A specific detection of LAMP primer composition of Gc_267155 gene of chartarum and application thereof

Abstract

The application discloses a specific detection method for Catenaria anguillarum. Globisporangium carolinianum ) Gc_267155 The application discloses a LAMP primer composition for a target gene and application thereof. Gc_ 267155 The nucleotide sequence of the gene is shown as SEQ ID NO. 26; the primer composition comprises a forward inner primer FIP shown as SEQ ID NO. 27, a reverse inner primer BIP shown as SEQ ID NO. 28, a forward outer primer F3 shown as SEQ ID NO. 29, a reverse outer primer B3 shown as SEQ ID NO. 30 and a reverse loop primer LB shown as SEQ ID NO. 31. Globisporangium carolinianum The target gene of Catenaria anguillarum Gc_267155 The LAMP primer composition designed based on the target gene can be used for rapidly detecting Catenaria anguillarum Globisporangium carolinianum The detection method has the advantages of high specificity, high accuracy, good sensitivity, simple operation, short time cost, visual observation of results and the like, and can identify Catenaria anguillarum when the DNA reaches 100 pg mu L ‑1 .

Description

Technical Field

[0001] This invention belongs to the field of biotechnology detection and relates to a specific detection card for *Geothermal Glomerulosa*. Gc_267155 LAMP primer composition for gene detection and its application. This application is a divisional application of patent application "A LAMP primer composition for specific detection of Geypericum cardiomycin and its application" (Patent No. 2026109858646). Background Technology

[0002] Carbocystis ( Globisporangium carolinianum ) is an important plant pathogen, belonging to the phylum Oomycota, family Pythiaceae, and genus Gynophora. Globisporangium One of the representative species, it was originally classified in the genus Pythium (Pythium). Pythium Different names for the same thing Pythium carolinianum . Globisporangium Carolinian It can infect a variety of flowers and crops, and is widely distributed throughout the world. It causes a variety of diseases such as damping-off, root rot, and seed rot in seedlings. It especially favors tender tissues such as newly germinated seeds, seedling roots, and hypocotyls, posing a particularly prominent threat to the greenhouse seedling industry and causing serious economic losses. Globisporangium carolinianum The colonies on CMA medium are a mixed pattern of radial and rose-shaped colonies. The hyphae are 1.8-6.9 μm in diameter. The sporangia are spherical, oval, or pear-shaped, terminal, occasionally intercalary or in chains, with papillae at the apex. The optimal growth temperature is 25-30℃. Globisporangium carolinianum Morphologically, it is easily confused with some species in the genera *Cyclocarya*, *Pythium*, and *Phytophthora*, requiring extensive and specialized experience in pathogen identification for differentiation. Furthermore, *Cyclocarya* exhibits high morphological diversity; some species share morphological characteristics, while others show significant intraspecific morphological variation. Moreover, some phenotypes are easily influenced by environmental conditions and nutrient substrates, leading to substantial changes. It is often difficult to determine the interrelationships between these complex and variable morphological features through visual observation alone.

[0003] Currently, in response to Globisporangium carolinianum There are relatively few detection technologies available. Traditional detection methods mainly utilize plate separation, based on... Globisporangium carolinianum Morphological identification is performed. This method is time-consuming and labor-intensive, requiring extensive and professional experience in pathogen identification and expensive precision instruments, which cannot meet the needs of field applications. Ordinary PCR technology requires precision temperature-controlled equipment and advanced and complex analytical instruments, and also demands a high level of proficiency and expertise from the operators. This method is time-consuming and not conducive to its widespread adoption at the grassroots level.

[0004] Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification technique developed in recent years. It has been widely applied in the detection and research of pathogens such as viruses, bacteria, parasites, and fungi. As an isothermal nucleic acid amplification technique, LAMP's greatest advantages lie in its rapid reaction speed, simple equipment, and easy-to-interpret results, making it particularly suitable for grassroots inspection and quarantine agencies and medical institutions. Currently, LAMP technology has not been widely used for detection in domestic and international settings. Globisporangium carolinianum Related reports.

[0005] In order to prevent and control Globisporangium carolinianum The spread of pathogens requires rapid and accurate detection. Discovering highly specific target genes is the core of all current detection technologies. Different target sequences exhibit varying specificities and sensitivity; results can differ significantly depending on the chosen target sequence and fragment size. The selection of target genes must ensure high conservation among different strains within a species, while exhibiting high interspecies variability.

[0006] In conclusion, discovering highly reliable and specific molecular detection targets and establishing sensitive and accurate detection technology systems based on these new targets is crucial for improving the detection capabilities of [specific targets]. Globisporangium carolinianum Rapid molecular detection research plays an important role in the early diagnosis of diseases caused by detection. Summary of the Invention

[0007] Purpose of the invention: The purpose of this invention is to provide a method for detecting *Geothermala spp.* (Geocystis jirovecii). Globisporangium Carolinian Primer compositions for different specific detection targets and their applications.

[0008] Technical solution: The specific detection card of the present invention for Geocystis ( Globisporangium carolinianum The LAMP primer composition, wherein the target detected by the LAMP primer composition is... Gc_s175398 The gene, the nucleotide sequence of which is shown in SEQ ID NO.1; the primer composition comprises: the forward inner primer FIP as shown in SEQ ID NO.2, the reverse inner primer BIP as shown in SEQ ID NO.3, the forward outer primer F3 as shown in SEQ ID NO.4, the reverse outer primer B3 as shown in SEQ ID NO.5, and the forward loop primer LF as shown in SEQ ID NO.6.

[0009] SEQ ID NO.1: gcgacacgcggcgccagttccgtctgctcgcgccaatgctgcacgaacagctcgggtgccgcgtgctgctcggtgacttgcgcggctttggcgactcgaccgactttgtatctctcaaaactggcaaccaaacgcacgcggc gtacacccccgaggcagtcgcagccgacgtcgtgcggctcatggacgcgctgcacgcgcagcaccccgcgagtgagttttgctgatcggcaactcgctcagcgccggtgcaatggtgcttgctgcgatggatgcggcagtcgcagc.

[0010] This invention is based on *Carya spp.* ( Globisporangium carolinianum )of Gc_s175398 Gene sequence, the sequence in Globisporangium carolinianum The evolutionary and conserved regions of the genome alternate. Using Blast software... Globisporangium carolinianum The genome sequence of [the fungus] was compared with the genome sequences of other fungi, and [the following was selected]. Globisporangium carolinianum A unique one-end sequence was used, and specific LAMP primers were designed. The LAMP reaction specifically recognizes six independent regions on the target sequence (Table 1) using four primers (FIP, BIP, F3, B3), demonstrating high specificity. Furthermore, the forward loop primer LF enhances the reaction rate, and together with the other four primers, enables the invention to proceed rapidly while ensuring reaction accuracy. Globisporangium carolinianum Detection. The LAMP reaction specifically recognizes six independent regions on the target sequence using four primers, which is more specific and sensitive than the two independent regions recognized by PCR primers.

[0011] The specific target detection card of the present invention is for *Geothermala* ( Globisporangium carolinianum The application of LAMP primer compositions in the preparation of kits.

[0012] The present invention is for detecting Carteriae ( Globisporangium carolinianum A LAMP kit containing the LAMP primer composition described above.

[0013] Furthermore, the kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, BstDNA polymerase, and hydroxynaphthol blue.

[0014] A LAMP primer composition and LAMP kit described above were used to detect *Geocereus kaempferi* (a type of fungus). Globisporangium Carolinian Applications in ).

[0015] The detection card of the present invention is for *Geothermala spp.* Globisporangium carolinianum The LAMP method for detecting *Geocystis carinii* includes the following steps: extracting DNA from the microorganism to be tested, using the DNA solution as a reaction template, performing a LAMP reaction with the primer combination described above, and then observing the color change of the amplification product. If the amplification product is sky blue, the test result is positive, indicating that *Geocystis carinii* is present in the microorganism to be tested. Globisporangium carolinianum If the amplification product is purple, the test result is negative, indicating that *Geocercospora carinii* is not present in the tested microorganism. Globisporangium Carolinian ).

[0016] Furthermore, the LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 Forward loop primer LF 0.8 μmol·L -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

[0017] Furthermore, the LAMP reaction procedure is as follows: reaction amplification at 63°C for 63 min.

[0018] The specific detection card of this invention is for *Geocytospora* ( Globisporangium carolinianum The LAMP primer composition, wherein the target of the LAMP primer composition is Gc_s1102605 The gene, the nucleotide sequence of which is shown in SEQ ID NO.7; the primer composition comprises: the forward inner primer FIP as shown in SEQ ID NO.8, the reverse inner primer BIP as shown in SEQ ID NO.9, the forward outer primer F3 as shown in SEQ ID NO.10, the reverse outer primer B3 as shown in SEQ ID NO.11, and the reverse loop primer LB as shown in SEQ ID NO.12.

[0019] SEQ ID NO.7: tgcgtcgatgcactcactctcatacttgctatcatatgctggtgtcctctgcagttctttgccgacgccgttgcgcagggcaagcgcgtgcgtctgatcttcatggtacgccactcgcaatgccgtcgctgcatcgtcgtgatgctgt cgacagcgtcgagcggatcgcactctgacgcagcaagccactcgcttgtttggccttgtagggcatgctgctgctgcgcgaccgcacaatgggcgagtacaacattgacgaagacggtgtgatccactgcgtcgtcacagaagcacgtacgt.

[0020] The specific target detection card of the present invention is for *Geothermala* ( Globisporangium carolinianum The application of LAMP primer compositions in the preparation of kits.

[0021] The present invention is for detecting Carteriae ( Globisporangium carolinianum A LAMP kit containing the LAMP primer composition described above.

[0022] Furthermore, the kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, BstDNA polymerase, and hydroxynaphthol blue.

[0023] A LAMP primer composition and LAMP kit described above were used to detect *Geocereus kaempferi*. (Pythium cedar) Applications in [the field].

[0024] The detection card of the present invention is for *Geothermala spp.* Globisporangium carolinianum The LAMP method for detecting *Geocystis carinii* includes the following steps: extracting DNA from the microorganism to be tested, using the DNA solution as a reaction template, performing a LAMP reaction with the primer combination described above, and then observing the color change of the amplification product. If the amplification product is sky blue, the test result is positive, indicating that *Geocystis carinii* is present in the microorganism to be tested. Globisporangium carolinianum If the amplification product is purple, the test result is negative, indicating that *Geocercospora carinii* is not present in the tested microorganism. Globisporangium Carolinian ).

[0025] Furthermore, the LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 Reverse loop primer LB 0.8 μmol·L -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

[0026] Furthermore, the LAMP reaction procedure is as follows: reaction amplification at 63°C for 60 min.

[0027] The specific detection card of this invention is for *Geocytospora* ( Globisporangium carolinianum The LAMP primer composition, wherein the target detected by the LAMP primer composition is... Gc_1197137 The gene, the nucleotide sequence of which is shown in SEQ ID NO. 13; the primer composition comprises: the forward inner primer FIP as shown in SEQ ID NO. 14, the reverse inner primer BIP as shown in SEQ ID NO. 15, the forward outer primer F3 as shown in SEQ ID NO. 16, the reverse outer primer B3 as shown in SEQ ID NO. 17, and the reverse loop primer LB as shown in SEQ ID NO. 18.

[0028] SEQ ID NO.13: caacgccgtcgacgcgacttctcgctgcgccatgctgctgcatcatcgcttgcatgctcgatcgcgtgctggctctgcatcatcgtgctcctacagtgcaacaacgtgcgcgcgagtctgttctcgccacaggacgtaccgggaccg cccgagaagatcttggtcacgtcggcaagcgactcggccctgcgcgtgcagctcttgccgcctgagcgtgtcaaagccgagggccaacggcgcgccggtgctcggttacaaagtcgaagtcgcgacgcgcgtgaacagcgtgcagacgttc.

[0029] This invention is based on *Carya spp.* ( Globisporangium carolinianum )of Gc_1197137 Gene sequence, which is found in *Geocystis carinii* ( Globisporangium carolinianumThe evolutionary and conserved regions of the genome alternate. Using Blast software, *Cartagena katerini* (… Globisporangium carolinianum The genome sequence of *Geocystis carinii* was compared with the genome sequences of other fungi, and *Geocystis carinii* was selected. Globisporangium Carolinian The LAMP reaction utilizes a unique one-end sequence and designs specific LAMP primers. The LAMP reaction specifically recognizes six independent regions on the target sequence using four primers (FIP, BIP, F3, B3) (Table 5), demonstrating high specificity. Furthermore, the reverse loop primer LB enhances the reaction rate, and together with the other four primers, enables rapid LAMP reaction on *Gastrocystis carinii* while ensuring reaction accuracy. Globisporangium carolinianum The LAMP reaction uses four primers to specifically recognize six independent regions on the target sequence, which is more specific and sensitive than the two independent regions recognized by PCR primers.

[0030] The specific target detection card of the present invention is for *Geothermala* ( Globisporangium carolinianum The application of LAMP primer compositions in the preparation of kits.

[0031] The present invention is for detecting Carteriae ( Globisporangium carolinianum A LAMP kit containing the LAMP primer composition described above.

[0032] Furthermore, the kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, BstDNA polymerase, and hydroxynaphthol blue.

[0033] A LAMP primer composition and LAMP kit described above were used to detect *Geocereus kaempferi* (a type of fungus). Globisporangium Carolinian Applications in ).

[0034] The detection card of the present invention is for *Geothermala spp.* Globisporangium carolinianum The LAMP method for detecting *Geocystis carinii* includes the following steps: extracting DNA from the microorganism to be tested, using the DNA solution as a reaction template, performing a LAMP reaction with the primer combination described above, and then observing the color change of the amplification product. If the amplification product is sky blue, the test result is positive, indicating that *Geocystis carinii* is present in the microorganism to be tested. Globisporangium carolinianum If the amplification product is purple, the test result is negative, indicating that *Geocercospora carinii* is not present in the tested microorganism. Globisporangium Carolinian ).

[0035] Furthermore, the LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹- 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L -1 Reverse loop primer LB, 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

[0036] Furthermore, the LAMP reaction procedure is as follows: reaction amplification at 63°C for 65 min.

[0037] The specific target detection card of the present invention is for *Geothermala* ( Globisporangium carolinianum The LAMP primer composition, wherein the target detected by the LAMP primer composition is... Gc_807637 The gene, the nucleotide sequence of which is shown in SEQ ID NO. 19; the primer composition comprises: the forward inner primer FIP as shown in SEQ ID NO. 20, the reverse inner primer BIP as shown in SEQ ID NO. 21, the forward outer primer F3 as shown in SEQ ID NO. 22, the reverse outer primer B3 as shown in SEQ ID NO. 23, the forward loop primer LF as shown in SEQ ID NO. 24, and the reverse loop primer LB as shown in SEQ ID NO. 25.

[0038] SEQ ID NO.19: atgaacgtgtacggcatcctccgcactgctgcgctcgcgaccgtgctgctcggcgctgcagctgatgcgcgtcgcgccggcaagacgctctgtgacgccgacccgacccacgcgccagcagtcgttaccgcatcgccaggtctcaag ggcagcgtcgtgccaactgtgcctgctgcgacgacaccagcgggcaaggtgcctgttcctgcgccagtcgcgccaattgcgaccgagcctgcaacgatcacggctgcacctggtgctggcaaggctccgacgacgactgcaccagcgaacacc.

[0039] This invention is based on *Carya spp.* ( Globisporangium carolinianum )of Gc_807637 Gene sequence, which is found in *Geocystis carinii* ( Globisporangium carolinianum The evolutionary and conserved regions of the genome alternate. Using Blast software, *Cartagena katerini* (… Globisporangium carolinianum The genome sequence of *Geocystis carinii* was compared with the genome sequences of other fungi, and *Geocystis carinii* was selected. Globisporangium Carolinian The LAMP reaction utilizes a unique one-end sequence and designs specific LAMP primers. The LAMP reaction specifically recognizes six independent regions on the target sequence (Table 7) using four primers (FIP, BIP, F3, B3), demonstrating high specificity. Furthermore, the loop primers LF and LB can improve the reaction rate, and together with the other four primers, enable the invention to proceed rapidly while ensuring reaction accuracy. Globisporangium carolinianum Detection. The LAMP reaction specifically recognizes six independent regions on the target sequence using four primers, which is more specific and sensitive than the two independent regions recognized by PCR primers.

[0040] The specific target detection card of the present invention is for *Geothermala* ( Globisporangium carolinianum The application of LAMP primer compositions in the preparation of kits.

[0041] The present invention is for detecting Carteriae ( Globisporangium carolinianum A LAMP kit containing the LAMP primer composition described above.

[0042] Furthermore, the kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, BstDNA polymerase, and hydroxynaphthol blue.

[0043] A LAMP primer composition and LAMP kit described above were used to detect *Geocereus kaempferi* (a type of fungus). Globisporangium Carolinian Applications in ).

[0044] The detection card of the present invention is for *Geothermala spp.* Globisporangium carolinianum The LAMP method for detecting *Geocystis carinii* includes the following steps: extracting DNA from the microorganism to be tested, using the DNA solution as a reaction template, performing a LAMP reaction with the primer combination described above, and then observing the color change of the amplification product. If the amplification product is sky blue, the test result is positive, indicating that *Geocystis carinii* is present in the microorganism to be tested. Globisporangium carolinianum If the amplification product is purple, the test result is negative, indicating that *Geocercospora carinii* is not present in the tested microorganism. Globisporangium Carolinian ).

[0045] Furthermore, the LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of loop primers LF and LB -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

[0046] Furthermore, the LAMP reaction procedure is as follows: reaction amplification at 63°C for 63 min.

[0047] The specific detection card of this invention is for *Geocytospora* ( Globisporangium carolinianum The LAMP primer composition, wherein the target of the LAMP primer composition is Gc_267155 The gene, the nucleotide sequence of which is shown in SEQ ID NO.26; the primer composition comprises: the forward inner primer FIP as shown in SEQ ID NO.27, the reverse inner primer BIP as shown in SEQ ID NO.28, the forward outer primer F3 as shown in SEQ ID NO.29, the reverse outer primer B3 as shown in SEQ ID NO.30, and the reverse loop primer LB as shown in SEQ ID NO.31.

[0048] SEQ ID NO.26: tcacaaccgacgtcgatgagctgctcgcacacagctttgacggcctcagctcgatcgtcgacgcaaacgacgtgcgcgcaaccgtcggcgcaacgac cgccgaccagcttgtgaagcacgccgactgcctattgagcatcacggccgacgttgacggcacagccagcagcacgagcaatgctaatggcaatggcgctgct.

[0049] This invention is based on Globisporangium carolinianum of Gc_267155 Gene sequence, the sequence in Globisporangium carolinianum The evolutionary and conserved regions of the genome alternate. Using Blast software... Cedar PythiumThe genome sequence of [the fungus] was compared with the genome sequences of other fungi, and [the following was selected]. Globisporangium Carolinian A unique one-end sequence was used, and specific LAMP primers were designed. The LAMP reaction specifically recognizes six independent regions on the target sequence using four primers (FIP, BIP, F3, B3) (Table 9), demonstrating high specificity. Furthermore, the reverse loop primer LB improves the reaction rate, and together with the other four primers, enables the invention to proceed rapidly while ensuring reaction accuracy. Globisporangium carolinianum Detection. The LAMP reaction specifically recognizes six independent regions on the target sequence using four primers, which is more specific and sensitive than the two independent regions recognized by PCR primers.

[0050] The specific target detection card of the present invention is for *Geothermala* ( Globisporangium carolinianum The application of LAMP primer compositions in the preparation of kits.

[0051] The present invention is for detecting Carteriae ( Globisporangium carolinianum A LAMP kit containing the LAMP primer composition described above.

[0052] Furthermore, the kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, BstDNA polymerase, and hydroxynaphthol blue.

[0053] A LAMP primer composition and LAMP kit described above were used to detect *Geocereus kaempferi* (a type of fungus). Globisporangium Carolinian Applications in ).

[0054] The detection card of the present invention is for *Geothermala spp.* Globisporangium carolinianum The LAMP method for detecting *Geocystis carinii* includes the following steps: extracting DNA from the microorganism to be tested, using the DNA solution as a reaction template, performing a LAMP reaction with the primer combination described above, and then observing the color change of the amplification product. If the amplification product is sky blue, the test result is positive, indicating that *Geocystis carinii* is present in the microorganism to be tested. Globisporangium carolinianum If the amplification product is purple, the test result is negative, indicating that *Geocercospora carinii* is not present in the tested microorganism. Globisporangium Carolinian ).

[0055] Furthermore, the LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 Reverse loop primer LB 0.8 μmol·L -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

[0056] Furthermore, the LAMP reaction procedure is as follows: reaction amplification at 63°C for 60 min.

[0057] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: The present invention screens out 5 specific detection cards for *Geothermala* ( Globisporangium carolinianum The target genes of ) are respectively Gc_ s175398 , Gc_s1102605 , Gc_1197137 , Gc_807637 and Gc_267155 LAMP primer compositions based on target genes can be used for rapid and efficient detection of *Geocystis carinii* (Katrophyta). Globisporangium carolinianum The detection method has the advantages of high specificity, high accuracy, good sensitivity, simple operation, and results that can be observed with the naked eye. When the DNA reaches 100 pg·μL... -1 It can identify Gastrocystis carinii in a short time, making it highly practical. Attached Figure Description

[0058] Figure 1 for Globisporangium carolinianum of Gc_s175398 Gene nucleic acid sequence and primer positions.

[0059] Figure 2 For testing Globisporangium carolinianum The results of specificity verification of LAMP primers, where 1-5 are different. Globisporangium carolinianum strains, 6-40 respectively G. acanthophoron、G. cluster, G. heterothallicum、G. huanghuaiense、G. intermediate、G. irregular G. middletonii, G. nodosum, G. orthogonon, G. paroecandrum, G. pengfuense, G. kicking, G. kicking, G. spinosum、G. shining、G. terrestrial、G. tenuihyphum, G. ultimum, G. ultimum, Pythium acanthicum, P. aphanidermatum, P. deliense、P. myriotylum、P. oligandrum、Phytopythium helicoides、Ph. harassing Phytophthora cactus、Ph. cinnamon、Ph. boehmeriae、Ph. Sojae、Botrytis cinerea、Colletotrichum gloeosporioides、Fusarium graminearum、Rhizopus arrhizus And ddH2O (negative control).

[0060] Figure 3 To detect Geocystis carbofurans ( Globisporangium carolinianum The results of sensitivity verification of the LAMP primer composition.

[0061] Figure 4 for Globisporangium carolinianum of Gc_s1102605 Gene nucleic acid sequence and primer positions.

[0062] Figure 5 To detect Geocystis carbofuran The results of the specificity verification of LAMP primers, where 1-5 are... Globisporangium carolinianum strains, 6-36 respectively G. acanthophoron、G. cluster, G. heterothallicum, G. intermedium, G. irregulare, G. middletonii, G. nodosum, G. orthogonon, G. paroecandrum, G. recalcitrans, G. recalcitrans, G. recalcitrans, G. spinosum, G. splendens, G. terrestris, G. tenuihyphum, G. ultimum, G. ultimum, Pythium acanthicum, P. aphanidermatum, P. myriotylum, P. oligandrum, Phytopythium helicoides, Phytophthora cactorum, Ph. cinnamomi, Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium verticillioides, Fusarium graminearum, Rhizopus arrhizus And ddH2O (negative control).

[0063] Figure 6 To detect Geocystis carbofurans ( Globisporangium carolinianum The results of sensitivity verification of the LAMP primer composition.

[0064] Figure 7 The results of LAMP detection on suspected diseased plants and negative controls using the LAMP primer composition in Example 5 are shown. 1 represents *Geocereus carinii* (positive control), 2-10 represent suspected diseased plants, and 11 represents ddH2O (negative control).

[0065] Figure 8 for Globisporangium carolinianum of Gc_1197137 Gene nucleic acid sequence and primer positions.

[0066] Figure 9 For testing Globisporangium carolinianum The results of specificity verification of LAMP primers, where 1-5 are different. Globisporangium carolinianum strains, 6-36 are respectively G. acanthophoron、G. cluster, G. heterothallicum、G. huanghuaiense、G. irregular, G. middleton G. nodosum, G. orthogonon, G. paroecandrum, G. pengfuense, G. recalcitrans, G. kicking, G. spinosum、G. shining、G. terrestrial、G. tenuihyphum、G. ultimum, G. ultimum, Pythium acanthicum, P. aphanidermatum, P. deliense, P. myriotylum、P. oligandrum、Phytopythium helicoides、Ph. vexans, Phytophthora cactorum, Ph. sojae, Botrytis cinerea, Fusarium graminearum, Rhizopus arrhizus And ddH2O (negative control).

[0067] Figure 10 To detect Geocystis carbofurans ( Globisporangium carolinianum The results of sensitivity verification of the LAMP primer composition.

[0068] Figure 11 To detect Geocystis carbofurans ( Globisporangium carolinianum ) Results of spore concentration verification of LAMP primer composition. 1-8 represent positive controls, containing 10 4 10 3 10 2The reactions of 1, 50, 10, and 0 oospores, and ddH2O (negative control).

[0069] Figure 12 for Globisporangium carolinianum of Gc_807637 Gene nucleic acid sequence and primer positions.

[0070] Figure 13 For testing Globisporangium carolinianum The results of specificity verification of LAMP primers, where 1-6 are different. Globisporangium carolinianum strains, 7-32 respectively G. acanthophoron、G. glomeratum, G. heterothallicum, G. irregulare, G. irregulare, G. middletonii, G. nodosum, G. orthogonon, G. paroecandrum, G. recalcitrans, G. recalcitrans, G. spinosum, G. splendens, G. ultimum, G. ultimum, Pythium acanthicum, P. aphanidermatum, P. oligandrum, Phytopythium helicoides, Ph. vexans, Phytophthora cactorum、Botrytis cinerea、Colletotrichum gloeosporioides、Fusarium graminearum, Rhizopus arrhizus And ddH2O (negative control).

[0071] Figure 14 To detect Geocystis carbofurans ( Globisporangium carolinianum The results of sensitivity verification of the LAMP primer composition.

[0072] Figure 15 for Globisporangium carolinianum of Gc_267155 Gene nucleic acid sequence and primer positions.

[0073] Figure 16 To detect different LAMP primer detection Globisporangium carolinianum Results of strain and negative control ddH2O.

[0074] Figure 17 To verify the specificity of the LAMP primers, 1 is the positive control, and 2-32 are respectively... G. acanthophoron、G. acanthophoron、G. cluster, G. cluster, G. heterothallicum、G. intermediate、G. irregular, G. irregular, G. middletonii, G. nodosum, G. orthogonon, G. paroecandrum, G. recalcitrans, G. recalcitrans, G. kicking, G. spinosum、G. shining、G. terrestrial、G. tenuihyphum、G. ultimum, G. ultimum, Pythium acanthicum, P. aphanidermatum, P. oligandrum, Phytopythium helicoides, Phytophtho racactorum, Ph. cinnamomi, Botrytis cinerea, Fusarium graminearum, Rhizopus arrhizus And ddH2O (negative control).

[0075] Figure 18 To detect Geocystis carbofurans ( Globisporangium carolinianum The results of sensitivity verification of the LAMP primer composition. Detailed Implementation

[0076] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0077] Screening and selection of detection targets for *Carya kagris*: This study utilized BLAST sequence search, sequence extraction, alignment, and analysis to mine a large-scale genomic database, thereby identifying detection targets for *Carya kagris*. Through whole-genome alignment, over 1000 *Carya kagris*-specific detection targets were obtained. From these over 1000 specific genes, a subset of genes (with sequences alternating between evolutionary and conserved regions in the *Carya kagris* genome) were selected as candidate genes. Specific primers were designed and screened, ultimately identifying 5 specific targets. 。

[0078] Example 1 Gc_s175398 For target detection Globisporangium carolinianum 1. Used for detection Globisporangium carolinianum The LAMP primer composition includes: forward inner primer FIP as shown in SEQ ID NO.2, reverse inner primer BIP as shown in SEQ ID NO.3, forward outer primer F3 as shown in SEQ ID NO.4, reverse outer primer B3 as shown in SEQ ID NO.5, and forward loop primer LF as shown in SEQ ID NO.6. (The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. See Table 1 for details.) Gc_s175398 Gene sequence and primer positions, such as Figure 1 As shown, Gc_s175398 The nucleotide sequence is shown in SEQ ID NO.1.

[0079] 2. Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of each of the circular primers LF -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 63 min, then observe the color change of the amplified product. A sky-blue color indicates a positive result. Globisporangium carolinianumIf the color is purple, it indicates a negative test result and that the virus does not exist. Globisporangium Carolinian .

[0080] 3. To verify the specificity of the LAMP method, five different strains were used. Globisporangium carolinianum The strain and 34 other oomycete and fungal strains, along with the negative control ddH2O, were used as test materials (Table 2). LAMP detection results showed that only... Globisporangium carolinianum The reaction tube solution used as the template showed a sky-blue positive reaction, while other tested microbial strains and the negative control all showed a purple negative reaction. Figure 2 ).

[0081] Table 1

[0082] Table 2

[0083]

[0084] Example 2 Globisporangium carolinianum Sensitivity of LAMP detection To determine the sensitivity of the LAMP detection method, the extracted... Globisporangium carolinianum The concentration of DNA was determined using a spectrophotometer and diluted sequentially in 10-fold increments to achieve a mass concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 2 μL of each sample was used as a template for the LAMP reaction. The reaction program was 63 °C for 63 min. HNB colorimetric results indicate that when... Globisporangium Carolinian The DNA concentration reached 100 pg·μL -1 The solution in the reaction tube will turn sky blue. Figure 3 ).

[0085] Example 3 Gc_s1102605 For the target detection card of Geocystis ( Globisporangium Carolinian ) 1. Used for detecting Geypericum carbofurans ( Globisporangium carolinianumThe LAMP primer composition is as follows: forward inner primer FIP as shown in SEQ ID NO.8, reverse inner primer BIP as shown in SEQ ID NO.9, forward outer primer F3 as shown in SEQ ID NO.10, reverse outer primer B3 as shown in SEQ ID NO.11, and reverse loop primer LB as shown in SEQ ID NO.12. (The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. See Table 3 for details.) Gc_ s1102605 Gene sequence and primer positions, such as Figure 4 As shown, Gc_s1102605 The nucleotide sequence is shown in SEQ ID NO.7.

[0086] 2. Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L -1 LB circular primer, 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L⁻¹ -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 60 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and *Geocystis carinii* is present; if it turns purple, the test result is negative and *Geocystis carinii* is not present.

[0087] 3. To verify the specificity of the LAMP method, five strains of *Geocystis carinii* were used. Globisporangium Carolinian As the test materials, strain ) and 30 other oomycetes and fungal strains were used (Table 4). LAMP detection results showed that only strains of oomycetes and fungal strains were used. Globisporangium carolinianum The reaction tube solution used as the template showed a sky-blue positive reaction, while other tested microbial strains and the negative control all showed a purple negative reaction. Figure 5 ).

[0088] Table 3

[0089] Table 4

[0090]

[0091] Example 4 Sensitivity of LAMP detection of Geypericum kaempferi To determine the sensitivity of the LAMP detection method, the concentration of the extracted *Geocereus kaempferi* DNA was measured using a spectrophotometer and diluted 10-fold to achieve a final concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 2 μL of each sample was used as a template for the LAMP reaction. The reaction program was 63℃ for 60 min. HNB colorimetric results indicate that when… Globisporangium carolinianum The DNA concentration reached 100 pg·μL -1 The solution in the reaction tube will turn sky blue. Figure 6 ).

[0092] Example 5 Globisporangium carolinianum LAMP field testing To verify the applicability of LAMP detection in the field, nine plant tissue samples suspected of being diseased were collected and brought back to the laboratory for DNA extraction. Standard *Geothermala spp.* DNA was used as a positive control, and ddH2O as a negative control. 2 μL of each sample was used as template for the LAMP reaction. The reaction program was 63℃ for 60 min. HNB colorimetric results showed that the solution in seven of the nine suspected diseased plant tissue samples turned sky blue, indicating the presence of *Geothermala spp.* Globisporangium carolinianum ( Figure 7 ).

[0093] Example 6 Gc_1197137 For target detection Globisporangium carolinianum 1. Used for detection Globisporangium carolinianum The LAMP primer composition includes: forward inner primer FIP as shown in SEQ ID NO. 14, reverse inner primer BIP as shown in SEQ ID NO. 15, forward outer primer F3 as shown in SEQ ID NO. 16, reverse outer primer B3 as shown in SEQ ID NO. 17, and reverse loop primer LB as shown in SEQ ID NO. 18. (The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. See Table 5 for details.) Gc_1197137 Gene sequence and primer positions, such as Figure 8 As shown, Gc_1197137 The nucleotide sequence is shown in SEQ ID NO.13.

[0094] 2. Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L -1 LB circular primer, 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L⁻¹ -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 65 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and *Geocystis carinii* is present; if it turns purple, the test result is negative and *Geocystis carinii* is not present.

[0095] 3. To verify the specificity of the LAMP method, five different strains of *Geoceros kaempferi* were used. Globisporangium Carolinian As test materials, strain 1 and 30 other oomycetes and fungal strains were used (Table 6). LAMP assay results showed that only strain 1 was positive for *Geocystis carinii*. Globisporangium carolinianum The reaction tube solution using the sample as a template showed a sky-blue positive reaction, while other tested microbial strains and the negative control all showed a purple negative reaction. Figure 9 ).

[0096] Table 5

[0097] Table 6

[0098]

[0099] Example 7 Globisporangium carolinianum Sensitivity of LAMP detection To determine the sensitivity of the LAMP detection method, the concentration of the extracted *Geocereus kaempferi* DNA was measured using a spectrophotometer and diluted 10-fold to achieve a final concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 Two μL of each sample was used as a template for LAMP reaction. The reaction program was 63℃ for 65 min. HNB colorimetric results indicated that when the DNA concentration of *Geocystis carinii* reached 100 pg·μL... -1 The solution in the reaction tube will turn sky blue. Figure 10 ).

[0100] Example 8 Globisporangium carolinianum Sensitivity of LAMP assay for spore concentration exist Globisporangium carolinianum Add 5 mL of sterile water to the culture plate, gently scrape off the oospores, count them using a hemocytometer, and adjust the concentration of the spore suspension to 10 oospores / μL. -1 The same steps are used to configure configurations containing 0, 50, and 10 respectively. 2 10 3 and 10 4 Prepare a suspension containing different numbers of oospores. Take six soil samples, each containing 0.25 g (dry weight) of sterile soil, and place them in separate 2 mL EP tubes. Add the prepared suspension containing different numbers of oospores and mix well. Extract DNA from the treated soil samples according to the instructions of the Soil DNA Extraction Kit (MO BIO) for LAMP detection, using standard... Globisporangium carolinianum Genomic DNA of the strain was used as a positive control, and sterile ddH2O was used as a negative control. 2 μL of each was used as template for LAMP reaction. The reaction program was 63℃ for 65 min. HNB colorimetric results indicate that when the spore concentration of *Geocystis carinii* reaches 10 spores / μL... -1 The solution in the reaction tube can also turn sky blue. Figure 11 ).

[0101] Example 9 Gc_807637 For target detection Globisporangium carolinianum 1. Used for detecting Geypericum carbofurans ( Globisporangium carolinianumThe LAMP primer composition is as follows: forward inner primer FIP as shown in SEQ ID NO.20, reverse inner primer BIP as shown in SEQ ID NO.21, forward outer primer F3 as shown in SEQ ID NO.22, reverse outer primer B3 as shown in SEQ ID NO.23, forward loop primer LF as shown in SEQ ID NO.24, and reverse loop primer LB as shown in SEQ ID NO.25. (The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. See Table 7 for details.) Gc_807637 Gene sequence and primer positions, such as Figure 12 As shown, Gc_807637 The nucleotide sequence is shown in SEQ ID NO.19.

[0102] 2. Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of loop primers LF and LB -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L⁻¹ -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 63 min, then observe the color change of the amplified product. A sky-blue color indicates a positive result. Globisporangium carolinianum If the color is purple, it indicates a negative test result and that the virus does not exist. Globisporangium Carolinian .

[0103] 3. To verify the specificity of the LAMP method, six different strains of *Geoceros kaempferi* were used. Globisporangium Carolinian As test materials, strain 1 and 25 other oomycetes and fungal strains were used (Table 8). LAMP assay results showed that only strain 1 was positive for *Geocystis carinii*. Globisporangium carolinianum The reaction tube solution using the sample as a template showed a sky-blue positive reaction, while other tested microbial strains and the negative control all showed a purple negative reaction. Figure 13 ).

[0104] Table 7

[0105] Table 8

[0106] Example 10 Globisporangium carolinianum Sensitivity of LAMP detection To determine the sensitivity of the LAMP detection method, the extracted... Globisporangium carolinianum Carteriae The concentration of DNA was determined using a spectrophotometer and diluted sequentially in 10-fold increments to achieve a mass concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 2 μL of each sample was used as a template for the LAMP reaction. The reaction program was 63 °C for 63 min. HNB colorimetric results indicate that when… Globisporangium carolinianum The DNA concentration reached 100 pg·μL -1 The solution in the reaction tube will turn sky blue. Figure 14 ).

[0107] Example 11: Detection using LAMP Globisporangium carolinianum 1. Used for detection Globisporangium carolinianum The LAMP primer composition includes: forward inner primer FIP as shown in SEQ ID NO.27, reverse inner primer BIP as shown in SEQ ID NO.28, forward outer primer F3 as shown in SEQ ID NO.29, reverse outer primer B3 as shown in SEQ ID NO.30, and reverse loop primer LB as shown in SEQ ID NO.31. (The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. See Table 9 for details.) Gc_267155 Gene sequence and primer positions, such as Figure 15 (As shown).

[0108] 2. Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 Reverse loop primer LB 0.8 μmol·L -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L⁻¹ -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 60 min, then observe the color change of the amplified product. A sky-blue color indicates a positive result. Globisporangium carolinianum If the color is purple, it indicates a negative test result and that the virus does not exist. Globisporangium Carolinian .

[0109] 3. To verify the specificity of the LAMP method, six different strains were used. Globisporangium carolinianum The strain and 30 other oomycete and fungal strains were used as test materials (Table 10). LAMP assay results showed that only the strains with the following characteristics were used. Globisporangium carolinianum The reaction tube solution used as the template showed a sky-blue positive reaction, while other tested microbial strains and the negative control all showed a purple negative reaction. Figure 16 and 17 ).

[0110] Table 9

[0111] Table 10

[0112]

[0113] Example 12 Globisporangium carolinianum Sensitivity of LAMP detection To determine the sensitivity of the LAMP detection method, the extracted... Globisporangium carolinianum The concentration of DNA was determined using a spectrophotometer and diluted sequentially in 10-fold increments to achieve a mass concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -12 μL of each sample was used as a template for the LAMP reaction. The reaction program was 63℃ for 60 min. HNB colorimetric results indicate that when… Globisporangium Carolinian The DNA concentration reached 100 pg·μL -1 The solution in the reaction tube will turn sky blue. Figure 18 ).

Claims

1. A specific detection card for Geocystis ( Globisporangium carolinianum ) Gc_267155 LAMP primer composition for genes, characterized in that, The Gc_267155 The nucleotide sequence of the gene is shown in SEQ ID NO.26; the primer composition includes: the forward inner primer FIP as shown in SEQ ID NO.27, the reverse inner primer BIP as shown in SEQ ID NO.28, the forward outer primer F3 as shown in SEQ ID NO.29, the reverse outer primer B3 as shown in SEQ ID NO.30, and the reverse loop primer LB as shown in SEQ ID NO.

31.

2. A specific detection card for *Geocytospora* as described in claim 1 (… Globisporangium carolinianum ) Gc_267155 Application of LAMP primer compositions for genes in the preparation of kits.

3. A method for detecting *Geocereus carbaryl* ( Globisporangium carolinianum The LAMP kit of ) is characterized in that, The kit contains the LAMP primer composition of claim 1.

4. The method for detecting *Geocystis carinii* according to claim 3 (… Globisporangium carolinianum The LAMP kit of ) is characterized in that, The kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, Bst DNA polymerase, and hydroxynaphthol blue.

5. A LAMP primer composition according to claim 1, or a LAMP kit according to any one of claims 3-4, for detecting *Geocystis aureus* (Kalocarya paliurus). Globisporangium carolinianum Applications in ).

6. A detection card for *Geocereus geysersis* ( Globisporangium carolinianum The LAMP method of ) is characterized by, Includes the following steps: DNA was extracted from the microorganism to be tested. The DNA solution was used as a reaction template, and a LAMP reaction was performed using the primer composition described in claim 1. The color change of the amplification product was then observed. If the amplification product was sky blue, the test result was positive, indicating that *Geocystis carinii* was present in the microorganism to be tested. Globisporangium carolinianum If the amplification product is purple, the test result is negative, indicating that *Geocercospora carinii* is not present in the tested microorganism. Globisporangium carolinianum ).

7. The *Carya spp.* according to claim 6 (… Globisporangium carolinianum The LAMP method of ) is characterized by, The LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ -1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 Forward loop primer LF 0.8 μmol·L -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

8. The *Geocystis carinii* according to claim 6 (… Globisporangium carolinianum The LAMP method of ) is characterized by, The LAMP reaction procedure is as follows: reaction amplification at 63℃ for 63 min.

Images