Primers and methods for SYBR Green real-time fluorescent PCR detection of Hobi-like viruses

Abstract

The application belongs to the technical field of biological detection, and provides a Hobi-like virus SYBR Green real-time fluorescent PCR detection primer and method.The sequence of the primer is as follows: an upstream primer: GGTGAAAGAGGGTCATTATG; and a downstream primer: TAGTGATGTAGCAGGTCTC.The minimum detection limit of the application is 1 copies / μL, and the coefficient of variation in the group is less than 1%.The Hobi-like virus SYBR Green real-time fluorescent PCR detection method established by the application has the characteristics of strong specificity, high sensitivity, good repeatability, short detection time and the like, and is suitable for pathogen detection and epidemiological investigation of the Hobi-like virus.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to primers and methods for the detection of Hobi-like viruses using SYBR Green real-time fluorescent PCR. Background Technology

[0002] Hobi-like viruses belong to the genus *Hemorrhagic viruses* of the family Flaviviridae. They are single-stranded positive-sense RNA viruses and representative of atypical hemorrhagic viruses, measuring 12.3 kb in size. They have one open reading frame flanked by uncoding regions (UTRs). In 2004, the first Hobi-like virus was isolated from fetal bovine serum imported from Brazil by a German laboratory. With the widespread use of fetal bovine serum, the virus has been detected or isolated from fetal bovine serum in the United States, Switzerland, Italy, Australia, China, and other countries. Hemorrhagic viruses are not strictly host-specific and can cross-infect cattle, sheep, pigs, goats, and other wild ruminants. Hobi-like viruses can cause reproductive disorders in pregnant ewes, resulting in abortion, stillbirth, or the birth of persistently infected newborn lambs.

[0003] Existing methods for detecting HoBi-like viruses can be divided into virus isolation and detection methods. HoBi-like viruses can be isolated by using bovine kidney cells as a reference for BVDV isolation. Alternatively, HoBi-like viruses in serum can be detected by using an ACE kit for BVDV, but this method cannot effectively distinguish them from BVDV.

[0004] Currently, there is a lack of rapid, convenient, and low-cost SYBR Green real-time fluorescent PCR detection methods for the untranslated regions (UTRs) of Hobi-like viruses. Research in this area can provide technical support for veterinary researchers and rapid diagnosis of diseases, and is of great significance for ensuring the biosafety of biological products. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a primer and method for the detection of Hobi-like viruses using SYBR Green real-time fluorescent PCR. This method is characterized by high specificity, high sensitivity, good repeatability, and short detection time.

[0006] To achieve the above objectives, the present invention provides the following technical solution: A primer for SYBR Green real-time fluorescent PCR detection of Hobi-like viruses, the sequence of which is as follows: Upstream primer: GGTGAAAGAGGGTCATTATG Downstream primer: TAGTGATGTAGCAGGTCTC.

[0007] A SYBR Green real-time fluorescent PCR detection kit for Hobi-like viruses, the kit comprising the aforementioned primers.

[0008] A non-diagnostic method for detecting Hobi-like viruses using SYBR Green real-time fluorescence PCR, the method comprising the following steps: (1) Take the sample to be tested; (2) The reaction system was prepared according to the following scheme: qPCR Mix (2X): 10 µL, upstream primer and downstream primer: 0.4~1.0 µL each, template: 5 µL, RNase Free dH2O to 20 µL; (3) The reaction was carried out according to the following scheme: pre-denaturation at 95℃ for 2 min; pre-denaturation at 95℃ for 15 s, annealing at 53~61℃ for 40 s, and repeated 40 times. The upstream and downstream primers are as described above, a SYBR Green real-time fluorescent PCR detection primer for Hobi-like viruses.

[0009] Preferably, the reaction system is as follows: qPCR Mix (2X): 10 µL, upstream primer and downstream primer: 0.6 µL each, template: 5 µL, and RNase-free dH2O to a final volume of 20 µL.

[0010] Preferably, the reaction conditions are: pre-denaturation at 95°C for 2 min; pre-denaturation at 95°C for 15 s, annealing at 55°C for 40 s, for 40 cycles.

[0011] The beneficial effects of this invention are: This invention exhibits good specificity, sensitivity, and repeatability, and shows no cross-reactivity with bovine viral diarrhea virus (BVDV), foot-and-mouth disease virus (FMDV), peste des petits ruminants virus (PPRV), porcine reproductive and respiratory syndrome virus (PRRSV), and classical swine fever virus (CSFV). The limit of detection of this invention is 1 copy / μL, and the intragroup coefficient of variation is less than 1%. The SYBR Green real-time fluorescent PCR detection method for HoBi-like viruses established in this invention has the characteristics of high specificity, high sensitivity, good repeatability, and short detection time, making it suitable for the etiological detection and epidemiological investigation of HoBi-like viruses. Attached Figure Description

[0012] Figure 1 The figure shows the experimental results for the primer pair in Example 1 of this invention; Figure 2 The figure shows the experimental results for primer pair H-F3 / H-R3; Figure 3 The figure shows the experimental results for primer pair H-F4 / H-R4; Figure 4 The figure shows the experimental results for primer pair H-F5 / H-R5; Figure 5 The figure shows the experimental results for primer pair H-F5 / H-R5; Figure 6 This is a graph showing the specific detection results of real-time fluorescent RT-PCR in Example 1 of the present invention; Figure 7 This is a graph showing the sensitivity detection results of real-time fluorescent RT-PCR in Example 1 of the present invention; Figure 8 This is a standard curve diagram of Embodiment 1 of the present invention. Detailed Implementation

[0013] The present invention will be specifically described below through embodiments. It should be noted that the following embodiments are only used to further illustrate the present invention and should not be construed as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above-described invention are still within the scope of protection of the present invention.

[0014] Example 1

[0015] 1.1 Main Materials and Reagents Foot-and-mouth disease virus type O-A bivalent inactivated vaccine and peste des petits ruminants (PPR) live vaccine were purchased from Tiankang Biotechnology Co., Ltd.; porcine reproductive and respiratory syndrome (PRRS) inactivated vaccine and classical swine fever (CSF) live vaccine were purchased from Wuhan Keqian Biotechnology Co., Ltd.; MooLeYou (bovine viral diarrhea and infectious rhinotracheitis bivalent inactivated vaccine) was purchased from Jinyu Baoling Biopharmaceutical Co., Ltd.; BeyoFast™ SYBR Green qPCR Mix (2X) was purchased from Beyotime Biotechnology Co., Ltd.; PrimeScript was purchased from [other products / products]. TM RT MasterMix (Perfect Real Time) and viral DNA / RNA extraction kits were purchased from TaKaRa Medical Engineering (Dalian) Co., Ltd., plasmid mini-extraction kits were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and PUC57-5' UTR recombinant plasmids were purchased from Wuhan Jinkairui Biotechnology Co., Ltd.

[0016] 1.2 Main Instruments Fluorescent PCR instrument (7500 Fast, ABI, USA); NanoDrop 2000 micro-volume nucleic acid and protein analyzer (Thermo Scientific, USA).

[0017] 1.3 Construction and Identification of Positive Plasmids Based on the 5' UTR gene sequence of the Hobi-like virus reference strain (KY091656), the corresponding gene sequence was synthesized by Wuhan Jinkairui Biotechnology Co., Ltd., cloned into the PUC57 vector, and the positive plasmid PUC57-5' UTR was constructed. After being confirmed by sequencing, the concentration was determined using an ultra-micro nucleic acid protein analyzer, and the copies were calculated according to the formula.

[0018] copies= , where C is the measured plasmid concentration, in ng / μL.

[0019] 1.4 Primer Design Based on PCR primer design principles, primers were designed targeting the 5' UTR gene sequence (KY091656) of Hobi-like virus. The primer sequences (5'-3') are as follows: H-F2: GGTGAAAGAGGGTCATTATG H-R2: TAGTGATGTAGCAGGTCTC The amplification length is 75 bp.

[0020] 1.5 Optimization of Real-Time Fluorescent PCR Reaction System and Conditions Following the BeyoFast™ SYBR Green qPCR Mix (2X) reagent instructions, a 20 µL reaction system was used. Using positive plasmids diluted to an appropriate concentration as templates, a matrix optimization method was employed to further investigate the effects of primer (10 µmol / L) dosages (0.4, 0.6, 0.8, 1.0 µL) and annealing temperatures (53, 55, 57, 59, 61℃) on amplification efficiency. Optimal reaction conditions were determined based on low Ct values, high fluorescence intensity, and clearly specific melting curves.

[0021] 1.6 Specificity Test The purchased vaccines underwent RNA extraction using a viral nucleic acid extraction kit. The extracted RNA (foot-and-mouth disease virus, bovine viral diarrhea virus, classical swine fever virus, porcine reproductive and respiratory syndrome virus, and peste des petits ruminants virus) was reverse transcribed and used as a template. ddH2O was used as a negative control. Amplification was performed using an optimized SYBR Green real-time fluorescent PCR method to evaluate the specificity of the detection method. 1.7 Sensitivity Test The prepared positive plasmid was serially diluted 10-fold, and a concentration of 10 was selected. 8 10 7 10 6 10 5 10 4 10 3 10 2 101 10 0 Using copies / μL as template and ddH2O as a negative control, amplification was performed using the optimized SYBR Green real-time fluorescence PCR method to determine the sensitivity of the detection method.

[0022] 1.8 Establishment of the Standard Curve The prepared positive plasmid was diluted, and 10 was selected. 8 10 7 10 6 10 5 10 4 Five gradients of positive plasmids (copies / μL) were used as templates for quantitative detection using the optimized SYBR Green real-time fluorescence PCR method. Each gradient was performed in triplicate, and standard curve analysis was performed using the built-in software of the fluorescence PCR instrument.

[0023] 1.9 Repeatability Test Selected positive plasmids after serial dilution (10 7 10 6 10 5 Fluorescent PCR was performed at three consecutive dilutions. Each dilution was set up with three replicates as within-group replicates, and ddH2O was used as a negative control. The experiment was repeated three times at different time points to assess between-group replicates. The mean Ct value, standard deviation, and coefficient of variation (CV) were calculated to evaluate the repeatability and stability of the established method.

[0024] 1.10 Sample Testing The established SYBR Green real-time fluorescence PCR method was used to test 192 sheep nasal swabs and 270 imported Dorper sheep serum samples retained in the laboratory to evaluate whether the method can be used for clinical testing.

[0025] Comparative Example 1 The primers (5'-3') designed for this comparative example are as follows: H-F3: GGTCATTATGTGGCTCTT H-R3: AAGTTAACGATTCCATGTG The amplification length is 109 bp.

[0026] The method described in Example 1 was used for detection, and it was found that amplification was not possible. Figure 2 .

[0027] Comparative Example 2 The primers (5'-3') designed for this comparative example are as follows: H-F4: GTCATTATGTGGCTCTTT H-R4: CAAAGTTTAACGATTCCAT The amplification length is 110 bp.

[0028] The method described in Example 1 was used for detection, and primer dimers were found to be generated. Figure 3 .

[0029] Comparative Example 3 The primers (5'-3') designed for this comparative example are as follows: H-F5: ACGGTGAATCTTAACTCAA H-R5: TAGTGATGTAGCAGGTCT The amplification length is 108 bp.

[0030] The method described in Example 1 was used for detection, and low amplification efficiency was found. Figure 4 .

[0031] Comparative Example 4 The primers (5'-3') designed for this comparative example are as follows: H-F6: GGGAGTACAGCCTGATAG H-R6: AGTTCAAAGTTTAACGATTCC The amplification length is 96 bp.

[0032] When the method of Example 1 was used for detection, nonspecific amplification was found, see... Figure 5 .

[0033] Experimental Example 1. Determination of positive plasmid DNA concentration and conversion of copies Plasmids with positive sequencing alignment results were selected and extracted using a plasmid mini-extraction kit. The recombinant plasmid concentration was measured to be 100 ng / μL using an ultra-micro nucleic acid and protein analyzer, and then converted to 3 × 10⁻⁶ ng / μL according to the formula. 10 copies / μL.

[0034] 2 Optimization results of real-time fluorescence reaction conditions By comparing the amplification efficiency and specificity of the five primer pairs corresponding to Example 1 and Comparative Examples 1 to 4, it was ultimately found that the H-F2 / H-R2 primer pair of Example 1 was the optimal primer (see Example 1). Figure 1 Based on this, the reaction system and procedure were further optimized. Referencing BeyoFast... TMBased on the SYBR Green qPCR Mix (2X) reagent instructions and optimization results, the optimal reaction system was determined to be 20 µL: 10 µL qPCR Mix (2X), 0.6 µL each of forward and reverse primers (10 µmol / L), 5 µL template, and RNase-free dH2O to bring the total to 20 µL. The optimized reaction program was: 95℃ pre-denaturation for 2 min; [95℃ denaturation for 15 s, 55℃ annealing for 40 s (fluorescence acquisition)] × 40 cycles.

[0035] 3. Specificity test results The optimized real-time fluorescent RT-PCR method described above was used to amplify the extracted RNA (foot-and-mouth disease virus, bovine viral diarrhea virus, classical swine fever virus, porcine reproductive and respiratory syndrome virus, peste des petits ruminants virus, and bovine viral diarrhea virus). The results showed that this method only produced specific amplification and melting curves for Hobi-like virus-positive plasmid templates. Figure 6 The method showed good specificity, while no amplification curves were observed in other viral nucleic acids and negative controls.

[0036] 4. Sensitivity test results The recombinant plasmid was serially diluted 10-fold to prepare concentrations ranging from 10 to 10. 8 ~1×10 0 The standard solution was analyzed using copies / μL and detected by an optimized fluorescent PCR method. The results showed ( Figure 7 The optimized detection method has a limit of detection of 1 copies / μL for the positive plasmid PUC57-5' UTR (Table 1), indicating that the fluorescent PCR method established in this invention has high sensitivity.

[0037] Table 1. Dilutions Ct value

[0038] 5. Establishment of the standard curve Select 10 8 10 7 10 6 10 5 10 4 Five dilutions of positive plasmids (copies / μL) were used as templates for quantitative detection using the optimized SYBR Green real-time fluorescence PCR method. Each gradient was performed in triplicate. Standard curve analysis was performed using the built-in software of the fluorescence PCR instrument. The established standard curve (…) Figure 8 ), correlation coefficient R 2The value is 0.999, the slope of the curve is -3.105, the intercept is 30.099, and the equation of the line is y = -3.105x + 30.099.

[0039] 6. Repeatability test results The experimental results show (Table 2) that for each concentration of standard (10 7 10 6 10 5 The standard deviation of the within-group tests was between 0.09 and 0.13, and the coefficient of variation was between 0.07% and 0.50%. The standard deviation of the between-group tests was between 0.09 and 0.13, and the coefficient of variation was between 0.12% and 0.54%, indicating that the established method has good stability and repeatability.

[0040] Table 2 Concentrations Ct value

[0041] 7. Sample Testing The established SYBR Green real-time fluorescent PCR method was used to test 192 sheep nasal swabs, whole blood samples, and 270 imported Dorper sheep serum samples retained in the laboratory. Three nasal swab samples tested positive, while the rest did not detect HoBi-like virus. However, whether this indicates a small-scale transmission of HoBi-like virus in Guizhou Province requires further assessment based on subsequent epidemiological investigations and an expansion of the sample collection scope.

[0042] 8. Discussion The main clinical symptoms of HoBi-like virus infection are diarrhea, respiratory diseases, reproductive disorders in ewes, and persistent infection in newborn animals. Currently, there are reports of HoBi-like virus infection in sheep and goats in my country. With the development of the sheep industry, due to improper introduction of breeding stock, HoBi-like virus has spread rapidly in sheep farms, causing economic losses to the sheep farming industry.

[0043] Currently, detection methods for HoBi-like viruses mainly include etiological detection, serological detection, and molecular biological detection. Etiological detection involves virus isolation and culture, biological characteristic analysis, and electron microscopy observation, but this is time-consuming. The most commonly used serological detection method is enzyme-linked immunosorbent assay (ELISA); however, there are currently no commercially available ELISA kits.

[0044] This invention establishes a SYBR Green real-time fluorescent RT-PCR detection method targeting the 5' UTR gene of Hobi-like viruses. This method exhibits excellent specificity, sensitivity, and reproducibility, showing no cross-reactivity with bovine viral diarrhea virus, foot-and-mouth disease virus, peste des petits ruminants virus, porcine reproductive and respiratory syndrome virus, and classical swine fever virus, with the intragroup coefficient of variation remaining below 1%. Particularly noteworthy is its detection limit as low as 1 copy / μL, and SYBR Green eliminates the need for expensive probe design, compared to existing one-step quantitative PCR techniques (with a detection limit of 10). 3 (copies / μL), the method proposed in this invention has significant advantages in the field of disease diagnosis.

Claims

1. A SYBR Green real-time fluorescent PCR detection primer for Hobi-like viruses, characterized in that, The sequence of the primers is as follows: Upstream primer: GGTGAAAGAGGGTCATTATG Downstream primer: TAGTGATGTAGCAGGTCTC.

2. A SYBR Green real-time fluorescent PCR detection kit for Hobi-like viruses, characterized in that, The kit contains the primers as described in claim 1.

3. A non-diagnostic method for detecting Hobi-like viruses using SYBR Green real-time fluorescent PCR, characterized in that, The method includes the following steps: (1) Take the sample to be tested; (2) The reaction system was prepared according to the following scheme: qPCR Mix (2X): 10 µL, upstream primer and downstream primer: 0.4~1.0 µL each, template: 5 µL, RNase Free dH2O to 20 µL; (3) The reaction was carried out according to the following scheme: pre-denaturation at 95℃ for 2 min; pre-denaturation at 95℃ for 15 s, annealing at 53~61℃ for 40 s, and repeated 40 times. The upstream and downstream primers are as described in claim 1, which are SYBR Green real-time fluorescent PCR detection primers for Hobi-like viruses.

4. The non-diagnostic Hobi-like virus SYBR Green real-time fluorescent PCR detection method according to claim 3, characterized in that, The reaction system was as follows: qPCR Mix (2X): 10 µL, upstream and downstream primers: 0.6 µL each, template: 5 µL, and RNase-free dH2O to a final volume of 20 µL.

5. The non-diagnostic Hobi-like virus SYBR Green real-time fluorescence PCR detection method according to claim 3, characterized in that, The reaction conditions were: 95℃ pre-denaturation for 2 min; 95℃ pre-denaturation for 15 s, 55℃ annealing for 40 s, for 40 cycles.

Images