulifolia and application thereof. The nucleotide sequence of the InDel molecular marker is shown as in SEQ ID NO:1. The InDel molecular marker of the application is located at a specific site of a chloroplast genome of Chamaesyce humulifolia, can effectively distinguish Chamaesyce humulifolia from common and easily confused Chamaesyce humulifolia species such as Chamaesyce serpyllifolia, Chamaesyce saxicola, Lycium chinense and Chamaesyce mexicana, and the identification result is intuitive and reliable.

Description

Technical Field

[0001] This invention relates to the field of plant molecular marker technology, specifically to an InDel molecular marker for identifying *Salvia splendens* and its application. Background Technology

[0002] Shady Sage ( Salvia nemorosa Sage (Salvia splendens) is a perennial herb belonging to the genus Sage in the Lamiaceae family. Native to Central Europe and West Asia, it is widely used as a landscaping plant and a source of nectar for bees due to its purple spike-like inflorescences and long flowering period. The entire plant contains volatile oils with antibacterial and anti-inflammatory medicinal value and is also widely used in traditional Chinese medicine.

[0003] Sage (genus) Salvia *Salvia* is one of the largest genus in the Lamiaceae family, with over 900 species worldwide and about 80 species in China. Due to the vast number of species in the *Salvia* genus, many are morphologically similar, making accurate morphological differentiation difficult, especially during the vegetative growth stage. Traditional classification methods primarily rely on morphological characteristics such as flowers and leaves, but these methods are subjective and highly susceptible to environmental influences. Shade sage and closely related species such as clary sage (*Salvia clary*) are also mentioned. Salvia sclarea ), European sage ( Salvia officinalis Salvia splendens, Mexican sage ( Salvia leucantha Plants such as α, β, and γ have similar morphologies in the seedling stage, which can easily cause confusion and bring difficulties to landscaping, medicinal plant cultivation and germplasm resource protection.

[0004] With the development of molecular biology techniques, DNA molecular marker technology has provided a reliable means for the accurate identification of plant varieties. InDel (Insertion-Deletion) markers are co-dominant molecular markers developed based on insertion or deletion sites in the genome. They possess advantages such as high polymorphism, good stability, and simple detection, and have been widely used in plant variety identification, genetic diversity analysis, and molecular breeding. The chloroplast genome, with its maternally inherited characteristics, moderate evolutionary rate, and sequence conservation, is an ideal material for developing molecular markers for interspecific identification.

[0005] Currently, there is limited research on specific molecular markers for *Salvia splendens*, and a lack of molecular markers that can rapidly and accurately distinguish *Salvia splendens* from other *Salvia* varieties is needed. Therefore, developing *Salvia splendens*-specific InDel molecular markers and establishing rapid and accurate molecular identification methods are of great significance for protecting *Salvia splendens* germplasm resources, preventing variety confusion, and guiding its application in landscaping and medicinal plant cultivation. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide an InDel molecular marker for identifying *Salvia sylvatica* and its application. The InDel molecular marker of this invention can effectively distinguish *Salvia sylvatica* from other *Salvia* species, providing a simple, rapid, and effective auxiliary method for early variety identification, germplasm resource conservation, and molecular-assisted breeding of *Salvia sylvatica* seedlings.

[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides an InDel molecular marker for identifying sage in the shade, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0008] This invention also provides an application of the InDel molecular marker described above in the identification of cultivars of *Salvia splendens* seedlings, germplasm resource conservation, or molecular-assisted breeding.

[0009] The present invention also provides a primer pair for obtaining the InDel molecular marker, wherein the primer pair is: InDel-1F: 5'-AAAGTAGGTTTTTTCGTTATGGGCC-3'; InDel-1R: 5'-TGAAATCTTGCTTGGTCTTCACTG-3'.

[0010] Furthermore, if the primer pair amplifies a 245 bp band, and this band contains the InDel molecular marker InDel-1, then the plant to be tested, *Salvia*, is *Salvia hygrophila*; the nucleotide sequence of the band is shown in SEQ ID NO: 4.

[0011] This invention also provides the application of the primer pair described above in the identification of cultivars, germplasm resource conservation, or molecular-assisted breeding of *Salvia splendens* seedlings.

[0012] The present invention also provides a kit for identifying *Salvia splendens*, the kit comprising the primer pair described above.

[0013] The present invention also provides a method for identifying *Salvia splendens* using the aforementioned kit, comprising the following steps: (1) Extract genomic DNA from the *Salvia* species to be tested; (2) Using the extracted genomic DNA as a template, PCR amplification was performed on it using the primer pairs InDel-1F and InDel-1R provided in the kit; (3) Perform Sanger sequencing on the PCR product. When the PCR product is a 245 bp band, the band contains the InDel molecular marker InDel-1. Then the plant to be tested is *Salvia spp.*

[0014] Furthermore, the nucleotide sequence of the band is shown in SEQ ID NO: 4.

[0015] The present invention also provides a method for identifying *Salvia splendens* using the aforementioned kit, comprising the following steps: ① Extract genomic DNA from the *Salvia* species to be tested; ② Using the LightCycler® High Resolution Melting Master and the primer pairs in the kit, real-time quantitative PCR amplification of genomic DNA from the target Sage species was performed; ③ Perform HRM analysis on the real-time quantitative PCR products. If the highest melting peak of the genus *Salvia* to be tested is at 76.5℃, then the genus *Salvia* to be tested is *Salvia shadiensis*.

[0016] The present invention also provides an application of the kit described herein in the identification of cultivars of *Salvia splendens* seedlings, germplasm resource conservation, or molecular-assisted breeding.

[0017] The beneficial effects of this invention are: (1) High specificity: The InDel molecular marker of the present invention is located at a specific site in the chloroplast genome of Sageia serratifolia, which can effectively distinguish Sageia serratifolia from common and easily confused Sage species such as Clary Sage, European Sage, Salvia splendens, and Mexican Sage. The identification results are intuitive and reliable. (2) Good stability: Chloroplast genome has the characteristics of maternal inheritance, sequence conservation and high copy number. Molecular markers based on chloroplast InDel sites are not affected by nuclear genome heterozygosity, cultivation environment and growth stage, and the identification results are stable. (3) It can be used for early seedling identification: the present invention can complete the identification by taking a small number of leaves during the vegetative growth stage or seedling stage, without waiting for the flowering period, which greatly shortens the variety identification cycle and reduces the economic losses caused by misplanting or mixing of seedlings; (4) Wide range of applications: The InDel molecular marker and its primer pair of the present invention can be developed into a specific detection kit, which can be widely used in the fields of quality control of landscaping seedlings, identification of germplasm resource banks, identification of the authenticity of medicinal plant cultivation raw materials and molecular-assisted breeding. Attached Figure Description

[0018] Figure 1 Electrophoresis diagram of InDel-1 primer pair amplification; In the diagram, M represents the DNA marker, and lanes 1-5 are respectively lined with sage (Salvia splendens). S. nemorosa Clary sage ( S. sclarea ), European sage ( S. officinalis), a string of red ( S. splendens Mexican sage ( S. leucantha ); Figure 2 A comparison of the amplification and sequencing results of five easily confused *Salvia* species using InDel-1 primer pairs; In the picture, Sn is sage, Ssc is clary sage, So is European sage, Ssp is scarlet sage, and Sl is Mexican sage. Figure 3 Thermal melting curves of five species of Sage; Figure 4 A comparison of the amplification and sequencing results of eight species of Sage using InDel-1 primer pairs; Figure 5 The thermal melting curves of eight species of Sage are shown. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0020] This invention provides an InDel molecular marker, InDel-1, for identifying *Salvia miltiorrhiza*. The InDel-1 is located at positions 21955-21979 of the overall chloroplast genome sequence of *Salvia miltiorrhiza* in patent application number 2026110620573 (i.e., positions 2916-2940 of xl-3 in patent application number 2026110620573), and is a 25 bp insertion sequence. The nucleotide sequence of the InDel molecular marker InDel-1 is shown in SEQ ID No: 1.

[0021] The chloroplast genome of *Salvia splendens* in this invention is the chloroplast genome of *Salvia splendens* in the invention patent application number 2026110620573.

[0022] Example 1 Functional Verification of the InDel Molecular Marker InDel-1 in Identifying Sage in the Shade of the Forest I. PCR Amplification Method 1. Based on the comparison of shady sage ( Salvia nemorosa Clary sage ( Salvia sclarea NCBI login number is NC_050900.1), Sage ( Salvia officinalis NCBI login number is MN520021), a string of red flowers ( Salvia splendens NCBI accession number NC_050901.1), Mexican sage ( Salvia leucanthaThe chloroplast genome sequence (NCBI accession number MT156367.1) was used as the target fragment, and a 220 bp sequence containing the InDel molecular marker InDel-1 was selected. The amplification primers were designed as follows: InDel-1F: 5'-AAAGTAGGTTTTTTCGTTATGGGCC-3' (SEQ ID NO: 2); InDel-1R: 5'-TGAAATCTTGCTTGGTCTTCACTG-3' (SEQ ID NO: 3).

[0023] 2. Extraction of genomic DNA from the samples to be tested: Genomic DNA was extracted from *Salvia splendens*, *Clary Salvia splendens*, *Salvia pubescens*, *Salvia splendens*, and *Salvia splendens gracilis* using a modified CTAB method.

[0024] 3. PCR reaction: Using the extracted genomic DNA as a template, PCR amplification was performed using InDel-1F and InDel-1R primers. The PCR reaction system was as follows: 2×PCR rTaq Mix (Takara): 10 μL, InDel-1F (10 μmol / L): 1.0 μL, InDel-1R (10 μmol / L): 1.0 μL, genomic DNA (50 ng / μL): 2 μL, ddH2O: 6 μL, total 20 μL.

[0025] The amplification program was as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for 35 cycles; and extension at 72℃ for 10 min.

[0026] 4. Electrophoresis detection The PCR products obtained above were detected by 1.0% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, the band in lane 1 is slightly larger than the other four, but the difference is not significant. Therefore, these bands were cut into gels, ligated into T-vectors, and single clones were picked for Sanger sequencing.

[0027] Sequencing results as follows Figure 2 As shown (only partial sequences of amplified from 5 species of Sage are displayed), the InDel molecular marker InDel-1 is present at position 81 of the amplified sequence of *Sage sylvatica*, while this fragment is not present in the amplified sequences of other easily confused *Sage* species.

[0028] II. HRM High-Resolution Thermal Melting Curve Method High-resolution melting analysis (HRM) is a gene analysis technique based on the differences in the thermostability of double-stranded DNA. It generates characteristic melting curves by real-time monitoring of the binding of fluorescent dyes to PCR products during the heating process, enabling the identification of single-base mutations, insertions or deletions, short repetitive sequences, and DNA methylation status. This technique uses saturated fluorescent dyes and specialized instruments to achieve precise temperature control and fluorescence acquisition, eliminating the need for probe labeling or post-PCR processing. It offers advantages such as closed-tube operation, low cost, and high throughput.

[0029] 1. Using the InDel-1F and InDel-1R primer pairs described above, as well as the genomic DNA of the five species of Sage, the DNA concentration and 260 / 280 ratio were determined. The results are shown in Table 1.

[0030] Table 1 Sample DNA concentration and 260 / 280 ratio 2. HRM is prepared using PCR reaction solution. Prepare the DNA template: First, dilute the above genomic DNA to 20 ng / uL with PCR-grade H2O according to the instructions of LightCycler® High Resolution Melting Master (manufacturer: Roche Pharmaceuticals Shanghai Co., Ltd., catalog number: 4909631001, purchased from Shanghai Rongweida Industrial Co., Ltd.). Then prepare the reaction solution according to the reaction system in Table 2.

[0031] Table 2 Reaction System 3. After preparation, add 15 µL of reaction solution to each tube, and then add 5 µL of genomic DNA template; seal with sealing film.

[0032] 4. Then place the reaction plate into a real-time quantitative PCR instrument (Roche, LightCycler® 96) and set the reaction program in Table 3 to carry out the reaction.

[0033] Table 3 Reaction Procedure HRM analysis results are as follows: Figure 3 As shown, the highest melting peak of *Salvia splendens* is 76.5℃, that of *Clary Salvia splendens* is 75.5℃, and that of *Salvia philippinensis*, *Salvia splendens*, and *Salvia gracilis* are 75.2℃ and 75℃, respectively. The melting curves clearly distinguish the five species of sage.

[0034] Example 2 Kits for identifying shady sage This embodiment provides a kit for identifying shady sage, including the primer pair InDel-1F and InDel-1R from Example 1.

[0035] Example 3 Methods for identifying shady sage I. PCR Amplification Method 1. Genomic DNA was extracted from the *Salvia* species to be tested using a modified CTAB method.

[0036] 2. Using the extracted genomic DNA as a template, PCR amplification was performed using InDel-1F and InDel-1R primers. The PCR reaction system was as follows: 2×PCR rTaq Mix (Takara): 10 μL, InDel-1F (10 μmol / L): 1.0 μL, InDel-1R (10 μmol / L): 1.0 μL, Genomic DNA (50 ng / μL): 2 μL, ddH2O: 6 μL, total 20 μL.

[0037] The amplification program was as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for 35 cycles; and extension at 72℃ for 10 min.

[0038] 3. The PCR products were detected by electrophoresis and Sanger sequencing. When the PCR product was a 245 bp band, the band contained the InDel molecular marker InDel-1, indicating that the tested plant was *Salvia splendens*. The nucleotide sequence of the 245 bp band is shown in SEQ ID NO: 4, and the InDel molecular marker InDel-1 is located at positions 124-148 of the sequence shown in SEQ ID NO: 4.

[0039] II. HRM High-Resolution Thermal Melting Curve Method 1. Genomic DNA was extracted from the *Salvia* species to be tested using a modified CTAB method.

[0040] 2. Using LightCycler® High Resolution Melting Master and primer pairs InDel-1F and InDel-1R, real-time quantitative PCR amplification of genomic DNA from the target *Salvia* species was performed. The specific steps are as follows: (1) Prepare DNA template: First, dilute the above genomic DNA to 20 ng / uL with PCR-grade H2O according to the LightCycler® High Resolution Melting Master instructions. Then prepare the reaction solution according to the reaction system in Table 2.

[0041] (2) After preparation, add 15 µL of reaction solution to each tube, and then add 5 µL of genomic DNA template; seal with sealing film.

[0042] (3) Then place the reaction plate into a real-time quantitative PCR instrument (Roche, LightCycler® 96) and set the reaction program in Table 3 to carry out the reaction.

[0043] 3. Perform HRM analysis on the real-time quantitative PCR products. If the highest melting peak of the genus *Salvia* to be tested is at 76.5℃, then the genus *Salvia* to be tested is *Salvia shadiens*.

[0044] Example 4 Identification of Unknown Sage Species In this embodiment, eight Sage seedlings were randomly selected and numbered S.sp-1 to S.sp-8. Genomic DNA was extracted from S.sp-1 to S.sp-8, and the genomic DNA was detected using the two methods described in Example 3.

[0045] 1. Results of PCR amplification The results are as follows Figure 4 As shown (only partial sequences of 8 sample amplifications are displayed), at position 81 of the sequence (shown in the red box), sample S.sp-2 contains the TAACTAAATTAAATAAAATTAAATA insertion sequence, which means it contains the InDel molecular marker InDel-1, while the other samples do not contain it. Therefore, sample S.sp-2 is *Salvia splendens*, and the others are not *Salvia splendens*.

[0046] 2. Results of HRM high-resolution thermal melting curve method The results are as follows Figure 5 As shown, the highest melting peak of sample S.sp-2 is at 76.5℃, while the highest melting peaks of the other samples are between 75 and 76℃. Three samples did not show any melting peaks. Therefore, based on the HRM curves, S.sp-2 is identified as *Salvia splendens*, while the others are not.

[0047] Plant variety identification showed that sample S.sp-2 was *Salvia splendens*, while the other samples were not *Salvia splendens*. This is consistent with the above results, indicating that the InDel molecular marker of the present invention can be used to identify *Salvia splendens*.

[0048] This invention successfully screened and obtained the InDel molecular marker for identifying *Salvia miltiorrhiza*, and developed specific primer pairs and kits based on this InDel marker. This invention utilizes the InDel site unique to the chloroplast genome of *Salvia miltiorrhiza* to effectively distinguish it from other *Salvia* varieties, providing a reliable molecular tool for germplasm resource conservation, variety identification, and landscaping applications of *Salvia miltiorrhiza*. The method of this invention is simple, rapid, and accurate, allowing for early identification at the seedling stage, reducing breeding workload, and ensuring the correctness of seedling varieties.

[0049] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An InDel molecular marker for identifying *Salvia splendens*, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:

1.

2. The application of the InDel molecular marker as described in claim 1 in the identification of seedling varieties of *Salvia splendens*, germplasm resource conservation, or molecular-assisted breeding.

3. A primer pair for obtaining the InDel molecular marker as described in claim 1, characterized in that: The primer pair is: InDel-1F:AAAGTAGGTTTTTTCGTTATGGGCC; InDel-1R:TGAAATCTTGCTTGGTCTTCACTG.

4. The primer pair according to claim 3, characterized in that: When the primer pair amplifies a 245 bp band, and the band contains the InDel molecular marker InDel-1, then the plant to be tested is *Salvia spp.*; the nucleotide sequence of the band is shown in SEQ ID NO:

4.

5. The application of the primer pair according to claim 3 in the identification of cultivars of *Salvia splendens* seedlings, germplasm resource conservation, or molecular-assisted breeding.

6. A kit for identifying *Salvia splendens*, characterized in that: The kit includes the primer pair as described in claim 3.

7. A method for identifying *Salvia splendens* using the kit described in claim 6, characterized in that: Includes the following steps: (1) Extract genomic DNA from the *Salvia* species to be tested; (2) Using the extracted genomic DNA as a template, PCR amplification was performed on it using the primer pairs InDel-1F and InDel-1R provided in the kit; (3) Perform Sanger sequencing on the PCR product. When the PCR product is a 245 bp band, the band contains the InDel molecular marker InDel-1. Then the plant to be tested is *Salvia spp.* 8. The method according to claim 7, characterized in that: The nucleotide sequence of the band is shown in SEQ ID NO:

4.

9. A method for identifying *Salvia splendens* using the kit described in claim 6, characterized in that: Includes the following steps: ① Extract genomic DNA from the *Salvia* species to be tested; ② Using the LightCycler® High Resolution Melting Master and the primer pairs in the kit, real-time quantitative PCR amplification of genomic DNA from the target Sage species was performed; ③ Perform HRM analysis on the real-time quantitative PCR products. If the highest melting peak of the genus *Salvia* to be tested is at 76.5℃, then the genus *Salvia* to be tested is *Salvia shadiensis*.

10. The application of the kit according to claim 6 in the identification of cultivars of *Salvia splendens* seedlings, germplasm resource conservation, or molecular-assisted breeding.

Images