Green fluorescent protein-based plant chloroplast subcompartments specificity calcium imaging monitoring method, application and detection kit

Abstract

The present application relates to the field of genetic engineering, and particularly relates to a green fluorescent protein-based plant chloroplast sub-compartment specific calcium imaging monitoring method, application and detection kit, the method comprising: fusing specific signal peptides targeting the outer membrane of chloroplast, the inner membrane of chloroplast, the stroma of chloroplast and the outer side of thylakoid membrane with the N-terminal of calcium indicator GCaMP6m to obtain fusion fragments, and cloning and constructing four kinds of recombinant expression vectors; introducing the four kinds of recombinant expression vectors into recipient plants respectively to obtain transgenic plants stably expressing each calcium imaging probe; applying high temperature stress treatment to the obtained transgenic plants, continuously collecting time sequence fluorescence images by using a fluorescence microscope, calculating relative calcium signal intensity, and realizing real-time dynamic monitoring of calcium signals of different subcellular structures of chloroplast. The monitoring method, application and detection kit can realize millisecond-level monitoring of calcium signal changes of different subcellular parts of plant chloroplast.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a method and application of a plant chloroplast subcompartment-specific calcium imaging monitoring method based on green fluorescent protein, as well as a detection kit. Background Technology

[0002] Calcium ions are one of the most important second messengers in plants, participating in the regulation of almost all important physiological processes, including plant growth and development, stress responses (such as drought, high temperature, pests and diseases), and photosynthesis. Chloroplasts, as semi-autonomous organelles unique to plants, are not only the site of photosynthesis but also important intracellular calcium ion reservoirs and environmental signal sensing organelles. Chloroplast calcium signaling plays a crucial role in regulating photosynthetic efficiency, responding to abiotic stresses, and mediating signal transduction between organelles. However, due to limitations in experimental methods and the lack of high spatiotemporal resolution and high-specificity subcellular calcium imaging techniques, our understanding of the spatiotemporal dynamics of calcium signals in different subcellular structures of chloroplasts (outer membrane, inner membrane, and the outer thylakoid membrane) induced by environmental changes is still very limited.

[0003] Traditional chemical calcium indicators (such as Fluo-4 AM and Rhod-2 AM) cannot specifically target different subcellular structures of chloroplasts; they also have difficulty penetrating plant cell walls, resulting in extremely low loading efficiency. After loading, they will diffuse freely within the cell, causing the monitoring results to fail to reflect the true calcium signals of specific organelles.

[0004] Most existing gene-encoded calcium indicators (GECIs) can only be located in the cytoplasm or nucleus. Summary of the Invention

[0005] This invention aims to solve the problems in the prior art and provide a method, application, and detection kit for monitoring specific calcium signals in plant chloroplast sub-cells based on green fluorescent protein, which can achieve comprehensive and accurate monitoring of calcium signals in chloroplast sub-cells.

[0006] To achieve the above objectives, the first aspect of this application provides a plant chloroplast sub-cell-specific calcium imaging monitoring method based on green fluorescent protein, which enables comprehensive and accurate monitoring of calcium signals in chloroplast sub-cells, comprising:

[0007] S100. Specific signal peptides targeting the outer membrane of chloroplasts, the inner membrane of chloroplasts, the chloroplast stroma, and the outer membrane of thylakoids are fused with the N-terminus of the calcium indicator GCaMP6m to obtain fusion fragments. The fusion fragments are cloned to construct four recombinant expression vectors. S120. The four recombinant expression vectors are introduced into recipient plants respectively to obtain transgenic plants that stably express each calcium imaging probe. S140. High temperature stress was applied to the obtained transgenic plants, and time-series fluorescence images were continuously acquired using a fluorescence microscope to calculate the relative calcium signal intensity, thereby realizing real-time dynamic monitoring of calcium signals in different subcellular structures of chloroplasts.

[0008] In one embodiment, the specific signal peptide targeting the outer membrane of chloroplasts is the AtOEP7 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:1; the specific signal peptide targeting the inner membrane of chloroplasts is the AtTIC21 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:2; the specific signal peptide targeting the chloroplast stroma is the AtBAM4 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:3; and the specific signal peptide targeting the outer membrane of thylakoids is the AtSTN7 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:4.

[0009] In one embodiment, the nucleotide sequence of the calcium indicator GCaMP6m is shown in SEQ ID NO:5.

[0010] In one embodiment, the cloning involves cloning each fusion fragment into a pHELLSGATE8 plant binary expression vector driven by the CaMV35S promoter.

[0011] In one embodiment, the recipient plant is a Micro-Tom tomato or a MoneyMaker tomato.

[0012] In one embodiment, before applying stress treatment to the obtained transgenic plants, the method further includes S130, using a laser confocal microscope to perform fluorescence imaging on the transgenic plants to verify the targeting effect of each calcium imaging probe on the corresponding chloroplast subcellular structure.

[0013] In one embodiment, the excitation wavelength of the GFP fluorescence channel in laser confocal microscopy imaging is 488 nm, and the emission light acquisition range is 500-550 nm; the excitation wavelength of the chlorophyll autofluorescence channel is 488 nm, and the emission light acquisition range is 650-700 nm.

[0014] The second aspect of this application provides the application of the method described above in monitoring calcium signals in plant chloroplasts.

[0015] A second aspect of this application provides a plant chloroplast subcompartment-specific calcium imaging detection kit, comprising four recombinant expression vectors: an AtOEP7-GCaMP6m fusion expression vector targeting the outer chloroplast membrane, an AtTIC21-GCaMP6m fusion expression vector targeting the inner chloroplast membrane, an AtBAM4-GCaMP6m fusion expression vector targeting the chloroplast stroma, and an AtSTN7-GCaMP6m fusion expression vector targeting the outer thylakoid membrane. In one embodiment, this method was used to detect and differentiate calcium signal differences in the cytoplasm and chloroplasts under ambient temperature (24°C) and high-temperature stresses (37°C and 42°C).

[0016] Compared with existing technologies, this application has the following beneficial effects: This invention constructs a specific signal peptide targeting the outer membrane of chloroplasts, the inner membrane of chloroplasts, the chloroplast stroma, and the outer surface of the thylakoid membrane, fusing it with the N-terminus of the calcium indicator GCaMP6m to obtain a corresponding recombinant expression vector. This allows for millisecond-level monitoring of calcium signal changes in different subcellular parts of plant chloroplasts, achieving specific monitoring of calcium signals in specific subcellular structures of chloroplasts. This avoids the non-specific diffusion problem of traditional chemical indicators. Under high-temperature stress, time-series fluorescence images are continuously acquired using a fluorescence microscope, and the relative calcium signal intensity is calculated, enabling real-time dynamic monitoring of calcium signals in different subcellular structures of chloroplasts. This provides theoretical and practical basis for further research on the molecular biological mechanisms related to chloroplast calcium signals in plants and for variety improvement, and has significant economic and social benefits. Results showed that under 37℃ high-temperature stress, calcium signals increased in the inner membrane, stroma, and outer surface of the thylakoid membrane (peaking at approximately 50s), while the outer membrane showed no response; under extreme stress at 42℃, the outer membrane showed a delayed response (increasing from approximately 60s to peak at 180s). This indicates that when plants respond to high-temperature stress, calcium signals are first generated inside the chloroplasts and can be further transmitted to the cytoplasm as the stress level increases, exhibiting regional and temporal characteristics. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1This diagram illustrates the construction of four recombinant plant binary expression vectors targeting chloroplast subcellular structures, as well as an empty vector, involved in Example 1 of this invention. A shows the plasmid map of the empty vector pHELLSGATE 8, marking the core functional elements of this plant binary vector; B shows the plasmid map of the recombinant expression vector pHELLSGATE 8-GCaMP6m (without a specific signal peptide); C shows the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLoC-G; D shows the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLiS-G; E shows the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLS-G; and F shows the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLtoS-G.

[0019] Figure 2 This is a confocal imaging image of the subcellular localization of chloroplast probes in the guard cells of the leaves of the tomato transgenic lines without specific signal peptides and four chloroplast subcellular calcium imaging lines involved in Example 1 of this invention. The corresponding transgenic lines are: A is GCaMP6m (cytoplasmic localization line without specific signal peptide), B is CHLOC-G (extracellular chloroplast localization line), C is CHLiS-G (intracellular chloroplast localization line), D is CHLS-G (chloroplast stroma line), and E is CHLtoS-G (extracellular thylakoid membrane localization line). The four horizontal columns are, in order, bright-field images, GFP fluorescence channel images, chlorophyll autofluorescence channel images, and multi-channel fused superimposed images. The green areas marked with GFP signal indicate the expression location of the calcium ion probe, the red areas marked with chlorophyll autofluorescence indicate the location of the chloroplast, and the yellow areas in the fused image represent the co-localization region of GFP signal and chlorophyll autofluorescence, used to verify the targeting effect of the calcium ion probe.

[0020] Figure 3This is a temporal pseudocolor imaging and calcium signal analysis curve of the stem portion of the tomato transgenic line without specific signal peptides under 24℃ high-temperature stress, as well as four chloroplast subcellular calcium imaging lines. A represents GCaMP6m (cytoplasmic localization line without specific signal peptides), B represents CHLoC-G (chloroplast outer membrane line), C represents CHLiS-G (chloroplast inner membrane line), D represents CHLS-G (chloroplast stroma line), and E represents CHLtoS-G (thylakoid line). (External line of the strain); the left side shows the time-series pseudocolor imaging of calcium signal, using purple-orange-red pseudocolor display. The more orange-red the color, the higher the calcium ion concentration. The horizontal markings 0, 50, 180, and 270 represent seconds (s), which are the time points when the images were acquired after high-temperature stress treatment. The rightmost line of each row shows the dynamic change curve of the relative fluorescence intensity (ΔF / F0) of the calcium signal of the corresponding strain under 24℃ high-temperature stress. The horizontal axis represents the stress treatment time (in seconds), the vertical axis represents the ΔF / F0 value, and the short vertical line represents the experimental standard error.

[0021] Figure 4 This is a temporal pseudo-color imaging and calcium signal analysis curve of the stem portion of the tomato transgenic lines without specific signal peptides under 37℃ high-temperature stress, as well as four chloroplast subcellular calcium imaging lines. The transgenic lines are: A is GCaMP6m (cytoplasmic localization line without specific signal peptides), B is CHLoC-G (chloroplast outer membrane line), C is CHLiS-G (chloroplast inner membrane line), D is CHLS-G (chloroplast stroma line), and E is CHLtoS-G (…). (External thylakoid membrane strains); the left side shows the time-series pseudocolor imaging of calcium signals, displayed using purple-orange-red pseudocolor, with the color leaning more towards orange-red indicating a higher calcium ion concentration; the horizontal markings 0, 50, 180, and 270 represent seconds (s), indicating the time points when images were acquired after high-temperature stress treatment; the rightmost line of each row shows the dynamic change curve of the relative fluorescence intensity (ΔF / F0) of the corresponding strain's calcium signal under 37℃ high-temperature stress, with the horizontal axis representing the stress treatment time (in seconds), the vertical axis representing the ΔF / F0 value, and the short vertical line representing the experimental standard error.

[0022] Figure 5This is a temporal pseudocolor imaging and calcium signal analysis curve of the stem portion of the tomato transgenic lines without specific signal peptides under 42℃ high-temperature stress, as well as four chloroplast subcellular calcium imaging lines. The vertical axis corresponds to the four transgenic lines in sequence: A is GCaMP6m (cytoplasmic localization line without specific signal peptides), B is CHLoC-G (chloroplast outer membrane line), C is CHLiS-G (chloroplast inner membrane line), D is CHLS-G (chloroplast stroma line), and E is CHLto. S-G (Thylakoid membrane extracellular lineage); the left side shows the time-series pseudocolor imaging of calcium signal, displayed using purple-orange-red pseudocolor, with the color leaning more towards orange-red indicating a higher calcium ion concentration; the horizontal markings 0, 50, 180, and 270 represent seconds (s), indicating the time points at which images were acquired after high-temperature stress treatment; the rightmost line of each row shows the dynamic change curve of the relative fluorescence intensity (ΔF / F0) of the corresponding line's calcium signal under 42℃ high-temperature stress, with the horizontal axis representing the stress treatment time (in seconds), the vertical axis representing the ΔF / F0 value, and the short vertical line representing the experimental standard error. Detailed Implementation

[0023] To facilitate understanding of this application, the following description will be more comprehensive and detailed in conjunction with the accompanying drawings and preferred embodiments, but the scope of protection of this application is not limited to the following specific embodiments.

[0024] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of this application.

[0025] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0026] Please see Figure 1-5 A method for detecting subcompartment-specific calcium in plant chloroplasts based on green fluorescent protein, according to one embodiment, includes the following steps: S100. Specific signal peptides targeting the outer membrane of chloroplasts, the inner membrane of chloroplasts, the chloroplast stroma, and the outer membrane of thylakoids were fused with the N-terminus of the calcium indicator GCaMP6m to obtain fusion fragments. The fusion fragments were cloned to construct four recombinant expression vectors.

[0027] As a single-fluorescent protein calcium indicator, GCaMP6m maintains its calcium indication function because the N-terminal signal peptide of a protein generally determines its final subcellular localization. The N-terminal fusion signal peptide of GCaMP6m does not affect the fluorescence intensity response after calcium binding, ensuring the integrity of its function. Even after the fusion protein is successfully transported to its target compartments, GCaMP6m continues to respond normally to changes in calcium ion concentration. GCaMP6m is one of the most sensitive single-fluorescent protein calcium indicator variants currently available, exhibiting rapid response kinetics (milliseconds) and a large dynamic range, making it suitable for real-time dynamic calcium imaging monitoring.

[0028] Preferably, the specific signal peptide targeting the outer chloroplast membrane is the AtOEP7 signal peptide (derived from the Arabidopsis AtOEP7 gene, AT3G52420), and its nucleotide sequence is shown in SEQ ID NO:1; the specific signal peptide targeting the inner chloroplast membrane is the AtTIC21 signal peptide (derived from the Arabidopsis AtTIC21 gene, AT2G15290), and its nucleotide sequence is shown in SEQ ID NO:2; the specific signal peptide targeting the chloroplast stroma is the AtBAM4 signal peptide (derived from the Arabidopsis AtBAM4 gene, AT5G55700), and its nucleotide sequence is shown in SEQ ID NO:3; the specific signal peptide targeting the outer thylakoid membrane is the AtSTN7 signal peptide (derived from the Arabidopsis AtSTN7 gene, AT1G68830), and its nucleotide sequence is shown in SEQ ID NO:4. The nucleotide sequence of the calcium indicator GCaMP6m is shown in SEQ ID NO:5.

[0029] SEQ ID NO:1: atgggaaaaacttcgggagcgaaacaggcgactgtggtggtcgcagcgatggcgttaggatggttagccatagagatcgctttcaagcctttcctcgataaattccgctcctcaatcgacaaatctgacccaaccaaagaccccgatgac SEQ ID NO:2: atgcaatcactactcttgccgccggcgagttcctccggcgtatccgccgtcgcgctacggccaggtttccagcactcatttaaccaccaaagcctctctactcgctccctgccattgtttaatccacttctcttagctccgaagaagaaaaccaccatctcctcatatcaatcgccaccgtctctgtccgtctacggtttccaaatcggaggatctaaacctagtttcacaccatccacggtggcattttcatatccgacttctccgtcttccgttcccggtgataatgaggtcgacaaagcaaaactcgctcaggttgcaaagagattggagaagacttcaaggtactttaagagactagggagtattggtttctgggggcagcttgtgtcaactgtggttgcagctgtgattctatccttctccattgttgtaactgggaaacctacttcacctgctactttctatgctactgctagtgggattgctgctgcgtttgtctcggttttctggtcgtttgggtatattcggctctccgagaggctccgtcgaacttccatcgaccctgccaag SEQ ID NO:3: atgacggagactggagtaatcggatgtggctgtcgcggagtcaccggcggcaatttcttccatcccggaggattttctttgaaatcttgtttcctcgagcagagtacaaagcgtaatcgtaactttttccgaagcgtttctatgattcctcctttcaaacgcggtcgtttcatcactaagttgcgt SEQ ID NO:4: atggctacaatatctccgggaggagcttacatcggaactccctcaccgtttctcggcaaaaaactcaaacctttctctctaacttcaccgattttgagttttaaaccaacggttaagctcaattccagttgtcgcgctcaattgatcgatacggttcacaatctcttcatcggagttggagttggacttccatgtacggttatggagtgtggtgatatgatatatcgaagtactttgccgaaatctaatggtttaacgatcactgctcctggagtagctttagctctcactgctctttcgtatctatgggcaacacctggtgttgctcctgggtttttcgatatgtttgttcttgcttttgttgagagattgtttcgacctacttttagaaaggatgattttgttgttggg SEQ ID NO:5: ctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacatccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaa ccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacctgccggaccaactgactgaagagcagatcgcagaatttaaagaggctttctccctatttgacaaggacggggatgggacaataacaaccaaggagctgggga cggtgatgcggtctctggggcagaaccccacagaagcagagctgcaggacatgatcaatgaagtagatgccgacggtgacggcacaatcgacttccctgagttcctgacaatgatggcaagaaaagggagctacagggacacggaagaagaaattagaagcgttcggtgtg tttgataaggatggcaatggctacatcagtgcagcagagcttcgccacgtgatgacaaaccttggagagaagttaacagatgaagaggttgatgaaatgatcagggaagcagacatcgatggggatggtcaggtaaactacgaagagtttgtacaaatgatgacagcgaagtga The recombinant expression vector is constructed by cloning each signal peptide-GCaMP6m fusion fragment into a plant binary expression vector (preferably pHELLSGATE8) driven by the CaMV35S promoter.

[0030] The CaMV35S promoter is a constitutive strong promoter, enabling stable and efficient expression of fusion proteins in various plant tissues and organs. This ensures sufficient fluorescence intensity of the probe at target sites such as leaf guard cells and stems for imaging detection. The pHELLSGATE8 vector carries a spectinomycin resistance marker, facilitating transformant screening.

[0031] S120. The four recombinant expression vectors are introduced into recipient plants respectively to obtain transgenic plants that stably express each calcium imaging probe. Preferably, the recipient plant is tomato ( Solanum lycopersicum (More preferably Micro-Tom or MoneyMaker varieties; the introduction is accomplished through Agrobacterium-mediated genetic transformation.)

[0032] S130. Fluorescence imaging of transgenic plants was performed using a laser confocal microscope to verify the targeting effect of each calcium imaging probe on the corresponding chloroplast subcellular structures.

[0033] Confocal microscopes have high spatial resolution (submicron level) and optical tomography capabilities, which can clearly distinguish fine subcellular structures such as chloroplast membranes, stroma, and thylakoid membranes.

[0034] S140. High temperature stress was applied to the obtained transgenic plants, and time-series fluorescence images were continuously acquired using a fluorescence microscope to calculate the relative calcium signal intensity, thereby realizing real-time dynamic monitoring of calcium signals in different subcellular structures of chloroplasts.

[0035] Preferably, the excitation wavelength of the GFP fluorescence channel for laser confocal microscopy imaging is 488 nm, and the emission light acquisition range is 500-550 nm; the excitation wavelength of the chlorophyll autofluorescence channel is 488 nm, and the emission light acquisition range is 650-700 nm.

[0036] Chlorophyll autofluorescence is used to mark the overall location of chloroplasts. Simultaneous imaging with the GFP fluorescent channel is achieved without additional staining, avoiding interference from exogenous dyes on cell state and ensuring accurate localization information in live cells. The GFP fluorescent channel is used to detect the distribution of GCaMP6m. The excitation band of 488nm and emission band below 550nm minimizes spectral crosstalk from chlorophyll autofluorescence (650-700nm), ensuring signal specificity.

[0037] The temperature for high-temperature stress treatment was 37-42℃; the relative calcium signal intensity ΔF / F0 was calculated as follows: using the baseline fluorescence value F0 before treatment as a reference, ΔF / F0 = (F... 校正 -F0) / F0, where F 校正 =F 原始 -F 背景 This calculation formula corrects for differences in probe expression levels and background fluorescence interference, and normalizes the data by using the pre-treatment baseline as a reference. This eliminates the influence of inter-individual expression differences on quantitative comparisons, making data from different strains and different experimental batches comparable.

[0038] The above method can be applied to the monitoring of calcium signals in plant chloroplasts.

[0039] This invention provides a plant chloroplast subcompartment-specific calcium imaging detection kit, which contains four recombinant expression vectors: AtOEP7-GCaMP6m fusion expression vector targeting the outer chloroplast membrane, AtTIC21-GCaMP6m fusion expression vector targeting the inner chloroplast membrane, AtBAM4-GCaMP6m fusion expression vector targeting the chloroplast stroma, and AtSTN7-GCaMP6m fusion expression vector targeting the outer thylakoid membrane.

[0040] Example 1 The construction of S100, cytoplasmic localization lines without specific signal peptides, and recombinant expression vectors for subcellular calcium imaging in four different chloroplast locations, specifically included the following steps: (1) Preparation of LB solid and liquid culture media: LB liquid culture medium: Weigh 10 g of tryptone, 5 g of yeast extract and 10 g of sodium chloride, dissolve them completely in 1 L of deionized water (ddH2O) and autoclave at 121 °C for 20 min. When preparing solid LB culture medium, add 12 g of agar powder to the above LB liquid culture medium formula.

[0041] (2) Using cDNA from wild-type Arabidopsis thaliana Col-0 ecotype as a template, the target fragment was amplified by PCR (experimental conditions: the target fragment was amplified using Hieff Canace® Plus high-fidelity DNA polymerase of Yeasen (product number 10153ES), a 50 μL reaction system was prepared, and the PCR program was: 98 ℃ pre-denaturation for 3 min; 35 cycles (98 ℃ for 10 s, 68 ℃ extension for 30 s / kb; 72 ℃ final extension for 5 min) to obtain the AtOEP7 signal peptide fragment targeting the outer membrane of chloroplasts (the first 150 bp of the coding region of the Arabidopsis thaliana AtOEP7 gene, nucleotide sequence as shown in SEQ ID NO:1), the AtTIC21 signal peptide fragment targeting the inner membrane of chloroplasts (the first 573 bp of the coding region of the Arabidopsis thaliana AtTIC21 gene, nucleotide sequence as shown in SEQ ID NO:2), and the AtBAM4 signal peptide fragment targeting the chloroplast stroma (the first 186 bp of the coding region of the Arabidopsis thaliana AtBAM4 gene, nucleotide sequence as shown in SEQ ID NO:2). The AtSTN7 signal peptide fragment (the first 411 bp of the coding region of the Arabidopsis AtSTN7 gene, nucleotide sequence as shown in SEQ ID NO:3) and the thylakoid membrane outer region (nucleotide sequence as shown in SEQ ID NO:4) were obtained by PCR amplification using plasmid pN1-GCaMP6m-XC as a template. The coding region fragment of the GCaMP6m gene (nucleotide sequence as shown in SEQ ID NO:5) was obtained. The 5' end of the PCR products of the above four signal peptides was introduced with a homologous arm complementary to the linearized pHELLSGATE8 vector, and the 3' end was introduced with a homologous arm complementary to the 5' end of the GCaMP6m gene; the 5' end of the PCR product of the GCaMP6m gene was introduced with a homologous arm complementary to the 3' end of the signal peptide, and the 3' end was introduced with a homologous arm complementary to the linearized pHELLSGATE8 vector. The plant binary expression vector pHELLSGATE8 was digested with restriction endonucleases XhoI and XbaI, and the linearized vector backbone was recovered by agarose gel electrophoresis. The linearized vector was mixed with the GCaMP6m fragment at a molar ratio of 1:2, and the linearized vector was also mixed with four signal peptide fragments and the GCaMP6m fragment at a molar ratio of 1:2:2. The resulting five mixed solutions were added to a multi-fragment homologous recombinase system (total reaction volume 20 μL), and incubated at 50°C for 30 min to complete the recombination reaction. The recombinant product was transformed into *E. coli* DH5α competent cells and plated on LB solid medium containing 75 mg / L spectinomycin, and cultured upside down at 37°C for 12 h. Single colonies were picked and inoculated into 1 ml of LB liquid medium containing 75 mg / L spectinomycin, and cultured at 37°C with shaking at 200 rpm until OD500. 600=0.6-0.8. Using 1 μL of bacterial culture as a template, PCR was performed using primers at the promoter end and marker gene end for positive identification. Positive clones were sent for sequencing verification, ultimately obtaining five recombinant expression vectors with correct sequences. For example... Figure 1 As shown, A is the plasmid map of the empty vector pHELLSGATE 8, marking the core functional elements of this plant binary vector; B is the plasmid map of the recombinant expression vector pHELLSGATE 8-GCaMP6m (cytoplasmic localization vector without specific signal peptide); C is the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLoC-G (chloroplast outer membrane localization vector); D is the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLiS-G (chloroplast inner membrane localization vector); E is the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLS-G (chloroplast stroma localization vector); and F is the plasmid map of the recombinant expression vector pHELLSGATE 8-CHLtoS-G (thylakoid membrane outer localization vector).

[0042] The construction of S120, cytoplasmic localization lines without specific signal peptides, and four transgenic tomato lines for subcellular calcium imaging of chloroplasts in different locations, specifically includes the following steps: (1) Preparation of culture medium: 1 / 2MS medium: Take 2.15 g of 1 / 2MS medium base salt and 15 g of sucrose, add them to 800 mL of deionized water and stir until completely dissolved. Adjust the pH value to 5.7-5.8 with 1 mol / L potassium hydroxide (KOH) solution, then add 8 g of agar powder, and finally make up the volume to 1 L with deionized water.

[0043] KCMS medium: Add MS medium base salt (EDTA sodium iron, vitamin-free) 4.3 g, 20 mg / mL inositol solution 5 mL, 1 mg / mL vitamin B1 solution 1.3 mL, 1 mg / mL 2,4-dichlorophenoxyacetic acid (2,4-D) solution 200 μL, 100 mg / mL potassium dihydrogen phosphate (KH2PO4) solution 2 mL, 1 mg / mL kinetin solution 100 μL and sucrose 30 g in sequence. After stirring well, adjust the pH to 5.7-5.8, make up the volume to 1 L with deionized water, add 7.4 g of agar, and autoclave at 121℃ for 30 min.

[0044] Agrobacterium infection suspension: The preparation method is as follows: take 4.3 g of MS medium salt mixture, 20.0 g of sucrose, 5 mL of 20 mg / mL inositol solution, and 400 μL of 1 mg / mL vitamin B1 solution, dissolve them, adjust the pH value to 5.8, and make up to 1 L with deionized water. Then, autoclave at 121℃ for 30 min before use.

[0045] 2Z Screening Medium: Dissolve 4.3 g of MS medium salt mixture and 30 g of sucrose in an appropriate amount of deionized water, adjust the pH to 5.8, and bring the volume to 1 L. Add 7.4 g of agar and autoclave at 121°C for 30 min. When the medium temperature has cooled to about 50°C, aseptically add the following filtered sterilized reagents in a laminar flow hood: 100 μL of 1 mg / mL indoleacetic acid (IAA) solution, 2 mL of 1 mg / mL zeatin (ZT) solution, 1 mL of 100 mg / mL kanamycin solution, and 1.2 mL of 300 mg / mL termethin solution.

[0046] 0.2 Z Subculture Medium: The basic components were the same as those of 2 Z medium (MS salt 4.3 g, sucrose 30 g, agar 7.4 g, adjusted to 1 L, pH 5.8, sterilized at 121℃ for 30 min). When cooled to 60℃, aseptically add: 200 μL of 1 mg / mL zeatin solution, 1 mL of 100 mg / mL kanamycin solution, and 1.2 mL of 300 mg / mL termethin solution.

[0047] Rooting medium: Weigh 4.3 g of MS medium salt mixture, 30.0 g of sucrose, and 7.4 g of agar. Dissolve in an appropriate amount of deionized water, adjust the pH to 5.8, and bring the volume to 1 L. Autoclave at 121℃ for 30 min. When the temperature drops to 60℃, aseptically add 2 mL of 1 mg / mL indolebutyric acid (IBA) solution, 500 μL of 100 mg / mL kanamycin solution, and 1.2 mL of 300 mg / mL termethin solution.

[0048] (2) Using Agrobacterium-mediated tomato cotyledon transformation, transgenic tomato plants stably expressing four calcium imaging probes were obtained. The specific steps are as follows: Agrobacterium transformation and positive clone screening: Five correctly sequenced recombinant expression vectors were introduced into Agrobacterium tumefaciens GV3101 competent cells using a freeze-thaw method. The cells were plated on LB agar containing 75 mg / L spectinomycin and 25 mg / L rifampin and incubated upside down at 28°C for 48 h. Single colonies were picked and identified by PCR using the upstream primer of the CaMV 35S promoter and the downstream primer of the GCaMP6m gene to obtain positive Agrobacterium transformants.

[0049] Preparation of Agrobacterium infection solution: Select positive Agrobacterium colonies and inoculate them into LB liquid medium containing 75 mg / L spectinomycin and 25 mg / L rifampin. Incubate at 28°C with shaking at 200 rpm until OD600 = 0.6. Collect the cells by centrifugation at 4000 rpm for 10 min, resuspend the cells in an equal volume of Agrobacterium suspension in KCMS medium, and adjust the final concentration to OD600 = 0.1 for later use.

[0050] Tomato cotyledon infection and co-culture: Tomato seeds were sterilized with 75% alcohol and sown on 1 / 2 MS medium. Cotyledons of sterile tomato seedlings at the cotyledon expansion stage were taken, cut into small pieces of about 0.5 cm × 0.5 cm, and immersed in the Agrobacterium infection solution for 4 min. Excess bacterial solution on the surface of the cotyledons was blotted dry with sterile filter paper, and the cotyledons were laid flat on KCMS co-culture medium with the back side facing up, and incubated in the dark at 25℃ for 2 days.

[0051] Callus induction and screening: The co-cultured cotyledons were transferred to callus screening medium 2Z and cultured at 25°C under light (16 h light / 8 h dark). Subculture was performed every 20 days until dense green callus tissue grew.

[0052] Differentiation and rooting of resistant shoots: The induced callus tissue was transferred to 0.2 Z subculture medium and cultured at 25℃ under light (16 h light / 8 h dark). Subculture was performed every 20 days until resistant shoots differentiated. When the resistant shoots grew to 2-3 cm, excess callus tissue was removed and transferred to rooting medium to induce rooting, thus obtaining T0 generation transgenic plants.

[0053] Identification of positive plants and seed harvesting: T0 generation plants were self-pollinated to harvest T1 generation seeds. T1 generation plants were selected by fluorescence screening, and single-copy homozygous lines were selected for self-pollination to obtain T2 generation homozygous transgenic seeds.

[0054] S130. Fluorescence imaging of transgenic plants was performed using a laser confocal microscope to verify the targeting effect of each calcium imaging probe on the corresponding chloroplast subcellular structures.

[0055] Using a Zeiss LSM 900 inverted laser confocal scanning microscope equipped with an Airyscan system, subcellular localization of calcium imaging probes in transgenic tomato plants was analyzed. The specific steps were as follows: a temporary mount of the lower epidermis of the leaf was prepared. Cotyledons of five transgenic lines at the two-leaf-one-heart stage were taken: the cytoplasmic localization line without specific signal peptide (GCaMP6m), the chloroplast outer membrane calcium imaging line (CHLoC-G), the chloroplast inner membrane calcium imaging line (CHLiS-G), the chloroplast matrix calcium imaging line (CHLS-G), and the thylakoid membrane outer calcium imaging line (CHLtoS-G). The lower epidermis of the leaf was gently peeled off with pointed tweezers and placed flat in the center of a glass slide with sterile distilled water added, avoiding the formation of air bubbles. A coverslip was then placed on top to prepare a temporary mount. Imaging Operation and Parameter Settings: The prepared temporary slide was placed on the microscope stage. First, using a 10× objective lens, the guard cell region of the stomatal fossa was located through the bright-field white light channel. Then, the objective lens was switched to 40×, and the following fluorescence channel signals were acquired sequentially: Bright-field white light channel; GFP fluorescence channel: excitation wavelength 488nm, emission light acquisition range 500–550nm, laser power 5%, gain 700; Chlorophyll autofluorescence channel: excitation wavelength 488nm, emission light acquisition range 650–700nm, laser power 5%, gain 650. Subcellular Co-localization Analysis: The acquired multi-channel fluorescence images were overlaid and analyzed using Zeiss ZEN software to observe the co-localization of GFP fluorescence signals and chlorophyll autofluorescence signals. Figure 2 Image (A) shows the fluorescence of GCaMP6m in the cytoplasm, confirming its cytoplasmic location. Figure 2 Image (B) shows that CHLoC-G fluorescence is located outside the autofluorescence of chlorophyll, confirming its localization on the outer membrane of the chloroplast. Figure 2 Image C shows that the fluorescence of CHLiS-G mainly coincides with the edge of chlorophyll autofluorescence, confirming its localization in the chloroplast inner membrane. Figure 2 (D) shows that the fluorescence of CHLS-G coincides with the autofluorescence of chlorophyll, confirming its location in the chloroplast stroma. Figure 2 Image (E) shows that the fluorescence of CHLtoS-G coincides with the autofluorescence of chlorophyll, confirming its localization on the outer side of the thylakoid membrane. These results demonstrate that, compared to the cytoplasmic localization line (GCaMP6m) lacking a specific signal peptide, the fusion vector was successfully expressed in transgenic tomato plants, and the recombinant protein was successfully expressed on the outer chloroplast membrane, inner chloroplast membrane, chloroplast stroma, and outer side of the thylakoid membrane.

[0056] S140. High temperature stress was applied to the obtained transgenic plants, and time-series fluorescence images were continuously acquired using a fluorescence microscope to calculate the relative calcium signal intensity, thereby realizing real-time dynamic monitoring of calcium signals in different subcellular structures of chloroplasts.

[0057] The differences in calcium signal changes in subcellular structures of cytoplasmic localization lines without specific signal peptides and four transgenic tomato chloroplast calcium imaging lines under different high-temperature stresses were monitored using a Zeiss Axio Observer 3 inverted fluorescence microscope. The specific steps are as follows: Transgenic tomato lines at the two-leaf-one-heart stage (GCaMP6m, CHLOC-G, CHLiS-G, CHLS-G, CHLtoS-G) were collected, and the lower epidermis of the leaves was peeled off and placed in freshly prepared stomatal opening solution (containing 100 mM CaCl2, 5 mM KCl, and 10 mM MES-Tris, with pH adjusted to 6.15 using Tris-HCl) at room temperature and light intensity (120 μmol / m²). -2 s -1 After 3 hours of treatment, the prepared temporary slides were placed on the microscope stage. Ten stable baseline fluorescence images were acquired before treatment. Then, 3 ml of preheated stomatal-opening solution (24℃, 37℃, and 42℃) was added to completely immerse the sample. This experiment was repeated three times. Imaging parameters were uniformly set to 488 nm single-mode laser excitation. MetaFluor software was used to control the microscope system to continuously acquire images for 5 minutes at a frequency of 2 seconds per frame, and the raw fluorescence data was saved. Finally, FIJI (ImageJ) software was used for quantitative analysis of the raw fluorescence images. Regions of interest (ROIs) of uniform size were drawn along the edges of corresponding subcellular structures of individual chloroplasts, and background ROIs of the same size were drawn in the cell-free background area. The corrected fluorescence intensity F was calculated. 校正 =F 原始 -F 背景 Using the average corrected fluorescence intensity of the 10 stable frames before high-temperature processing as the baseline F0, the relative calcium signal intensity ΔF / F0 = (F 校正 -F0) / F0, and statistically compare the onset response time, peak intensity, peak time and half decay time of calcium signals in each group, and plot them using Origin 2024 software.

[0058] Experimental results and analysis: such as Figure 3 As shown, under normal temperature (24℃) treatment, from Figure 3 As shown in (A), (B), (C), (D), and (E), compared to cytoplasmic localization lines without specific signal peptides, no significant calcium signal fluctuations were detected at any subcellular site of the chloroplasts in the four lines, and ΔF / F0 maintained a stable baseline level. This indicates that under normal temperature conditions, the calcium probes of the transgenic lines did not exhibit spontaneous calcium responses, and the baseline remained stable. Figure 4 As shown, under high temperature treatment at 37℃, Figure 4No changes in calcium signal were detected in the cytoplasm or near the outer membrane of chloroplasts in (A) and (B), while changes in chloroplast stroma calcium signal induced by high-temperature stress were detected in (C), (D), and (E). This indicates that high-temperature-induced calcium signal elevations can be detected at sites in the inner membrane, stroma, and outer thylakoid membrane of chloroplasts, with the calcium signal reaching its peak approximately 50 seconds after treatment and then gradually decreasing. No significant changes in calcium signal were detected in the cytoplasm or outer membrane of chloroplasts, suggesting that chloroplasts may be important calcium signal sensing organelles in plant responses to high-temperature stress, and that they generate high-temperature-induced calcium signals prior to the cytoplasm. Figure 5 As shown, under extreme high temperature stress of 42℃, Figure 5 Images (C), (D), and (E) show that calcium signals at sites on the outer side of the chloroplast inner membrane, stroma, and thylakoid membrane, respectively, peak approximately 50 seconds after treatment and then gradually decrease. Figure 5 In the treatment of (A), the calcium signal in the cytoplasm gradually increased after about 60 seconds, but the magnitude and intensity of the increase were significantly lower than those in the chloroplast stroma. In contrast, [the text abruptly ends here]. Figure 5 (A) Compared to, Figure 5 (B) The calcium signal at the chloroplast outer membrane site also began to increase approximately 60 seconds after treatment, reaching a peak around 180 seconds before slowly declining. However, the detection sensitivity for calcium signal was significantly higher than that of the cytoplasmic localization line (GCaMP6m) without a specific signal peptide. This result indicates that under extreme high-temperature stress, the calcium response at the chloroplast outer membrane site lags behind that inside the chloroplast. The calcium signal may originate from transmembrane transduction of calcium signals from the chloroplast matrix or co-activation of cytoplasmic calcium signals. Subsequently, the signal begins to decline, suggesting that under extreme high-temperature stress, the calcium signal at the chloroplast outer membrane may be transduced from the chloroplast matrix to the cytoplasm, or it may be due to cytoplasmic calcium signals caused by increased reactive oxygen species due to high-temperature stress.

[0059] In summary, the calcium imaging system constructed in this invention can clearly distinguish the changes in calcium signals in different subcellular compartments of chloroplasts, and the monitoring results have good repeatability. Under different degrees of high temperature stress, there are significant differences in the timing and intensity of calcium response at different subcellular sites of chloroplasts. When plants respond to high temperature stress, calcium signals are first generated in the chloroplast stroma, and can be further transmitted to the cytoplasm as the stress level increases, showing regional and temporal regulatory characteristics.

[0060] The above are merely preferred embodiments of this application. It should be noted that this application is not limited to the above embodiments. For those skilled in the art, several improvements and modifications can be made without departing from the principles of this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should also be considered within the scope of protection of this application.

Claims

1. A method for monitoring sub-compartment-specific calcium in plant chloroplasts based on green fluorescent protein, characterized in that, include: S100. Specific signal peptides targeting the outer membrane of chloroplasts, the inner membrane of chloroplasts, the chloroplast stroma, and the outer membrane of thylakoids are fused with the N-terminus of the calcium indicator GCaMP6m to obtain fusion fragments. The fusion fragments are cloned to construct four recombinant expression vectors. S120. The four recombinant expression vectors are introduced into recipient plants respectively to obtain transgenic plants that stably express each calcium imaging probe. S140. High temperature stress was applied to the obtained transgenic plants, and time-series fluorescence images were continuously acquired using a fluorescence microscope to calculate the relative calcium signal intensity, thereby realizing real-time dynamic monitoring of calcium signals in different subcellular structures of chloroplasts.

2. The method according to claim 1, characterized in that, The specific signal peptide targeting the outer membrane of chloroplasts is the AtOEP7 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:1; the specific signal peptide targeting the inner membrane of chloroplasts is the AtTIC21 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:2; the specific signal peptide targeting the chloroplast stroma is the AtBAM4 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:3; and the specific signal peptide targeting the outer membrane of thylakoids is the AtSTN7 signal peptide, whose nucleotide sequence is shown in SEQ ID NO:

4.

3. The method according to claim 1, characterized in that, The nucleotide sequence of the calcium indicator GCaMP6m is shown in SEQ ID NO:

5.

4. The method according to claim 1, characterized in that, The cloning process involved cloning each fusion fragment into the pHELLSGATE8 plant binary expression vector driven by the CaMV35S promoter.

5. The method according to claim 1, characterized in that, The recipient plant is either Micro-Tom tomato or MoneyMaker tomato.

6. The method according to claim 1, characterized in that, Before applying stress treatment to the obtained transgenic plants, the process also includes S130, using a laser confocal microscope to perform fluorescence imaging on the transgenic plants to verify the targeting effect of each calcium imaging probe on the corresponding chloroplast subcellular structure.

7. The method according to claim 6, characterized in that, The excitation wavelength of the GFP fluorescence channel in laser confocal microscopy imaging is 488 nm, and the emission light acquisition range is 500-550 nm; the excitation wavelength of the chlorophyll autofluorescence channel is 488 nm, and the emission light acquisition range is 650-700 nm.

8. The application of the method according to any one of claims 1-7 in monitoring calcium signals in plant chloroplasts.

9. A plant chloroplast sub-compartment-specific calcium imaging detection kit, characterized in that, It contains four recombinant expression vectors, namely: AtOEP7-GCaMP6m fusion expression vector targeting the outer membrane of chloroplasts, AtTIC21-GCaMP6m fusion expression vector targeting the inner membrane of chloroplasts, AtBAM4-GCaMP6m fusion expression vector targeting the chloroplast stroma, and AtSTN7-GCaMP6m fusion expression vector targeting the outer membrane of thylakoids.

Images