Confinement effect triggered synergistic nanomachine catalytic assembly detection system and method

Abstract

The application relates to the technical field of biological detection, in particular to a limited effect triggered cooperative nanomachine catalytic assembly detection system and method. The application adopts a nanotransducer with surface-fixed first recognition probes and pre-hybridized catalytic chains, a nanomagnifier with surface-fixed hairpin probes, and a functionalized hydrogel electrode loaded with the nanomagnifier. The target-mediated spatial co-location of the first and second recognition probes triggers the release of the catalytic chains, and then the catalytic hairpin assembly reaction is started, so that a methylene blue labeled signal probe is enriched on the electrode interface. The sequential coupling of protein target recognition, nucleic acid signal conversion and cyclic amplification is realized through differential pulse voltammetry detection. The application does not need to participate in the antibody and enzyme, the limit of procalcitonin detection can reach 2.35*10 ‑4 ng / mL, the reaction can be completed at room temperature for 10 minutes, the specificity, repeatability and storage stability are good, the application can be extended for detection of various protein biomarkers, and is suitable for dispersed detection and high-frequency sample analysis scenes.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically a confinement effect-triggered synergistic nanomachine catalytic assembly detection system and method. Background Technology

[0002] Protein biomarker detection is widely used in the assessment of infection, inflammation, and disease progression. Current methods for protein biomarker detection mostly employ antibodies or enzymes for target recognition and signal amplification. However, the relevant protein components are sensitive to temperature, transportation, and storage conditions. The detection process typically involves multiple steps of incubation, washing, and signal labeling, increasing detection costs and operational complexity, which is unfavorable for decentralized detection scenarios. Nucleic acid aptamers, on the other hand, are easy to chemically synthesize, have designable sequences, flexible modification methods, good batch-to-batch consistency, and high storage stability. Through sequence design and structural regulation, nucleic acid probes with recognition, signal transduction, and catalytic functions can be constructed, providing a technological basis for reducing the dependence of detection systems on antibodies and enzymes.

[0003] Nucleic acid strand substitution and catalytic hairpin assembly can achieve nucleic acid signal transduction and cyclic amplification under enzyme-free conditions. However, protein targets usually cannot be directly used as the initiating strand for nucleic acid catalytic assembly; protein recognition events still need to be converted into nucleic acid signals that can drive downstream reactions. Under free diffusion conditions, the local effective concentration and collision probability between nucleic acid probes are low, which can easily lead to limited reaction kinetics. Increasing the probe concentration may increase non-specific strand substitution, background leakage, and a decrease in signal-to-noise ratio.

[0004] In existing protein detection methods based on nucleic acid aptamers and catalytic nucleic acid assembly, the coupling efficiency between signal conversion and downstream amplification reactions is low. Furthermore, target recognition, signal conversion, and cyclic amplification are usually performed by independent reaction units, making it difficult to balance detection sensitivity, reaction speed, and system stability. How to utilize spatial confinement to increase the local effective concentration of recognition probes and effectively couple protein target recognition with nucleic acid catalytic assembly is a technical problem that urgently needs to be solved in the current technology. Summary of the Invention

[0005] The purpose of this invention is to provide a detection system and method for synergistic nanomachine catalytic assembly triggered by confinement effect, so as to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] A confinement effect-triggered synergistic nanomachine catalytic assembly and detection system includes a target recognition element, a nucleic acid signal amplification element, and an electrochemical detection element;

[0008] The target recognition element comprises a nanotransistor and a free second recognition probe;

[0009] The nanotransistor includes a first nanoparticle carrier, on the surface of which a first recognition probe is fixed, and a catalytic chain is pre-hybridized on the first recognition probe.

[0010] Both the first recognition probe and the second recognition probe are nucleic acid aptamers capable of specifically binding to different binding regions of the target protein;

[0011] The nucleic acid signal amplification element includes a signal hairpin probe and a nano-amplifier;

[0012] The nanoamplifier includes a second nanoparticle carrier, on the surface of which a fixed hairpin probe is fixed; the signal hairpin probe is labeled with an electroactive signal molecule.

[0013] The electrochemical detection element is a functionalized hydrogel electrode, comprising a base electrode and a composite hydrogel layer modified on the surface of the base electrode, and the nanoamplifier is loaded in the porous network structure of the composite hydrogel layer;

[0014] The detection system is configured to trigger the release of the catalytic chain through target-mediated spatial co-localization of dual recognition probes, thereby initiating a catalytic hairpin assembly reaction, which enriches the signal hairpin probe carrying electroactive signal molecules at the interface of the functionalized hydrogel electrode and generates an electrochemical response.

[0015] As a further aspect of the present invention: both the first nanoparticle carrier and the second nanoparticle carrier are gold nanoparticles;

[0016] Both the first identification probe and the fixed hairpin probe are fixed to the surface of the corresponding gold nanoparticles by gold-sulfur bonds formed by thiol modification.

[0017] As a further aspect of the present invention: the composite hydrogel layer is a hydrogel layer formed by polyacrylamide, phytic acid and polydopamine, and the substrate electrode is a screen-printed carbon electrode.

[0018] The nanoamplifier is loaded within the porous network structure of the composite hydrogel layer through a swelling-shrinkage cycle.

[0019] As a further aspect of the present invention: the electroactive signal molecule is methylene blue, and the signal hairpin probe is a methylene blue-terminated hairpin structure nucleic acid probe.

[0020] As a further aspect of the present invention: the target protein to be tested is procalcitonin;

[0021] The first recognition probe and the second recognition probe specifically bind to different binding regions of procalcitonin, respectively.

[0022] A method for detecting the synergistic nanomachine catalytic assembly triggered by confinement effects, comprising the following steps:

[0023] (1) Construction of detection reaction system: The second recognition probe, the signal hairpin probe labeled with electroactive signal molecules and the nanotransducer are dispersed in buffer solution to obtain detection reaction solution;

[0024] The detection reaction solution is brought into contact with a functionalized hydrogel electrode loaded with a nano-amplifier, so that the working area of ​​the electrode is immersed in the reaction solution;

[0025] The surface of the nanotransducer is fixed with a first recognition probe and pre-hybridized with a catalytic chain, and the surface of the nanoamplifier is fixed with a hairpin probe.

[0026] (2) Target-mediated catalytic chain release: The sample to be tested is added to the detection reaction system and the reaction is incubated so that the protein target in the sample binds to the first recognition probe and the second recognition probe at the same time, mediating the spatial co-localization of the two recognition probes on the surface of the nanotransducer, and releasing the catalytic chain through the toe-mediated chain displacement reaction;

[0027] (3) Catalytic hairpin assembly and signal enrichment: The released catalytic chain combines with the signal hairpin probe and opens the hairpin structure. The opened signal hairpin probe hybridizes with the fixed hairpin probe on the surface of the nano-amplifier to form a double-chain complex. At the same time, the catalytic chain is released to trigger multiple rounds of catalytic hairpin assembly reaction, so that the signal hairpin probe carrying electroactive signal molecules is enriched at the interface of the functionalized hydrogel electrode.

[0028] (4) Electrochemical quantitative detection: After washing to remove unbound free probes, the electrochemical response signal of the functionalized hydrogel electrode is collected, and the concentration of protein target in the sample is determined based on the intensity of the response signal.

[0029] As a further aspect of the present invention: the incubation reaction in steps (2) and (3) is carried out at room temperature of 20-30°C, and the total reaction time is 8-12 minutes.

[0030] As a further aspect of the present invention: Step (4) uses differential pulse voltammetry to collect electrochemical response signals, takes the peak current difference between the test sample and the blank control sample as the quantitative basis, and calculates the target concentration through a pre-established standard curve of peak current difference and target concentration.

[0031] As a further aspect of the present invention: replacing the first recognition probe and the second recognition probe with those corresponding to different binding regions of the target protein, respectively, to detect different types of protein biomarkers.

[0032] Application of the confinement effect-triggered synergistic nanomachine catalytic assembly detection system described above in the quantitative detection of protein biomarkers in in vitro serum samples.

[0033] Compared with the prior art, the beneficial effects of the present invention are:

[0034] This invention utilizes the synergistic effect of nanotransducers and nanoamplifiers to sequentially convert protein target-mediated dual-recognition probe recognition into confinement effect-triggered catalytic chain release, catalytic hairpin assembly, and electrochemical signal output. Under conditions that do not depend on protein antibodies and enzymes, it achieves sequential coupling of protein target recognition, nucleic acid signal conversion, and cyclic amplification.

[0035] In terms of detection performance, under optimized conditions, the linear detection range of this invention for procalcitonin is 10. -3 ~10 3 ng / mL, correlation coefficient R 2 The value was 0.985, and the detection limit was 2.35 × 10⁻⁶. -4 ng / mL; Compared with non-nanomachinery systems using free-diffusion probes, nanotransducers significantly improve catalytic chain release efficiency and detection sensitivity by increasing the local effective concentration of the recognition probe. The detection reaction can be completed within 10 min at room temperature, and the detection procedure is simple and rapid;

[0036] Regarding detection specificity and stability, this invention exhibits a significant electrochemical response to procalcitonin, while the signals produced by the same concentrations of calcitonin, C-reactive protein, interleukin-6, and B-type natriuretic peptide are close to those of the blank control. No significant cross-response was observed for the tested potential interfering substances. Twenty independent tests were performed on the same procalcitonin-containing sample on different dates, and the results showed good consistency. After storage for four weeks, the pre-prepared detection system retained over 85% of the initial signal at 4°C and over 80% of the initial signal at room temperature, demonstrating good detection repeatability and storage stability.

[0037] In practical applications, using 0.1 ng / mL as a reference threshold, the classification results of clinical serum samples obtained by this invention are consistent with those of the central laboratory reference method; the relative standard deviation of repeated tests for samples above the reference threshold is less than 8.5%, and the relative standard deviation of all samples is less than 10%, which can be used for the quantitative detection of procalcitonin in in vitro serum samples.

[0038] The target concentration variation trend obtained by detecting isolated serum samples collected at different time points is basically consistent with the detection results of the reference method, which can improve the temporal resolution of continuous sample detection. In addition, by replacing the first recognition probe and the second recognition probe, which can bind to different binding regions of the target protein respectively, this detection system can be extended to the detection of other protein biomarkers, providing a technical basis for decentralized detection and high-frequency sample analysis. Attached Figure Description

[0039] Figure 1 This is a schematic diagram illustrating the detection principle of the confinement effect-triggered synergistic nanomachine catalytic assembly detection system in an embodiment of the present invention.

[0040] Figure 2 These are structural and electrochemical performance characterization diagrams of the nanotransducer, nanoamplifier, and functionalized hydrogel electrode in the embodiments of the present invention;

[0041] In the figures, a is the transmission electron microscope image of the nanotransducer; b is the UV-Vis absorption spectrum of the bare gold nanoparticles and nanotransducer; c is the hydration particle size distribution of the bare gold nanoparticles and nanotransducer; d is the Zeta potential test result of the bare gold nanoparticles and nanotransducer; e is the transmission electron microscope image of the nanoamplifier; f is the UV-Vis absorption spectrum of the bare gold nanoparticles and nanoamplifier; g is the hydration particle size distribution of the bare gold nanoparticles and nanoamplifier; h is the Zeta potential test result of the bare gold nanoparticles and nanoamplifier; i is the scanning electron microscope image and energy dispersive spectroscopy elemental mapping of the PAAM / PA / PDA hydrogel without nanoamplifier; j is the scanning electron microscope image and energy dispersive spectroscopy elemental mapping of the PAAM / PA / PDA hydrogel with nanoamplifier; k is the retention rate curve of gold element in the hydrogel after different immersion times; l is the cyclic voltammetry curve of different modified electrodes; m is the differential pulse voltammetry curve of different modified electrodes; and n is the electrochemical impedance spectroscopy of different modified electrodes.

[0042] Figure 3 This diagram illustrates the feasibility verification of the synergistic nanomachine catalytic assembly and detection system in this embodiment of the invention.

[0043] Among them, a is the result of NUPACK software predicting the catalytic chain leakage rate and the catalytic chain release efficiency triggered by the confinement effect under targetless conditions; b is a schematic diagram of the principle of simulated dual-probe spatial co-localization in the biotin-streptavidin system; c is the result of polyacrylamide gel electrophoresis verifying the catalytic chain release triggered by the confinement effect; d is the result of agarose gel electrophoresis verifying the catalytic chain-mediated catalytic hairpin assembly; and e is a curve of real-time fluorescence monitoring of the catalytic hairpin assembly reaction kinetics.

[0044] Figure 4The figure shows the optimized conditions for the detection reaction of the synergistic nanomachine catalytic assembly in an embodiment of the present invention.

[0045] Among them, a is the effect of different swelling-shrinkage cycles on the loading of the nanoamplifier; b is the peak current difference at different concentrations of methylene blue labeled hairpin probes; c is the fluorescence signal of the catalytic chain released by the target and untargeted groups at different concentrations of the second recognition probe; d is the peak current difference at different concentrations of nanotransducers; e is the differential pulse voltammetry peak current of the untargeted, low-concentration target and high-concentration target samples at different reaction times; f is the peak current difference between low-concentration target and high-concentration target samples at different reaction temperatures.

[0046] Figure 5 This is a graph showing the sensitivity and specificity evaluation results of procalcitonin detection in this embodiment of the invention;

[0047] Among them, a is the differential pulse voltammetric response curve of procalcitonin samples with different concentrations; b is the standard curve between the peak current difference and the concentration of procalcitonin; c is the comparison of the detection response of the nanotransducer system and the free-diffusion nucleic acid probe system; d is the bar chart of the specific detection results of procalcitonin and potential interfering substances.

[0048] Figure 6 This is a graph showing the repeatability and storage stability evaluation results of the prefabricated detection system in this embodiment of the invention;

[0049] In this figure, a is the repeatability evaluation result of 20 independent tests on the same procalcitonin sample; b is the signal retention rate curve of the prefabricated reaction unit after being stored at 4°C for different times; and c is the signal retention rate curve of the prefabricated reaction unit after being stored at room temperature for different times.

[0050] Figure 7 This is a graph showing the application results of the detection system in clinical serum sample detection and dynamic monitoring in this embodiment of the invention;

[0051] In this figure, a is a comparison of the detection results of clinical serum samples by the detection method of this invention and the reference method of the central laboratory; b is a comparison of the dynamic monitoring results of the patient's procalcitonin level from preoperative to postoperative period. Detailed Implementation

[0052] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0053] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0054] Please see Figures 1-7 This embodiment uses procalcitonin as the target protein to fully illustrate the confinement effect-triggered synergistic nanomachine catalytic assembly detection system and detection method described in this invention. All oligonucleotide sequences involved in this embodiment were chemically synthesized using the solid-phase phosphoramide method. The specific base sequences and modification information of each sequence are shown in the table below, with corresponding sequence numbers from SEQ ID NO:1 to SEQ ID NO:13.

[0055] Table 1. Oligonucleotide sequence information used in this embodiment.

[0056] sequence name Base sequence (5'→3') and modification information The first identification probe, Apt-α (SEQ ID NO:1) Thiol-TTTTTTTTTTGTCAGTGAGCTAGGTTAGATGTCGTCTTTTTTTTTTTTTTTTTTTTTCCCTACGGCGCTAACCCCACAACCCGAGTACAA The second recognition probe, Apt-β (SEQ ID NO:2) TATCCCCACGCCGCCACCGTGCTACAACTTTTTTTTTTTTTTTTTTGACGACATCTAACCTAGC Catalytic chain (SEQ ID NO:3) CGACATCTAACCTAGCTCACTGAC Fluorescently labeled catalytic chain (SEQ ID NO:4) CGACATCTAACCTAGCTCACTGAC-Carboxyfluorescein Methylene blue labeled signal hairpin probe H1-MB (SEQ ID NO:5) Methylene Blue -GTCAGTGAGCTAGGTTAGATGTCGCCATGTGTAGACGACATCTAACCTAGC Nanoamplifier-fixed hairpin probe H2 (SEQ ID NO:6) AGATGTCGTCTACACATGGCGACATCTAACCTAGCCCATGTGTAGATTTTTTTTTT-mercapto Unlabeled signal hairpin probe H1 (SEQ ID NO:7) GTCAGTGAGCTAGGTTAGATGTCGCCATGTGTAGACGACATCTAACCTAGC Unlabeled hairpin probe H2 (SEQ ID NO:8) AGATGTCGTCTACACATGGCGACATCTAACCTAGCCCATGTGTAGA Control probe 1 (SEQ ID NO:9) TTTTTTTTTTGTCAGTGAGCTAGGTTAGATGTCGTCTTTTTTTTTT-Biotin Control probe 2 (SEQ ID NO:10) Biotin-TTTTTTTTTTGACGACATCTAACCTAGC NUPACK simulation uses co-localization to simulate sequences (SEQ ID NO:11) GTCAGTGAGCTAGGTTAGATGTCGTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACGACATCTAACCTAGC NUPACK simulates the first identification probe (SEQ ID NO:12) GTCAGTGAGCTAGGTTAGATGTCGTCTTTTTTTTTTTTTTTTTTTTTCCCTACGGCGCTAACCCCACAACCCGAGTACAA Second recognition probe for NUPACK simulation (SEQ ID NO:13) TATCCCCACGCCGCCACCGTGCTACAACTTTTTTTTTTTTTTTTTTTTGACGACATCTAACCTAGC

[0057] The TNaK buffer used in this embodiment has the following conventional components: 20 mmol / L tris(hydroxymethyl)aminomethane-hydrochloric acid buffer, 140 mmol / L sodium chloride, and 5 mmol / L potassium chloride, with the pH adjusted to 7.5. This buffer composition is a conventional and well-known configuration for nucleic acid reaction systems in the art and can be adaptively adjusted according to actual reaction requirements.

[0058] Fabrication and characterization of 1-nanometer transducers

[0059] The nanotransducer uses gold nanoparticles as a carrier, with the first recognition probe Apt-α immobilized on the surface and pre-hybridized with the catalytic chain. This allows for the triggering of catalytic chain release under target-mediated confinement effects, thereby converting protein recognition signals into nucleic acid catalytic signals.

[0060] 1.1 Fabrication of nanotransistors

[0061] Take 1 mL of a gold nanoparticle suspension with a concentration of 1.5 mg / mL and a core particle size of approximately 50 nm. Add 100 μL of a thiol-modified first recognition probe Apt-α (SEQ ID NO:1) with a concentration of 1 μmol / L to the suspension. After gently mixing, incubate at room temperature for 12 h to fix the thiol probe onto the surface of the gold nanoparticles via gold-sulfur bonds.

[0062] After incubation, a stepwise salt addition method was used for salt aging treatment: sodium chloride solution was added to the system in multiple batches to make the final sodium chloride concentration in the system reach 0.3 mol / L. After each addition of sodium chloride, the mixture was gently mixed and allowed to stand at room temperature for 30 min. After all the sodium chloride was added, the system was incubated at room temperature for another 24 h to improve the modification density and stability of the probe on the particle surface.

[0063] After salt aging, the system was centrifuged at 12,000 rpm for 20 min, the supernatant was discarded, and the unbound free probe was removed. The resulting precipitate was resuspended in 1 mL of a 200 nmol / L solution of the catalytic chain (SEQ ID NO:3), mixed thoroughly, and heated at 90 °C for 10 min. Then, it was slowly cooled to room temperature at a rate of 1 °C / min to allow the first recognition probe Apt-α to complete complementary hybridization with the catalytic chain.

[0064] After the hybridization reaction was completed, the sample was centrifuged again at 12,000 rpm for 20 min, the supernatant was discarded, the precipitate was washed twice with TNaK buffer, and finally the precipitate was resuspended in TNaK buffer to obtain the nanotransducer. Its storage concentration was about 1 mg / mL, and it was stored at 4℃ for later use.

[0065] Characterization effect of 1.2 nanometer transducers

[0066] The fabricated nanotransistors were characterized by transmission electron microscopy, UV-Vis absorption spectroscopy, dynamic light scattering, and Zeta potential measurement. The results are as follows:

[0067] Transmission electron microscopy revealed that the fabricated nanotransistors exhibited a uniform spherical morphology, good particle dispersion, and no obvious agglomeration.

[0068] The UV-Vis absorption spectroscopy results showed that the characteristic surface plasmon resonance absorption peak of the bare gold nanoparticles was located at 530 nm. After probe modification and hybridization of the catalytic chain, the absorption peak red-shifted to 545 nm, indicating that nucleic acid molecules were successfully modified on the particle surface.

[0069] Dynamic light scattering tests showed that the hydrated particle size of the bare gold nanoparticles was approximately 77.67 nm, while the hydrated particle size of the fabricated nanotransducers increased to 102.65 nm, corresponding to the formation of a nucleic acid layer on the particle surface.

[0070] The zeta potential test results showed that the zeta potential of the bare gold nanoparticles was -7.77±0.69mV, while the zeta potential of the nanotransducer decreased to -12.78±1.35mV. The enhanced negative charge is consistent with the negative charge characteristics of nucleic acid molecules.

[0071] The above characterization results collectively demonstrate that this embodiment successfully prepared a structurally stable and uniformly modified nanotransistor.

[0072] Fabrication and characterization of 2-nanometer amplifiers

[0073] The nanoamplifier uses gold nanoparticles as a carrier and immobilizes hairpin probes H2 on the surface to carry out catalytic hairpin assembly reactions mediated by the catalytic chain, thereby achieving enzyme-free cyclic signal amplification and interfacial enrichment of signal molecules.

[0074] 2.1 Fabrication of Nanoamplifiers

[0075] Take 1 mL of a gold nanoparticle suspension with a concentration of 1.5 mg / mL and a core particle size of approximately 50 nm. Add 100 μL of a thiol-modified hairpin probe H2 (SEQ ID NO:6) with a concentration of 1 μmol / L to the suspension. After gently mixing, incubate at room temperature for 12 h to fix the thiol probe onto the surface of the gold nanoparticles via gold-sulfur bonds.

[0076] After incubation, a stepwise salt addition method was used for salt aging treatment: sodium chloride solution was added to the system every 30 minutes, gradually increasing the sodium chloride concentration in the system to a final concentration of 0.3 mol / L. After all the sodium chloride was added, the system was incubated at room temperature for another 24 hours to improve the surface modification density and structural stability of the hairpin probe.

[0077] After salt aging, the system was centrifuged at 12,000 rpm for 20 min, the supernatant was discarded, the precipitate was washed twice with TNaK buffer, and finally the precipitate was resuspended in TNaK buffer to obtain the nanoamplifier. Its storage concentration was about 1 mg / mL, and it was stored at 4℃ for later use.

[0078] 2.2 Characterization of Nanoamplifiers

[0079] The fabricated nanoamplifier was characterized by transmission electron microscopy, ultraviolet-visible absorption spectroscopy, dynamic light scattering, and Zeta potential measurement. The results are as follows:

[0080] Transmission electron microscopy revealed that the fabricated nanoamplifiers maintained a regular spherical morphology, exhibited good particle dispersion, and showed no obvious agglomeration. Ultraviolet-visible absorption spectroscopy showed that the characteristic absorption peak of the probe-modified gold nanoparticles red-shifted from 530 nm to approximately 540 nm, indicating that the hairpin probe was successfully fixed to the particle surface.

[0081] Dynamic light scattering test results showed that after modifying the hairpin probe, the hydrated particle size of the gold nanoparticles was significantly increased compared with the bare particles, corresponding to the formation of the surface nucleic acid layer.

[0082] Zeta potential test results showed that after modifying the hairpin probe, the negative charge on the particle surface was further enhanced, consistent with the negative charge characteristics of nucleic acid molecules.

[0083] The characterization results above demonstrate that a structurally stable nanoamplifier was successfully prepared in this embodiment.

[0084] 3. Preparation of polyacrylamide / phytic acid / polydopamine composite hydrogel

[0085] Polyacrylamide / phytic acid / polydopamine (PAAM / PA / PDA) composite hydrogels are used to construct three-dimensional porous electrode interfaces, providing loading space for nanoamplifiers, promoting catalytic assembly reactions to occur near the electrode interface, and improving electrochemical signal output efficiency.

[0086] 3.1 Preparation of hydrogel precursor solution

[0087] 667 μL of a 6.0 mol / L acrylamide solution, 250 μL of a 0.54 mol / L phytic acid solution with pH 7.5, 250 μL of a 0.02 mol / L N,N′-methylenebisacrylamide solution, and 250 μL of deionized water were measured sequentially, thoroughly mixed, and then subjected to ultrasonic treatment. Argon gas was then introduced for degassing for 10 min to remove dissolved oxygen from the system and prevent it from interfering with the free radical polymerization reaction.

[0088] After degassing, 410 μL of 0.17 mol / L dopamine hydrochloride solution was added to the system, and the mixture was sonicated for 5 min to ensure homogeneity. Subsequently, 85.20 mg of potassium persulfate was added to the system as an initiator, and the mixture was sonicated for 15 min to ensure complete dissolution of the initiator.

[0089] Finally, 0.5 μL of N,N,N′,N′-tetramethylethylenediamine was added to the system as an accelerator, and after gentle mixing, the PAAM / PA / PDA composite hydrogel precursor solution was obtained and immediately used for subsequent electrode modification operations.

[0090] 4. Fabrication and Characterization of Functionalized Hydrogel Electrodes for Loaded Nanoamplifiers

[0091] 4.1 Fabrication of Functionalized Hydrogel Electrodes

[0092] A C2000 screen-printed carbon electrode was used as the substrate electrode, and its working electrode was a circular carbon electrode with a diameter of 4 mm. The functionalized hydrogel electrode supporting the nanoamplifier was prepared according to the following steps:

[0093] The first step, electrode activation and crosslinking agent modification: 3 μL of 0.5% (w / v) glutaraldehyde solution was dropped onto the working electrode surface of the screen-printed carbon electrode and dried at 37°C for 30 min, so that glutaraldehyde could be covalently bound to the electrode surface, providing crosslinking binding sites for the hydrogel.

[0094] The second step is in-situ polymerization of hydrogel: 3 μL of freshly prepared PAAM / PA / PDA composite hydrogel precursor solution is dropped onto the surface of the treated working electrode and allowed to stand at room temperature for 45 min to allow the precursor solution to complete in-situ polymerization and form a hydrogel film; after the reaction is completed, the electrode is gently rinsed three times with 5 mL of deionized water to remove unpolymerized residual monomers.

[0095] The third step is to cyclically load the nanoamplifier by swelling and shrinking: the hydrogel-modified electrode is sequentially immersed in acetone solution, nanoamplifier suspension with a concentration of 1 mg / mL, and deionized water, with each step lasting 2 min. The above process constitutes one swelling and shrinking loading cycle. After three consecutive loading cycles, the nanoamplifier permeates through the porous network of the hydrogel and is fixed inside the hydrogel, thus obtaining the functionalized hydrogel electrode loaded with the nanoamplifier, which is stored at room temperature for later use.

[0096] 4.2 Characterization results of functionalized hydrogel electrodes

[0097] The functionalized hydrogel electrode was characterized by scanning electron microscopy, energy dispersive spectroscopy (EDS) elemental analysis, and electrochemical tests. The results are as follows: Scanning electron microscopy showed that the prepared PAAM / PA / PDA composite hydrogel had an interconnected porous structure with a pore size range of approximately 3.3–7.9 μm. This three-dimensional porous structure can provide sufficient loading space for the nanoamplifier and facilitate the diffusion and reaction of nucleic acid probes.

[0098] Scanning electron microscopy-energy dispersive spectroscopy elemental mapping analysis showed that there was a clear gold element signal in the hydrogel network after loading the nanoamplifier, and the gold element was evenly distributed, indicating that the nanoamplifier was successfully fixed inside the porous structure of the hydrogel.

[0099] The load stability test results showed that after immersing the functionalized hydrogel electrode in TNaK buffer for 48 hours, the gold content in the hydrogel did not decrease significantly, indicating that the nanoamplifier has good load stability in the hydrogel and is not prone to detachment.

[0100] Electrochemical characterization of electrodes at different modification stages was performed using cyclic voltammetry, differential pulse voltammetry, and electrochemical impedance spectroscopy. The results showed that the electrochemical response of the electrode decreased after modification with PAAM / PA / PDA hydrogel, which is related to the insulating properties of the hydrogel. However, the electrochemical response significantly recovered after loading a nanoamplifier, indicating that the introduction of gold nanoparticles improved the conductivity of the electrode interface. These results demonstrate that the fabricated functionalized hydrogel electrode possesses stable electrochemical performance and can be used for subsequent electrochemical detection.

[0101] 5. Detection Method for Synergistic Nanomachine Catalytic Assembly Triggered by Confinement Effect

[0102] The detection method described in this embodiment triggers the release of the catalytic chain through target-mediated spatial co-localization of dual recognition probes, thereby initiating a catalytic hairpin assembly reaction, which enriches signal molecules at the electrode interface to generate an electrochemical signal, thus achieving quantitative detection of procalcitonin.

[0103] 5.1 Preparation of the detection reaction system

[0104] An 800 μL detection reaction solution was prepared using TNaK buffer. The reaction solution contained a methylene blue-labeled signal hairpin probe H1-MB (SEQ ID NO:5) at a final concentration of 40 nmol / L, a second recognition probe Apt-β (SEQ ID NO:2) at a final concentration of 10 nmol / L, and a nanotransducer at a final concentration of 50 μg / mL.

[0105] The prepared detection reaction solution is added to the reaction unit of the functionalized hydrogel electrode equipped with a loaded nanoamplifier, so that the working electrode detection area of ​​the electrode is in full contact with the reaction solution.

[0106] 5.2 Target Response and Signal Generation Process

[0107] Add 200 μL of the isolated serum sample to be tested to the above reaction system, mix thoroughly, and react at room temperature for 10 min.

[0108] During the reaction, when the sample to be tested contains procalcitonin, procalcitonin can simultaneously bind to the first recognition probe Apt-α on the surface of the nanotransducer and the free second recognition probe Apt-β in the system, causing the two recognition probes to co-localize on the surface of the nanotransducer and generate a confinement effect. This confinement effect can significantly increase the local effective concentration of the second recognition probe and promote the toe-end mediated chain substitution reaction between the second recognition probe and the chain substitution region in the first recognition probe / catalytic chain complex, thereby releasing the catalytic chain from the surface of the nanotransducer into the reaction system.

[0109] The released free catalytic chain first binds to the methylene blue-labeled signal hairpin probe H1-MB, opening the hairpin structure of H1-MB and exposing a sequence that is complementary to the hairpin probe H2. Subsequently, the opened H1-MB hybridizes with the hairpin probe H2 fixed on the surface of the nanoamplifier to form an H1-MB / H2 double-stranded complex, while simultaneously releasing the catalytic chain back into the reaction system.

[0110] The released catalytic chain can continue to participate in the next round of catalytic reaction, sequentially opening new signal hairpin probes H1-MB and promoting their assembly with hairpin probes H2 on the surface of the nanoamplifier. As the catalytic hairpin assembly reaction continues, the signal hairpin probes carrying methylene blue labels are continuously enriched at the interface between the nanoamplifier and the electrode, causing a continuous enhancement of the differential pulse voltammetric signal.

[0111] After the reaction was completed, the reaction solution in the reaction system was removed, and the working area of ​​the electrode was gently washed three times with TNaK buffer to remove unbound free methylene blue-labeled signal hairpin probes and reduce background signal. Then the electrode was placed in blank TNaK buffer for electrochemical signal acquisition.

[0112] 5.3 Electrochemical Signal Acquisition and Result Determination

[0113] Electrochemical signals were acquired using differential pulse voltammetry, with the following detection parameters set: scan start potential -400mV, stop potential -200mV, pulse amplitude 20mV, potential step 5mV, pulse width 50ms, pulse period 200ms, and rest time 1000ms.

[0114] Record the differential pulse voltammetric peak current value of the detection system, calculate the peak current difference between the test sample and the blank control sample, and determine the procalcitonin concentration in the test sample based on the pre-established standard curve between the peak current difference and the target concentration, thus achieving quantitative detection of the target.

[0115] 6. Feasibility verification of the detection system

[0116] 6.1 Verification of catalytic chain release triggered by confinement effect

[0117] The interaction between the first and second recognition probes and the catalytic chain was simulated and predicted using NUPACK software. The results showed that under target-free conditions, no significant non-specific hybridization occurred between the first and second recognition probes. The first recognition probe / catalytic chain complex remained stable at room temperature, and the non-specific leakage rate of the catalytic chain was less than 0.5%. When procalcitonin mediated the spatial co-localization of the first and second recognition probes, the second recognition probe could competitively release approximately 93.37% of the catalytic chain through a toe-mediated chain displacement reaction, indicating that the confinement effect can serve as a highly efficient molecular switch for catalytic chain release.

[0118] Further, a biotin-streptavidin system was used to simulate the spatial co-localization process of procalcitonin-mediated dual-probe reaction, which was verified by polyacrylamide gel electrophoresis: After prehybridizing biotin-labeled control probe 1 (SEQ ID NO:9) with the catalytic chain, biotin-labeled control probe 2 (SEQ ID NO:10) and streptavidin were added. When streptavidin mediated the spatial co-localization of the two control probes, a clear free catalytic chain band appeared in the system; without the addition of streptavidin, no significant catalytic chain release was observed. These experimental results further demonstrate that the spatial confinement effect can effectively trigger the chain displacement reaction, achieving efficient release of the catalytic chain.

[0119] 6.2 Verification of the catalytic hairpin assembly reaction

[0120] Unlabeled signal hairpin probe H1 (SEQ ID NO:7) and unlabeled hairpin probe H2 (SEQ ID NO:8), both with a final concentration of 100 nmol / L, were added to TNaK buffer. A catalyst chain with a final concentration of 10 pmol / L was added to the system, and the reaction was carried out at 25 °C.

[0121] Agarose gel electrophoresis results showed that, without the catalytic chain, both signal hairpin probe H1 and hairpin probe H2 maintained stable hairpin structures and did not form obvious hybridization complexes. After the catalytic chain was added, obvious H1 / H2 hybridization complex bands appeared in the system, and their migration positions were consistent with those of the H1 / H2 complex bands prepared by the thermal annealing method, indicating that the catalytic chain could effectively trigger the catalytic hairpin assembly reaction of the two hairpin probes.

[0122] The reaction kinetics of catalytic hairpin assembly were monitored using real-time fluorescence. The results showed that after the addition of the catalytic chain, the fluorescence signal of the system increased rapidly and reached the reaction plateau within about 5 minutes. Without the addition of the catalytic chain, no significant increase in fluorescence signal was observed. This indicates that a small amount of catalytic chain can cyclically catalyze the continuous assembly of the two hairpin probes, achieving efficient amplification of enzyme-free nucleic acid signals.

[0123] 7. Optimization of detection reaction conditions

[0124] While keeping other reaction conditions constant, the number of loading cycles of the nanoamplifier, the concentration of the methylene blue-labeled signal hairpin probe H1-MB, the concentration of the second recognition probe Apt-β, the concentration of the nanotransducer, and the reaction time were optimized, and the effect of reaction temperature on the detection system was investigated.

[0125] 7.1nm amplifier load cycle optimization

[0126] The swelling-shrinkage loading cycle was set to 1 to 5 cycles, and the gold content in the hydrogel was determined by inductively coupled plasma mass spectrometry to characterize the loading capacity of the nanoamplifier. The results showed that the loading capacity of the nanoamplifier in the hydrogel gradually increased with the increase of the number of loading cycles, and tended to saturate after 3 loading cycles; further increasing the number of cycles did not significantly increase the loading capacity. Therefore, in this embodiment, 3 loading cycles are preferred as the loading condition for the nanoamplifier.

[0127] 7.2 Optimization of Methylene Blue Labeled Signal Hairpin Probe H1-MB Concentration

[0128] The concentration range of the methylene blue-labeled signal hairpin probe H1-MB was set to 10–100 nmol / L, and a 10 pmol / L catalyst chain was used to initiate the reaction for 10 min. Results showed that when the H1-MB concentration was 40 nmol / L, the system achieved a large peak current difference and a stable electrochemical response. Further increasing the probe concentration did not significantly improve the detection signal and may increase the negative background signal and reagent consumption. Therefore, in this embodiment, 40 nmol / L is preferred as the working concentration of the methylene blue-labeled signal hairpin probe H1-MB.

[0129] 7.3 Optimization of the concentration of the second recognition probe Apt-β

[0130] With the nanotransducer concentration fixed at 50 μg / mL, procalcitonin was added to the positive group at a final concentration of 10 ng / mL, while an equal volume of phosphate buffer was added to the negative group. The fluorescence signal of the catalytic chain release was detected at different concentrations of the second recognition probe. The results showed that as the concentration of the second recognition probe increased, the fluorescence signal in the positive group gradually increased, reaching a plateau at a concentration of 10 nmol / L. Further increasing the probe concentration did not significantly increase the positive signal, and the background signal in the negative group did not show a significant increase. Therefore, in this embodiment, 10 nmol / L is preferred as the working concentration of the second recognition probe Apt-β.

[0131] Optimization of 7.4 nm transducer concentration

[0132] The concentration range of the nanotransducer was set to 10–60 μg / mL. The concentration of the methylene blue-labeled signal hairpin probe H1-MB in the reaction system was 40 nmol / L, and the concentration of the second recognition probe Apt-β was 10 nmol / L. The reaction time was 10 min. The results showed that as the concentration of the nanotransducer increased, the peak current difference of the system gradually increased, reaching a maximum at a concentration of 50 μg / mL. Further increasing the concentration to 60 μg / mL did not further increase the signal difference. Therefore, in this embodiment, 50 μg / mL is preferred as the working concentration of the nanotransducer.

[0133] 7.5 Optimization of Reaction Time

[0134] The reaction times were set to 6, 8, 10, 12, and 14 min, and the electrochemical responses of samples containing 1 ng / mL procalcitonin, 100 ng / mL procalcitonin, and a negative control without a target were detected, respectively. The results showed that the electrochemical response of the target-containing sample gradually increased with increasing reaction time; by 10 min, different concentrations of samples exhibited a clear concentration-dependent response. Considering both detection efficiency and signal intensity, this embodiment preferably uses 10 min as the reaction time.

[0135] 7.6 Evaluation of reaction temperature adaptability

[0136] The effect of reaction temperature on the detection results was investigated within the temperature range of 20–30℃, with samples containing 1 ng / mL and 100 ng / mL procalcitonin being tested respectively. The results showed that within the above temperature range, both concentrations of samples yielded stable peak current differences with varying concentrations, indicating that this detection system can adapt to ambient temperature changes of 20–30℃, requires no precision temperature control equipment, and is suitable for decentralized detection scenarios.

[0137] 8. Performance evaluation of the detection system

[0138] 8.1 Linear Range and Detection Limit

[0139] Under the optimized reaction conditions described above, a series of procalcitonin standard samples with different concentrations were prepared, reacted at room temperature for 10 min, and then subjected to differential pulse voltammetry detection. The results showed that as the procalcitonin concentration increased, the differential pulse voltammetric peak current gradually increased, and the system could detect 10... -4 ~10 3 Procalcitonin in the ng / mL range produces a concentration-dependent electrochemical response.

[0140] The peak current difference between the test sample and the negative control was used as the detection signal, and the logarithm of this signal value relative to the procalcitonin concentration was within 10. -3 ~10 3 It exhibits good linearity within the range of ng / mL, and the linear equation is:

[0141] ΔI=1.88759lgC PCT +6.92756;

[0142] Where ΔI is the peak current difference, in μA; C PCT The concentration of procalcitonin is expressed in ng / mL; the correlation coefficient R of the linear equation is... 2 The value is 0.985, and the calculated detection limit is 2.35 × 10⁻⁶. -4 ng / mL.

[0143] 8.2 Verification of the sensitivity enhancement effect of the confinement effect

[0144] To verify the enhancement of detection sensitivity by the confinement effect of the nanotransducer, a non-nanomachinery control system was constructed by replacing the nanotransducer with a freely diffused first recognition probe / catalytic chain composite probe, and different concentrations of procalcitonin were detected under the same reaction conditions. The results showed that the non-nanomachinery system only produced a reliable detection response when the procalcitonin concentration reached above 1 ng / mL; while the system of this invention using the nanotransducer still produced a significant concentration-dependent signal at concentrations below 1 ng / mL. These results indicate that constructing the first recognition probe / catalytic chain composite on the surface of the nanotransducer can improve the local effective concentration of the probe through target-mediated spatial co-localization, promote catalytic chain release, and thus significantly enhance detection sensitivity.

[0145] 8.3 Evaluation of Detection Specificity

[0146] Calcitonin, C-reactive protein, interleukin-6, and B-type natriuretic peptide were selected as potential interfering agents and detected in parallel with procalcitonin. The concentration of each analyte was 1 ng / mL, and a negative control group without analytes was also set up. The results showed that only the procalcitonin group produced a significant electrochemical response, while the signals produced by the other interfering agent groups were close to those of the negative control group. This indicates that the detection system can specifically recognize procalcitonin and has no significant cross-response to the tested potential interfering agents, demonstrating good detection specificity.

[0147] 9. Repeatability and storage stability of the prefabricated testing system

[0148] 9.1 Evaluation of repeatability

[0149] The detection reaction solution was pre-assembled with a functionalized hydrogel electrode to prepare a pre-fabricated reaction unit. Twenty independent tests were performed on the same sample containing procalcitonin on different days. The results showed good consistency in the concentrations obtained from each test, with an average concentration of 10.12 ng / mL. All results were within ±2 standard deviations of the mean, indicating that the pre-fabricated detection system has good cross-day repeatability.

[0150] 9.2 Storage stability evaluation

[0151] Artificial serum samples with final concentrations of 0.1, 1, and 10 ng / mL were prepared using procalcitonin standards. Pre-fabricated reaction units, consisting of pre-packaged detection reaction solutions and functionalized hydrogel electrodes, were prepared and stored at 4°C and room temperature, respectively. Detection was performed after 1, 2, 3, and 4 weeks of storage. The detection response of the freshly prepared reaction unit was used as the initial value, and the signal retention rate after different storage times was calculated. The results showed that the pre-fabricated detection system exhibited good stability under both storage conditions. After 4 weeks of storage, the signal retention rate was higher than 85% at 4°C and higher than 80% at room temperature, indicating that the system has good low-temperature and room-temperature storage stability, facilitating transportation and field application.

[0152] 10 Clinical applications of serum sample testing

[0153] 10.1 Consistency Evaluation of Clinical Sample Testing

[0154] Forty-two in vitro clinical blood samples were collected. After serum separation, the procalcitonin concentration was determined using both the detection method described in this invention and the chemiluminescent immunoassay method used in the central laboratory. Using 0.1 ng / mL as the clinical reference threshold, the central laboratory results showed that the procalcitonin concentration in 22 samples was higher than the reference threshold, while the concentration in the remaining 20 samples was lower. The sample classification results obtained by the method of this invention and the reference method of the central laboratory were completely consistent.

[0155] For samples with values ​​above the reference threshold, the relative standard deviation of three repeated tests using the method of this invention was less than 8.5%; the relative standard deviation of repeated tests for all clinical samples was less than 10%, indicating that this method has good consistency and repeatability in clinical sample testing and can be used for the quantitative detection of procalcitonin in isolated serum samples.

[0156] 10.2 Application of Target Dynamic Monitoring

[0157] A patient's serum samples were tested continuously from 1 day before surgery to 8 days after surgery. The central laboratory used conventional methods to test once a day, while the method of this invention tested once every 8 hours.

[0158] The results showed that the trend of procalcitonin concentration changes measured by the method of this invention was basically consistent with the results of the central laboratory test, and had a good correlation with the duration of antibiotic use. Compared with routine testing once a day, the method of this invention can complete three tests per day, which can significantly improve the temporal resolution of dynamic changes in procalcitonin and provide more intensive test data support for continuous clinical observation of patients' conditions.

[0159] It should be noted that this embodiment is only used as an example to illustrate the technical solution of the present invention with procalcitonin as the detection target. Those skilled in the art can replace the first recognition probe and the second recognition probe, which can bind to different binding regions of the target protein respectively, according to actual detection needs, and extend the detection system to the detection of other protein biomarkers. All such extended applications should fall within the protection scope of the present invention.

Claims

1. A confinement effect-triggered synergistic nanomachine catalytic assembly and detection system, comprising a target recognition element, a nucleic acid signal amplification element, and an electrochemical detection element, characterized in that: The target recognition element comprises a nanotransistor and a free second recognition probe; The nanotransferr includes a first nanoparticle carrier, on the surface of which a first recognition probe is fixed, and a catalytic chain is pre-hybridized on the first recognition probe. Both the first recognition probe and the second recognition probe are nucleic acid aptamers capable of specifically binding to different binding regions of the target protein; The nucleic acid signal amplification element includes a signal hairpin probe and a nano-amplifier; The nanoamplifier includes a second nanoparticle carrier, on the surface of which a fixed hairpin probe is fixed; the signal hairpin probe is labeled with an electroactive signal molecule. The electrochemical detection element is a functionalized hydrogel electrode, comprising a base electrode and a composite hydrogel layer modified on the surface of the base electrode, and the nanoamplifier is loaded in the porous network structure of the composite hydrogel layer; The detection system is configured to trigger the release of the catalytic chain through target-mediated spatial co-localization of dual recognition probes, thereby initiating a catalytic hairpin assembly reaction, which enriches the signal hairpin probe carrying electroactive signal molecules at the interface of the functionalized hydrogel electrode and generates an electrochemical response.

2. The confinement effect-triggered synergistic nanomachine catalytic assembly and detection system according to claim 1, characterized in that, Both the first nanoparticle carrier and the second nanoparticle carrier are gold nanoparticles; Both the first identification probe and the fixed hairpin probe are fixed to the surface of the corresponding gold nanoparticles by gold-sulfur bonds formed by thiol modification.

3. The confinement effect-triggered synergistic nanomachine catalytic assembly and detection system according to claim 1, characterized in that, The composite hydrogel layer is a hydrogel layer formed by polyacrylamide, phytic acid and polydopamine, and the substrate electrode is a screen-printed carbon electrode. The nanoamplifier is loaded within the porous network structure of the composite hydrogel layer through a swelling-shrinkage cycle.

4. The confinement effect-triggered synergistic nanomachine catalytic assembly and detection system according to claim 1, characterized in that, The electroactive signaling molecule is methylene blue, and the signal hairpin probe is a methylene blue-terminated hairpin-structured nucleic acid probe.

5. The confinement effect-triggered synergistic nanomachine catalytic assembly and detection system according to claim 1, characterized in that, The target protein to be tested is procalcitonin; The first recognition probe and the second recognition probe specifically bind to different binding regions of procalcitonin, respectively.

6. A method for detecting the synergistic nanomachine catalytic assembly triggered by confinement effects, characterized in that, Includes the following steps: (1) Construction of detection reaction system: The second recognition probe, the signal hairpin probe labeled with electroactive signal molecules and the nanotransducer are dispersed in buffer solution to obtain detection reaction solution; The detection reaction solution is brought into contact with a functionalized hydrogel electrode loaded with a nano-amplifier, so that the working area of ​​the electrode is immersed in the reaction solution; The surface of the nanotransducer is fixed with a first recognition probe and pre-hybridized with a catalytic chain, and the surface of the nanoamplifier is fixed with a hairpin probe. (2) Target-mediated catalytic chain release: The sample to be tested is added to the detection reaction system and the reaction is incubated so that the protein target in the sample binds to the first recognition probe and the second recognition probe at the same time, mediating the spatial co-localization of the two recognition probes on the surface of the nanotransducer, and releasing the catalytic chain through the toe-mediated chain displacement reaction; (3) Catalytic hairpin assembly and signal enrichment: The released catalytic chain combines with the signal hairpin probe and opens the hairpin structure. The opened signal hairpin probe hybridizes with the fixed hairpin probe on the surface of the nano-amplifier to form a double-chain complex. At the same time, the catalytic chain is released to trigger multiple rounds of catalytic hairpin assembly reaction, so that the signal hairpin probe carrying electroactive signal molecules is enriched at the interface of the functionalized hydrogel electrode. (4) Electrochemical quantitative detection: After washing to remove unbound free probes, the electrochemical response signal of the functionalized hydrogel electrode is collected, and the concentration of protein target in the sample is determined based on the intensity of the response signal.

7. The method for detecting synergistic nanomachine catalytic assembly triggered by confinement effect according to claim 6, characterized in that, The incubation reactions in steps (2) and (3) were carried out at room temperature of 20–30°C, and the total reaction time was 8–12 minutes.

8. The method for detecting the synergistic nanomachine catalytic assembly triggered by confinement effect according to claim 6, characterized in that, Step (4) The electrochemical response signal is acquired by differential pulse voltammetry. The peak current difference between the test sample and the blank control sample is used as the quantitative basis. The target concentration is calculated by the pre-established standard curve of peak current difference and target concentration.

9. The method for detecting synergistic nanomachine catalytic assembly triggered by confinement effect according to claim 6, characterized in that, By replacing the first and second recognition probes with those corresponding to different binding regions of the target protein, different types of protein biomarkers can be detected.

10. The application of the confinement effect-triggered synergistic nanomachine catalytic assembly detection system of claim 1 in the quantitative detection of protein biomarkers in in vitro serum samples.

Images