Nanopore single-molecule signal amplification system for nucleic acid cascade transduction and application thereof

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to a nanopore single-molecule signal amplification system for nucleic acid cascade transduction and application thereof. The present application constructs a solid-phase nanopore signal amplification system and method which has good universality, high modularization, strong anti-interference ability and high selectivity. The system realizes indirect detection of small-size and low-abundance nucleic acid targets and specific and high-sensitivity differentiation of different targets by modular integration of specific recognition, SDA concentration amplification, HCR / G-HCR structure amplification and solid-phase nanopore detection.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a nanoporous single-molecule signal sensitization system based on nucleic acid cascade transduction and its applications. Background Technology

[0002] Nanopores are tiny channels with pore sizes at the nanoscale, enabling real-time monitoring of ionic current changes generated as analytes pass through them at the single-molecule level. The basic principle of nanopore detection is to apply a constant voltage across a nanoscale pore, generating a stable ionic current at the pore tip. When the analyte is directed through the pore under voltage, due to volume exclusion effects, it momentarily occupies some of the ion positions within the pore, thus altering the ionic current. Each characteristic current change caused by a single analyte entering, passing through, or leaving the nanopore typically constitutes an independent single-molecule detection event. By analyzing the blocking current, blocking time, current shape, signal frequency, and current integral of this "event," information such as its size, structure, charge, and pore affinity can be obtained. Compared to traditional molecular detection methods, nanopores offer advantages such as single-molecule detection, real-time detection, no need for fluorescence or other exogenous labeling, no need for complex separation operations, and direct acquisition of dynamic information about the molecular passage process. Meanwhile, based on single-molecule events for data acquisition and analysis, nanopore technology has high detection throughput and flexible data analysis capabilities, and has good application prospects in fields such as nucleic acid detection, biomolecular characterization, and single-molecule analysis.

[0003] Indirect transduction strategies can transform weak target molecule signals into more significant nanopore signal events. The basic process typically includes three steps: target molecule recognition, signal transduction, and nanopore detection. When the target molecule is present, probes, signal molecules, or nanostructures that specifically react with it are introduced, transducing the target molecule into a specific nucleic acid structure. During voltage-driven perforation, this generates a significant change in ionic current, thereby indirectly achieving the detection of the target molecule.

[0004] Despite the broad application prospects of nanopore technology, certain technical limitations remain in practical detection and application. The magnitude of ion current changes and the duration of pore perforation caused by target molecules passing through nanopores are fundamental characteristic parameters for characterizing molecular pore perforation events. However, for short-chain nucleic acids and small nucleic acid molecules, due to their small size, the ion current blockage caused during pore perforation is weak, and the residence time is short. Furthermore, for low-abundance targets, the signal is easily submerged by background noise, making it impossible to achieve high signal-to-noise ratio resolution. Existing sensitization strategies are usually designed for specific target molecules, requiring the redesign of corresponding recognition, transduction, and signal amplification modules based on the sequence, structure, and recognition mechanism of different target molecules. The lack of a unified modular design approach across different detection targets makes it difficult to directly apply the same sensitization system to different types or sequences of target nucleic acids, resulting in long development cycles, significant design and optimization workloads, and limited versatility.

[0005] Therefore, it is particularly necessary to develop a solid-phase nanopore signal enhancement system or method that is versatile, highly modular, has strong anti-interference ability, and high selectivity. Summary of the Invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide a single-molecule signal enhancement system for nucleic acid cascade transduction in nanopores and its application.

[0007] This invention provides a nanopore single-molecule signal enhancement system, which includes: a detection target M, a probe M1, a probe M2, and four hairpin nucleic acid strands; The detection target M is a nucleic acid fragment derived from virus X; virus X includes: influenza A virus and / or novel coronavirus; The probes M1 and M2 are used to detect the detection target M and are partially inversely complementary to the 3' and 5' nucleotides of the detection target M, respectively. The nucleotide sequences of the four hairpin nucleic acid chains are shown in SEQ ID NO:9~SEQ ID NO:12.

[0008] The nucleotide sequence of the detection target M derived from the influenza A virus is shown in SEQ ID NO:1; The nucleotide sequence of the detection target M derived from the novel coronavirus is shown in SEQ ID NO:13.

[0009] Furthermore, the nucleotide sequences of probes M1 and M2 for detecting the detection target M derived from the influenza A virus are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively; The nucleotide sequences of probes M1 and M2 for detecting the target M derived from the novel coronavirus are shown in SEQ ID NO:14 and SEQ ID NO:15, respectively.

[0010] The nanopore single-molecule signal enhancement system of the present invention further includes: a detection target N, a probe N1, a probe N2, and two hairpin nucleic acid strands; The detection target N is a nucleic acid fragment derived from virus B; virus B includes: influenza A virus and / or influenza B virus; The probes N1 and N2 are used to detect the detection target N and are partially inversely complementary to the 3' and 5' nucleotides of the detection target N, respectively. The nucleotide sequences of the two hairpin nucleic acid chains are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

[0011] Furthermore, the viruses include: influenza A virus and / or influenza B virus; The nucleotide sequence of the detection target N derived from the influenza A virus is shown in SEQ ID NO:4; The nucleotide sequence of the detection target N derived from the influenza B virus is shown in SEQ ID NO:16.

[0012] Furthermore, the nucleotide sequences of probes N1 and N2 for detecting the detection target N derived from the influenza A virus are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. The nucleotide sequences of probes N1 and N2 for detecting the detection target N derived from the influenza B virus are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively.

[0013] In a specific embodiment of the present invention, the nanopore single-molecule signal sensitization system is designed to simultaneously perform HCR and G-HCR reactions against two targets for the same virus. Specifically, the nanopore single-molecule signal sensitization system for influenza A virus (a combination of G-HCR and traditional HCR) includes: detection target M, probe M1, probe M2, 4 G-HCR hairpin nucleic acid strands, detection target N, probe N1, probe N2, and 2 HCR hairpin nucleic acid strands. The nucleotide sequence of the detection target M is shown in SEQ ID NO:1; The nucleotide sequences of probe M1 and probe M2 are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively; The nucleotide sequences of the four G-HCR hairpin nucleic acid chains are shown in SEQ ID NO:9 to SEQ ID NO:12, respectively; The nucleotide sequence of the detection target N is shown in SEQ ID NO:4; The nucleotide sequences of probe N1 and probe N2 are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; The nucleotide sequences of the two HCR hairpin nucleic acid chains are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

[0014] Through the specific experimental design described above, H1N1, after transduction, only produces I2, which induces GHCR. The presence of the H1N1 target is confirmed by detecting the GHCR signal through nanopores. Similarly, H5N1, after transduction, only produces I1, which induces conventional GHCR. The presence of the H5N1 target is confirmed by detecting the GHCR signal through nanopores. When Probe A1 and Probe A2, and Probe B1 and Probe B2 are added simultaneously during H1N1 detection, Probe B1 and Probe B2 do not interfere with H1N1 recognition and subsequent reactions due to their specificity. Simultaneous detection of both targets, with all probes and targets added to the same tube at the same time, does not affect each other, improving detection specificity and the time required for virus typing. Both H1N1 and H5N1 can be detected simultaneously in a single test.

[0015] The nanopore single-molecule signal enhancement system (G-HCR) targeting the novel coronavirus includes: detection target M, probe M1, probe M2, and four G-HCR hairpin nucleic acid strands; and detection target N, probe N1, probe N2, and two HCR hairpin nucleic acid strands. The nucleotide sequence of the detection target M is shown in SEQ ID NO:13; The nucleotide sequences of probe M1 and probe M2 are shown in SEQ ID NO:14 and SEQ ID NO:15, respectively; The nucleotide sequences of the four G-HCR hairpin nucleic acid chains are shown in SEQ ID NO:9 to SEQ ID NO:12, respectively; The nanopore single-molecule signal sensitization system (traditional HCR) for influenza B virus includes: detection target N, probe N1, probe N2, and two HCR hairpin nucleic acid strands; The nucleotide sequence of the detection target N is shown in SEQ ID NO:16; The nucleotide sequences of probe N1 and probe N2 are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively; The nucleotide sequences of the two HCR hairpin nucleic acid chains are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

[0016] In this invention, the statement that "G-HCR and conventional HCR show significant differences in current drop and perforation time" aims to clarify that these two products generate different signals when passing through nanopores due to their different structures. H1N1 transduces to generate an initiator that initiates G-HCR, while H5N1 transduces to generate an initiator that initiates conventional HCR. Through this design, different targets generate different initiators via transduction, initiating corresponding HCR products, thus allowing for target differentiation through nanopores.

[0017] This invention provides a reagent for cascade amplification of virus detection signals, including the nanopore single-molecule signal sensitization system described in this invention.

[0018] The reagents described in this invention may also include reagents for preserving the nanoporous single-molecule signal sensitization system; specifically, they include buffer solutions, stabilizers, preservatives, antioxidants, etc., which are not limited in this invention.

[0019] This invention provides one of the following applications in preparing a kit for cascade amplification of virus detection signals, as shown in A) to B): A) The nanopore single-molecule signal enhancement system described in this invention; B) The reagents described in this invention.

[0020] The present invention provides a kit for cascade amplification of virus detection signals, which includes at least one of the nanopore single-molecule signal sensitization system described in the present invention or the reagents described in the present invention, and further includes enzymes, dNTPs and / or reaction buffers. The enzymes include DNA polymerase and endonuclease.

[0021] Furthermore, the DNA polymerase is Klenow Fragment; The endonuclease is Nt.BbvCI; The detection target M or N in this invention is specifically a nucleic acid or a small molecule. The nucleic acid can be artificially synthesized, derived from amplification products, or extracted from actual samples. It is used to detect specific targets, achieving cascaded signal amplification during the detection process, thus enhancing detection sensitivity and specificity. This invention's detection is based on an "indirect transduction strategy," specifically recognizing target molecules through 3WJ structure-specific identification and utilizing the SDA reaction to transduce the target molecule into an HCR initiator, achieving indirect transduction and concentration amplification of the target molecule. Specifically, the detection target M or N, as the target substance to be identified and detected, can be either a nucleic acid or a small molecule to meet the needs of different detection scenarios. For nucleic acid targets, their acquisition source is not particularly limited; they can originate from artificial synthesis, amplification products, or extraction from actual samples, ensuring the availability and applicability of the detection target in practical applications. During the detection process, the aforementioned detection target can achieve cascaded signal amplification, effectively enhancing the originally weak detection signal. This facilitates the detection process and result interpretation, significantly improving the sensitivity and specificity of the detection. The detection strategy employed in this invention is an "indirect transduction strategy," the core of which lies in the specific recognition of target molecules through the 3WJ structure and the transduction of target molecules into HCR initiators using the SDA reaction. This achieves indirect transduction and concentration amplification of the target molecules, further enhancing the overall performance of the detection system.

[0022] In this invention, the detection target (detection target M and / or detection target N) preferably has a GC ratio of 45% to 55%, and the GC ratio of the first 16 bases and the last 17 bases must also meet this ratio. The detection target itself does not contain dimers. The detection target is conserved.

[0023] This invention utilizes HCR and G-HCR to amplify the structure of target molecules. By generating significant signals through nanopores, it can distinguish between two targets detected in a unified system, saving sample detection time and simplifying the detection process.

[0024] This invention combines the amplification of SDA initiator concentration with the amplification of HCR structure to establish a cascade sensitization mechanism of "concentration amplification + structure amplification".

[0025] This invention only requires adjusting the 3WJ recognition probe for different types, sequences, and lengths of target nucleic acid molecules, without having to rebuild the entire detection system. It has good versatility and modularity, and high universality.

[0026] The beneficial effects of this invention are: This invention constructs a solid-phase nanopore signal enhancement system and method that is versatile, highly modular, anti-interference, and highly selective. By modularly integrating specific recognition, SDA concentration amplification, HCR / G-HCR structure amplification, and solid-phase nanopore detection, indirect detection of small-sized, low-abundance nucleic acid targets and differentiation of different targets are achieved. Attached Figure Description

[0027] Figure 1 This diagram illustrates the composition and working principle of a nanoporous single-molecule signal sensitization system based on nucleic acid cascade transduction. A represents the overall working principle and reaction flow of the system; B represents the specific target recognition and SDA reaction triggering process; C represents the Nt.BbvcI cleavage site; and D represents the HCR (traditional) / G-HCR reaction flow. Figure 2 The diagram shows scatter plots of single target responses; where A is the scatter plot of the control group without target H1N1; B is the scatter plot of G-HCR generated by input target H1N1 through transduction passing through the nanopore; C is the scatter plot of the control group without target H5N1; and D is the scatter plot of conventional HCR generated by input target H5N1 through transduction passing through the nanopore. Figure 3 The baseline current amplitude changes in the corresponding experimental groups are shown in Figure 2; where A represents the G-HCR current amplitude change and B represents the current drop amplitude change in the conventional HCR. Figure 4 The nanoporous scatter plots show the two HCR products generated by adding H1N1 and H5N1 to the same reaction system via transduction (H1N1 fixation results in G-HCR reaction, while H5N1 fixation results in conventional HCR reaction); where A is the scatter plot of the control group without H1N1 and H5N1; B is the nanoporous scatter plot of the two HCR products generated by adding H1N1 and H5N1 to the same reaction system via transduction. Figure 5 Box plots and bar charts showing the different presence of targets H1N1 and H5N1; where A is a box plot showing the absence of both H1N1 and H5N1, the presence of only H1N1, the presence of only H5N1, and the simultaneous presence of both targets; and B is a bar chart showing the absence of both H1N1 and H5N1, the presence of only H1N1, the presence of only H5N1, and the simultaneous presence of both targets. Figure 6 The diagram shows scatter plots of single target responses; where A is a scatter plot of the control group without SARS-CoV-2, B is a scatter plot of the nanopores that produce the corresponding G-HCR after transduction with SARS-CoV-2 as the input target, C is a scatter plot of the control group without FluB, and D is a scatter plot of the nanopores that produce the corresponding conventional HCR after transduction with FluB as the input target. Figure 7 Scatter plots, box plots, and bar charts showing the presence of the targets SARS-CoV-2 and FluB at different levels; where A is a scatter plot of the control group without SARS-CoV-2 and FluB; B is a scatter plot of nanopores that produce two HCR products after adding SARS-CoV-2 and FluB to the same reaction system via transduction; C is a box plot of the absence of SARS-CoV-2 and FluB (NC), the presence of only SARS-CoV-2 (SARS-CoV-2), the presence of only FluB (FluB), and the simultaneous presence of FluBSARS-CoV-2 and FluB (FluBSARS-CoV-2 and FluB); D is a bar chart of the absence of SARS-CoV-2 and FluB (NC), the presence of only SARS-CoV-2 (SARS-CoV-2), the presence of only FluB (FluB), and the simultaneous presence of FluBSARS-CoV-2 and FluB (FluBSARS-CoV-2 and FluB). Figure 8 The results show the optimization of the hybridization base number of the two probes; Figure A shows the HCR initiators generated by each group of probes after optimization; Figure B shows the generated HCR products. Detailed Implementation

[0028] This invention provides a single-molecule signal enhancement system for nanopores via nucleic acid cascade transduction and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately alter and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0029] The terminology used in the embodiments of this application is for the purpose of describing specific embodiments only and is not intended to limit this application. The term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " in "and / or" indicates that the preceding and following related objects have an "and" relationship.

[0030] The term "at least one" refers to one or more, while "more" refers to two or more. "At least one" or similar expressions refer to any combination of these items, including any combination of single items or multiple items. For example, "at least one of a, b, or c," or "at least one of a, b, and c," can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can each be a single item or multiple items.

[0031] The singular forms “a,” “the,” and “the” used in this application are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0032] The terms “comprising,” “having,” or “containing,” including their grammatical synonyms, should generally be understood as open-ended and non-restrictive, e.g., not excluding other unstated elements or steps unless specifically stated otherwise or understood from the context. Any and all instances or exemplary language used herein, such as “e.g.” or “comprising,” are intended merely to better illustrate the application; no language in this specification should be construed as indicating that any unclaimed element is essential to the practice of this application.

[0033] Furthermore, the numerical ranges and parameters used to define this application are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any numerical value inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise explicitly stated, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately." Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0034] The letters M and N are used only to distinguish between G-HCR-based and traditional HCR detection targets, and M1, M2, N1, N2, etc., are used to distinguish between detection probes corresponding to G-HCR-based and traditional HCR detection targets, and do not represent any other practical meaning. Specifically, the letters M and N are used as identifiers in this application solely to distinguish between G-HCR-based and traditional HCR detection targets, so as to clearly indicate the corresponding target categories in the description and claims. Similarly, the serial numbers M1, M2, N1, N2, etc., are further used to distinguish between various detection probes corresponding to G-HCR-based and traditional HCR detection targets, so that the probes corresponding to different targets can be clearly and one-to-one identified. It should be noted that the above letters and serial numbers themselves do not carry any structural, functional, sequential, or performance limitations, nor do they imply any specific order or superiority / inferiority. They are merely convenient means of naming and reference and should not constitute any limitation on the understanding of the technical solution of this application.

[0035] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0036] In the sequence list, replace u with t; The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments: Example 1: Overview of the Solid-Phase Nanopore Signal Enhancement System of the Present Invention The purpose of this invention is to construct a solid-phase nanopore signal enhancement system and method that is versatile, highly modular, resistant to interference, and highly selective. The method established in this invention can achieve dual amplification and signal transduction of target molecules while ensuring specific recognition of those molecules. Furthermore, it enables the same nanopore detection system to be adapted to different types of target nucleic acid molecules, providing a technical foundation for the highly sensitive, selective, and universal detection of low-abundance nucleic acids.

[0037] like Figure 1As shown, this invention first uses two probes to specifically recognize analytes at resolutions below that of solid-phase nanopores and form three-way junctions (3WJs). Klenow Fragment and Nt. BbvcI are used in a strand displacement amplification (SDA) reaction to transduce the target molecule into an initiator for the corresponding hybridization chain reaction (HCR), achieving concentration amplification. The initiator then opens the corresponding deoxyribonucleic acid (DNA) hairpins through base pairing and strand displacement reactions. These hairpins continuously and alternately participate in the reaction, ultimately forming a long-chain nucleic acid product with a repeating structure, achieving structural amplification. To achieve dual-target detection, this invention further designs two HCR reactions. Two target molecules generate corresponding HCR initiators through the SDA reaction, triggering two HCR reactions: a traditional HCR and a G-HCR that forms a branched assembly structure. Both products can pass through the solid-phase nanopore and generate signals, thereby enabling the confirmation of a single target molecule. When two targets are present simultaneously, since the size of the G-HCR product is larger than that of the traditional HCR product, the different perforation currents and perforation times generated when they pass through solid-phase nanopores can be used to achieve effective differentiation of the two targets.

[0038] Example 2: Composition and application of a solid-phase nanopore signal enhancement system developed using influenza A as the main research subject.

[0039] This invention uses two subtypes of influenza A (FluA), H1N1 and H5N1, as targets, binding to their respective probes Probe A1, Probe A2, Probe B1, and Probe B2. Under the action of Klenow Fragment and Nt.BbvcI, an SDA reaction occurs, generating corresponding initiators, named Initiator2 (I2) and Initiator1 (I1), respectively. I1 initiates a conventional HCR reaction, with corresponding DNA hairpins named H1 and H2; I2 initiates G-HCR, with corresponding hairpins named H3-5, H4, H5-3, and H6. The generated HCR products pass through nanopores under voltage-driven conditions, generating a signal.

[0040] I. Using influenza A as the main target and its corresponding probe sequence

[0041] H1N1: cgacuacacucucgaugaagaaagcagggcuag (SEQ ID NO: 1); Probe A1: gaagtctcggagatgaagatgaagcgctgagggtgttatcgagagtgtagtcg (SEQ IDNO: 2); Probe A2: ctagccctgctttcttcgcaacac (SEQ ID NO:3); H5N1: cugugguguaaguggugacacuguggguugguc (SEQ ID NO: 4); Probe B1: ttaacccacgccgaatcctagactgctgaggtactgttaccacttacaccacag (SEQID NO:5); Probe B2: gaccaacccacagtgtcgcaacag (SEQ ID NO: 6); The hairpin sequence required for HCR is as follows: H1: ttaacccacgccgaatcctagactcaaagtagtctaggattcggcgtg (SEQ ID NO:7); H2: agtctaggattcggcgtgggttaacacgccgaatcctagactactttg (SEQ ID NO:8); H3-5: gggtgggtgggaagtctcggagatgaagatgaagccatcgtgcttcatcttcatctccg (SEQID NO:9); H4: gcttcatcttcatctccggttttgcggagatgaagatgaagcacgatg (SEQ ID NO: 10); H5-3: caaaaccggagatgaagatgaagcttgcctgcttcatcttcatctccgtgtgggt (SEQ IDNO: 11); H6: gcttcatcttcatctccgagacttccggagatgaagatgaagcaggcaa (SEQ ID NO: 12); II. Experimental Procedure (a) Single target response Step 1: SDA Single Target Reaction System (1) H1N1 reaction system: 2 μL Target (H1N1 with a final concentration of 50 nM), 2 μL Probe 1 (Probe A1 with a final concentration of 50 nM), 2 μL Probe 2 (Probe A2 with a final concentration of 50 nM), 5 μL rCutSmart, 37.9 μL Nuclease-Free Water.

[0042] (2) H5N1 single target reaction system

[0043] 2 μL Target (H5N1 with a final concentration of 50 nM), 2 μL Probe 1 (Probe B1 with a final concentration of 50 nM), 2 μL Probe 2 (Probe B2 with a final concentration of 50 nM), 5 μL rCutSmart, 37.9 μL Nuclease-Free Water.

[0044] After mixing and annealing the two single-target reaction systems described above, 0.5 μL of dNTP (initial concentration 10 μM, final concentration 100 nM), 0.4 μL of Klenow Fragment, and 0.2 μL of Nt.BbvcI were added, and the reaction was carried out at 37 °C to obtain the SDA product.

[0045] In the control group, the target was replaced with nuclease-free water, and the remaining steps were the same. Next was the HCR reaction.

[0046] Step 2: HCR reaction

[0047] (1) The traditional HCR reaction system is: 1.2 μL H1 (final concentration 300 nM), 1.2 μL H2 (final concentration 300 nM), 15 μL SDA reaction product, 22.6 μL HCR buffer; (2) The G-HCR reaction system is: 1.2 μL H3-5 (final concentration 300 nM), 1.2 μL H4 (final concentration 300 nM), 1.2 μL H5-3 (final concentration 300 nM), 1.2 μL H6 (final concentration 300 nM), 15 μL SDA reaction product, and 20.2 μL HCR buffer.

[0048] The two systems described above were incubated at 25°C to obtain HCR products. Then, nanopore perforation experiments were performed.

[0049] Step 3: Nanopore perforation experiment

[0050] The nanopore perforation experiment system is as follows: 20 μL HCR product, 20 μL 10M LiCl, 10 μL formamide; after mixing, the sample is directly measured.

[0051] (II) Mixed target reaction

[0052] Step 1: SDA reaction

[0053] SDA mixed reaction system: 2 μL Target A (final concentration 50 nM H1N1), 2 μL Probe A1 (final concentration 50 nM Probe A1), 2 μL Probe A2 (final concentration 50 nM Probe A2), 2 μL Target B (final concentration 50 nM H5N1), 2 μL Probe B1 (final concentration 50 nM Probe B1), 2 μL Probe B2 (final concentration 50 nM Probe B2), 5 μL rCutSmart, 31.9 μL Nuclease-Free Water. After mixing and annealing, add 0.5 μL dNTP (final concentration 100 nM), 0.4 μL Klenow Fragment and 0.2 μL Nt.BbvcI, and react at 37 °C to obtain SDA product.

[0054] In the control group, the target was replaced with nuclease-free water, and the remaining steps were the same. Next was the HCR reaction.

[0055] Step 2: HCR reaction

[0056] (1) Traditional HCR-G-HCR reaction mixture: 1.2 μL H1 (final concentration 300 nM), 1.2 μL H2 (final concentration 300 nM), 1.2 μL H3-5 (final concentration 300 nM), 1.2 μL H4 (final concentration 300 nM), 1.2 μL H5-3 (final concentration 300 nM), 1.2 μL H6 (final concentration 300 nM), 15 μL SDA reaction product, 17.8 μL HCR buffer.

[0057] The two systems described above were incubated at 25°C to obtain HCR products. Then, nanopore perforation experiments were performed.

[0058] Step 3: Nanopore perforation experiment

[0059] The nanopore perforation experiment system is as follows: 20 μL HCR product, 20 μL 10M LiCl, 10 μL formamide, mixed well and then directly measured.

[0060] III. Experimental Results

[0061] (I) Comparison of current drop magnitude between G-HCR and traditional HCR

[0062] The results are as follows Figure 2 and Figure 3 As shown; by Figure 2 The scatter plot of nanopores shows significant differences in the number and distribution of events between the experimental and control groups, and G-HCR differs significantly from traditional HCR in current drop and perforation time. Figure 3 It can be seen that G-HCR has a much larger current drop than traditional HCR.

[0063] (II) Analysis of target detection

[0064] The results are as follows Figure 4 and Figure 5 As shown in Figure 4; A is a scatter plot of the control group (NC) without H1N1 and H5N1; B is a scatter plot of the nanopores that produce two HCR products after adding H1N1 and H5N1 to the same reaction system via transduction. Figure 4 It can be seen that nanopores can effectively distinguish the signals generated by mixed targets based on the current drop and the perforation time. The traditional HCR corresponding to H5N1 has a long perforation time and a small current drop, while the G-HCR corresponding to H1N1 has a short perforation time and a large current drop. Moreover, this method has low background leakage, demonstrating the multi-analysis capability of this method.

[0065] Figure 5 shows the current variation when neither H1N1 nor H5N1 is present (NC), when only H1N1 is present (H1N1), when only H5N1 is present (H5N1), and when both targets are present (H1N1 and H5N1 or Both Targets). Figure 5 It can be seen that the current drop for G-HCR corresponding to the H1N1 target is mainly distributed in the range of approximately 150~1000 pA, while the current drop for conventional HCR corresponding to the H5N1 target is mainly distributed in the range of approximately 50~125 pA. In the presence of mixed targets, the current drop is mainly distributed in the range of approximately 75~800 pA, covering the characteristic current drop range of the two single-target HCR products.

[0066] The above results demonstrate that the signal sensitization method constructed in this invention can effectively achieve the transduction and amplification of target molecules, and can distinguish different targets through the characteristic nanopore signals generated by different HCR products. Therefore, this method can not only effectively detect single targets, but also perform multiplex analysis on mixed targets.

[0067] Example 3: Composition and application of a solid-phase nanopore signal enhancement system developed using novel coronavirus and influenza B as the main research subjects.

[0068] To demonstrate the universality of this invention, the targets were changed to the novel coronavirus (SARS-CoV-2) and influenza B (FluB). The experimental procedures were the same as described above. The probe corresponding to SARS-CoV-2 was Probe C1, and Probe C2 was transduced to generate G-HCR products; the probe corresponding to FluB was Probe D1, and Probe D2 was transduced to generate conventional HCR products. The HCR hairpin structure was the same as in Example 2.

[0069] I. Using novel coronavirus and influenza B as the main research targets and their corresponding probe sequences

[0070] SARS-CoV-2: ccuuccuuacccagauccaucaagaauccuagg (SEQ ID NO: 13); Probe C1: gaagtctcggagatgaagatgaagcgctgagggtgttatctgggtaaggaagg (SEQ IDNO: 14); Probe C2:cctaggattcttgatgggcaacac (SEQ ID NO:15); FluB: cacacagagcucauagcagagcagcgagauccu (SEQ ID NO: 16); Probe D1: ttaacccacgccgaatcctagactgctgaggtactgttctatgagctctgtgtg (SEQID NO:17); Probe D2: aggatctcgctgctctggcaacag (SEQ ID NO: 18); II. Experimental Results The detection method is the same as in Example 2, and the results are as follows: Figure 6 and Figure 7 As shown. Figure 6 In the study, there were significant differences in the number and distribution of events between the experimental group and the control group (NC), and G-HCR differed significantly from traditional HCR (or HCR) in terms of current drop and perforation time. The invention demonstrates its excellent versatility by enabling the detection of new targets simply by replacing the corresponding recognition probe.

[0071] Depend on Figure 7 It can be seen that nanopores can effectively distinguish signals generated by mixed targets based on current drop and perforation time. Figure 7C and D in the figures represent box plots and bar graphs for cases where neither SARS-CoV-2 nor FluB is present, only SARS-CoV-2 is present, only FluB is present, and both targets are present simultaneously. Analysis of the bar graphs shows that the G-HCR current drop for the SARS-CoV-2 target is mainly distributed between approximately 150 and 1000 pA, while the conventional HCR current drop for the H5N1 target is mainly distributed between approximately 75 and 125 pA. In the presence of mixed targets, the current drop is mainly distributed between approximately 100 and 800 pA, covering the characteristic current drop range of both single-target HCR products. Furthermore, these results demonstrate that this invention has good modularity and versatility; by simply replacing the recognition probe corresponding to the target molecule, specific detection and signal differentiation of new targets can be achieved without requiring overall adjustments to the subsequent signal transduction and nanopore detection system.

[0072] Example 4: Optimization of the present invention and comparison with other prior art

[0073] I. Optimization of the Invention - Optimization of the Hybridization Base Number of the Two Probes

[0074] The number of hybridization bases between the two probes is crucial for the formation of the triplet structure. The probe sequences shown in the table below are optimized to control the hybridization of the two probes.

[0075] Table 1

[0076] The results are as follows Figure 8 As shown, too few hybridization bases will fail to form a stable triple-stranded structure, while too many will result in non-specific binding and background leakage when the target is not present. Gel electrophoresis revealed that a hybridization base count of 5 bp can form a stable triple-stranded structure without leakage.

[0077] II. Comparison with existing technologies

[0078] (a) Comparison with "Accurate Molecular Sensing based on Modular and Customizable CRISPR / Cas-Assisted Nanopore Operational Nexus (CANON)"

[0079] 1. Based on the principle of CRISPR-Cas12a, this paper cannot achieve one-pot dual-target detection. After the target activates Cas12a, it generates side-cleaving activity, cleaving the complementary strand of the initiator, thereby releasing the initiator and initiating an HCR reaction. However, since Cas12a side-cleaving is not sequence-specific, only one target can activate Cas12a in the system, generating side-cleaving activity and cleaving the complementary strand of one HCR initiator, thus establishing a target-output correspondence. If the system contains complementary strands of two HCR initiators, activation of Cas12a by either target will indiscriminately cleave the complementary strands of both HCR initiators, initiating two HCR reactions. Therefore, this paper cannot achieve one-pot dual-target detection.

[0080] 2. The method described in the article involves obtaining HCR products and then mixing them to detect two targets. However, the method proposed in this invention allows for one-pot mixing in a single tube, simultaneously detecting both targets, which is more convenient. Furthermore, compared to the HCR scatter plot in the article, the scatter plot of this invention provides a clearer and more distinct differentiation effect.

[0081] (II) Compared with a reagent, kit, and detection method for detecting Mycobacterium bovis (CN115786544A)

[0082] 1. The method described in this patent has a highly specific recognition system that is highly bound to the target sequence of Mycobacterium bovis, Cas12a / gRNA, and HCR sequence. Changing the target would require redesigning the gRNA, H1, H2, and other sequences, which is cumbersome and expensive. In contrast, this invention only requires changing the recognition arm sequence for different targets, eliminating the need for complex design, reducing synthesis costs, and keeping the subsequent "transduction-amplification-nanopore readout" module essentially unchanged.

[0083] 2. This patent introduces hemin for fluorescence characterization, while the present invention does not require the introduction of other substances and can directly detect the product without labeling.

[0084] 3. This patent can only detect one target, while the present invention can use a one-pot method to detect two targets.

[0085] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nanoporous single-molecule signal enhancement system, characterized in that, include: Detection target M, probe M1, probe M2, and four hairpin nucleic acid strands; The detection target M is a nucleic acid fragment derived from virus X; The virus X includes: influenza A virus and / or novel coronavirus; The probes M1 and M2 are used to detect the detection target M and are partially inversely complementary to the 3' and 5' nucleotides of the detection target M, respectively. The nucleotide sequences of the four hairpin nucleic acid chains are shown in SEQ ID NO:9 to SEQ ID NO:

12.

2. The nanoporous single-molecule signal enhancement system according to claim 1, characterized in that, The nucleotide sequence of the detection target M derived from the influenza A virus is shown in SEQ ID NO:1; The nucleotide sequence of the detection target M derived from the novel coronavirus is shown in SEQ ID NO:

13.

3. The nanoporous single-molecule signal enhancement system according to claim 2, characterized in that, The nucleotide sequences of probes M1 and M2 for detecting the target M derived from the influenza A virus are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. The nucleotide sequences of probes M1 and M2 for detecting the target M derived from the novel coronavirus are shown in SEQ ID NO:14 and SEQ ID NO:15, respectively.

4. The nanoporous single-molecule signal enhancement system according to claim 3, characterized in that, Also includes: Detection targets N, probe N1, probe N2, and two hairpin nucleic acid strands; The detection target N is a nucleic acid fragment derived from virus B; The virus B includes: influenza A virus and / or influenza B virus; The probes N1 and N2 are used to detect the detection target N and are partially inversely complementary to the 3' and 5' nucleotides of the detection target N, respectively. The nucleotide sequences of the two hairpin nucleic acid chains are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

5. The nanoporous single-molecule signal enhancement system according to claim 4, characterized in that, The nucleotide sequence of the detection target N derived from the influenza A virus is shown in SEQ ID NO:4; The nucleotide sequence of the detection target N derived from the influenza B virus is shown in SEQ ID NO:

16.

6. The nanoporous single-molecule signal enhancement system according to claim 5, characterized in that, The nucleotide sequences of probes N1 and N2 for detecting the detection target N derived from the influenza A virus are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. The nucleotide sequences of probes N1 and N2 for detecting the detection target N derived from the influenza B virus are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively.

7. A reagent for cascade amplification of virus detection signals, characterized in that, Includes the nanoporous single-molecule signal enhancement system according to any one of claims 1 to 6.

8. The application of one of the following (A) to (B) in the preparation of a reagent kit for cascade amplification of virus detection signals: A) The nanoporous single-molecule signal enhancement system according to any one of claims 1 to 6; B) The reagent as described in claim 7.

9. A reagent kit for cascaded amplification of virus detection signals, characterized in that, The system comprises at least one of the nanoporous single-molecule signal sensitization systems according to any one of claims 1 to 6 or the reagent according to claim 7, and further comprises an enzyme, dNTPs and / or a reaction buffer. The enzymes include DNA polymerase and endonuclease.

10. The reagent kit according to claim 9, characterized in that, The DNA polymerase is Klenow Fragment; The endonuclease is Nt.BbvCI.

Images