A prophylactic or therapeutic drug for pulmonary arterial hypertension, and a method for examining whether or not a subject is suffering from pulmonary arterial hypertension or the severity of pulmonary arterial hypertension

Abstract

An object of the present disclosure is to provide a prophylactic or therapeutic agent for pulmonary arterial hypertension. A prophylactic or therapeutic agent for pulmonary arterial hypertension, which comprises a substance capable of adsorbing or binding to an indole compound that is a tryptophan metabolite.

Description

Technical Field

[0001] This disclosure relates to medications for the prevention or treatment of pulmonary hypertension (PH). Additionally, this disclosure relates to methods for determining whether one has PH or the severity of PH, and the testing kits used in such methods. Background Technology

[0002] Pulmonary hypertension is a group of progressive diseases with poor prognosis that damage heart and lung function due to elevated blood pressure in the pulmonary arteries. According to the Nice Classification, it is classified as follows: Group 1: Pulmonary Arterial Hypertension (PAH); Group 1': Pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': Neonatal persistent pulmonary hypertension; Group 2: Pulmonary hypertension associated with left ventricular disease; Group 3: Pulmonary hypertension associated with lung disease and / or hypoxemia; Group 4: Chronic thromboembolic pulmonary hypertension (CTEPH); Group 5: Pulmonary hypertension with unknown multifactorial mechanisms.

[0003] Among pulmonary arteries (PH), peripheral pulmonary artery hemorrhage (PAH) is a disease characterized by pathological changes such as myoplasia, neointimal hyperplasia, and plexiform lesions in the pulmonary arteries, with major inflammatory lesions in the peripheral pulmonary arteries (arterioles or microarteries) (Non-Patent Literature 1, 2). The etiology of PAH is complex and may be caused by a combination of factors, including genetic background, epigenetic modification factors, pre-existing diseases, and environmental factors (Non-Patent Literature 3). Among these, inflammation and autoimmune diseases are considered to have a significant impact on the etiology of PAH (Non-Patent Literature 4, 5).

[0004] In recent years, the overall prognosis of PH has gradually improved with the use of vasodilators targeting smooth muscle relaxation, but the prognosis for severely ill patients and drug-resistant patients remains quite poor. Regarding the pathogenesis and severity of PH, it is believed that in addition to genetic susceptibility, secondary trauma such as inflammation and medications are important factors, but many details remain unclear.

[0005] The inventors of this application have reported that the aryl hydrocarbon receptor (AHR), known as a regulator of inflammatory signals and a receptor for pollutants in the environment, plays a key role in the pathogenesis of PAH (Non-Patent Document 6). In that report, it was found that PAH patients had higher serum AHR activity, and the more severe the symptoms, the higher the activity; the group with higher activity had a poorer prognosis. Figure 1 Additionally, it has been reported that combining FICZ, an endogenous AHR ligand, with hypoxia stimulation can induce severe pulmonary hypertension with intimal lesions in rats. Figure 2 Furthermore, it was reported that in the Su / Hx model, which serves as a model for severe PH, knocking out AHR almost completely suppressed the pathogenesis of PH, indicating that AHR plays a key role in the progression of PH to severe illness. Figure 3 ).

[0006] Existing technical documents Non-patent literature Non-patent literature 1: Humbert M, Sitbon O, Simonneau G. Treatment of pulmonary arterial hypertension. The New England journal of medicine 2004;351:1425-36. Non-patent literature 2: Rabinovitch M. Molecular pathogenesis of pulmonaryarterial hypertension. The Journal of clinical investigation 2012;122:4306-13. Non-patent literature 3: Humbert M, Guignabert C, Bonnet S, et al., Pathology andpathobiology of pulmonary hypertension: state of the art and researchperspectives. The European respiratory journal 2019;53. Non-patent document 4: Hashimoto-Kataoka T, Hosen N, Sonobe T, et al., Interleukin-6 / interleukin-21 signaling axis is critical in the pathogenesis of pulmonaryarterial hypertension. Proceedings of the National Academy of Sciences of the United States of America 2015;112:E2677-86. Non-patent literature 5: Schermuly RT, Ghofrani HA, Wilkins MR, Grimminger F. Mechanisms of disease: pulmonary arterial hypertension. Nature reviews Cardiology 2011;8:443-55. Non-Patent Literature 6: Masaki T. Okazawa M et al., Aryl hydrocarbon receptor isessential for the pathogenesis of pulmonary arterial hypertension. PNAS 2021;118, e2023899118 Summary of the Invention

[0007] The problem that the invention aims to solve If the ligands of AHR, which play an important role in the pathogenesis of PH, can be removed, it may become effective for the prevention, treatment, and prevention of severe PH. However, the AHR ligands involved in the pathogenesis of PH have not yet been identified.

[0008] Therefore, in one embodiment of this disclosure, the subject is to identify the AHR ligand involved in the pathogenesis of PH and to provide a preventive or therapeutic agent for PH capable of removing the AHR ligand.

[0009] In addition, other embodiments of this disclosure aim to elucidate the mechanism of pathological formation of PH caused by AHR ligands and to provide novel PH prevention or treatment drugs based on this mechanism.

[0010] In another embodiment of this disclosure, the subject matter is to discover biomarkers of PH and to provide a method for checking whether one has PH or the severity of PH.

[0011] Methods for solving problems It has been reported that changes in metabolites caused by intestinal bacterial community dysbiosis are associated with a variety of diseases. Therefore, the inventors of this application analyzed the intestinal bacterial community of patients with poxtony syndrome (PH). The results showed that intestinal bacterial community dysbiosis occurred in PH patients, characterized by ectopic colonization of oral bacteria into the intestine and an increase in active Ruminococcus gnavus. Furthermore, it was found that due to this intestinal bacterial community dysbiosis, tryptophan concentrations were high in the intestines of PH patients, accompanied by increased production of tryptophan metabolites (indole compounds) such as tryptophan. Moreover, it was found that tryptophan metabolites function as AHR ligands, promoting the pathogenesis of PH. Furthermore, it has been learned that in the intestine, tryptophan metabolites such as tryptophan (AHR ligands) reduce BOAT1 function through a decrease in the expression of AHR-dependent angiotensin-converting enzyme 2 (ACE2), thereby hindering tryptophan absorption and further exacerbating the high concentration of tryptophan in the intestine. Moreover, it has been observed that removing tryptophan metabolites from the intestine by administering substances that can adsorb or bind to them can prevent or treat pH. This disclosure is based on further repeated research of the above findings.

[0012] That is, in one embodiment of this disclosure, there is a technique for the prevention or treatment of pH by removing tryptophan metabolites from the intestine as a mechanism, and the invention is shown below.

[0013] Item 1-1. Pharmacological agents for the prevention or treatment of PH, which contain substances capable of removing indole compounds, which are metabolites of tryptophan, from the intestine.

[0014] Item 1-2. A pH prevention or treatment agent as described in Item 1-1, wherein the aforementioned substance is a substance capable of adsorbing or binding to an indole compound that is a metabolite of tryptophan.

[0015] Items 1-3. A pH prevention or treatment agent as described in Items 1-1 or 1-2, wherein the aforementioned indole compound is at least one selected from the group consisting of tryptophan, indole-3-carboxaldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid.

[0016] Items 1-4. A pH prevention or treatment agent as described in Items 1-1 or 1-2, wherein the aforementioned substance is a porous inorganic adsorbent.

[0017] Items 1-5. A preventive or therapeutic agent for pH as described in any one of Items 1-1 to 1-4, wherein the aforementioned substance is adsorbed carbon.

[0018] Items 1-6. Treatment methods for PH, which include the step of removing indole compounds, which are tryptophan metabolites, from the intestines of PH patients.

[0019] Items 1-7. The treatment method for PH as described in Items 1-6, wherein the indole compound is removed from the intestine of the PH patient by administering a therapeutically effective amount of a substance capable of adsorbing or binding to an indole compound that is a metabolite of tryptophan.

[0020] Items 1-8. Use of substances capable of removing indole compounds, which are metabolites of tryptophan, from the intestine for the manufacture of drugs for the prevention or treatment of pH.

[0021] Items 1-9. Uses as described in items 1-8, wherein the aforementioned substance is a substance capable of adsorbing or binding to indole compounds that are tryptophan metabolites.

[0022] Items 1-10. Substances capable of removing indole compounds, which are metabolites of tryptophan, from the intestine, and which are used to treat PH.

[0023] Items 1-11. Substances that can adsorb or bind to indole compounds, which are metabolites of tryptophan, and are used in the treatment of pH.

[0024] In another embodiment of this disclosure, there is a technique for examining whether or not one suffers from PH or the severity of PH by using the concentration of tryptophan in feces, intestinal contents or blood samples as an indicator, and the invention is shown below.

[0025] Item 2-1. Examination methods, which are methods for checking whether PH is present or the severity of PH. The examination method includes the step of measuring the concentration of tryptophan in fecal, intestinal contents, or blood samples collected from the subject.

[0026] Item 2-2. A test kit for determining whether or not someone has PH or the severity of PH, which contains reagents for measuring tryptophan.

[0027] In another embodiment of this disclosure, there is a technique for examining whether or not one suffers from PH or the severity of PH by using the concentration of tryptophan metabolites in feces, intestinal contents or blood samples as an indicator, and the invention is shown below.

[0028] Item 3-1. Examination methods, which are methods for checking whether PH is present or the severity of PH. The examination method includes the step of measuring the concentration of indole compounds, which are metabolites of tryptophan, in fecal, intestinal contents, or blood samples collected from the subject.

[0029] Item 3-2. The testing method as described in Item 3-1, wherein the aforementioned indole compound is at least one selected from the group consisting of tryptamine, indole-3-carboxaldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid.

[0030] Item 3-3. A test kit for determining whether or not someone has PH or the severity of PH, which contains reagents for measuring indole compounds, which are metabolites of tryptophan.

[0031] In another embodiment of this disclosure, there is a technique for examining whether PH or the severity of PH is present, using the AHR activity of feces or intestinal contents as an indicator, and the invention is shown below.

[0032] Item 4-1. Examination methods, which are methods for checking whether PH is present or the severity of PH. The examination method includes the step of measuring the AHR activity of feces or intestinal contents collected from the subject.

[0033] Item 4-2. A test kit for determining whether or not a patient has PH or the severity of PH, which contains reagents for measuring the AHR activity of feces or intestinal contents.

[0034] In another embodiment of this disclosure, there is a technique for examining whether PH is present or the severity of PH by using the concentration of ACE2 in feces, intestinal contents or blood samples as an indicator, and the invention is shown below.

[0035] Item 5-1. Examination methods, which are methods for checking whether PH is present or the severity of PH. The examination method includes the step of measuring the ACE2 concentration in fecal, intestinal contents, or blood samples collected from the subject.

[0036] Item 5-2. A test kit for determining whether someone has PH or the severity of PH, which contains reagents for measuring ACE2.

[0037] In another embodiment of this disclosure, there is a technique for the prevention or treatment of PH that uses an increase in the expression level of ACE2 in the gut as a mechanism, and the invention is shown below.

[0038] Item 6-1. PH prevention or treatment drugs that contain substances that increase the expression of ACE2.

[0039] Item 6-2. Treatment of PH, which includes the step of administering a therapeutically effective amount of a substance that increases the expression of ACE2 to PH patients.

[0040] Item 6-3. The use of substances that increase the expression of ACE2 in the manufacture of drugs for the prevention or treatment of PH.

[0041] Item 6-4. Substances that increase the expression of ACE2 are used to treat PH.

[0042] Invention Effects According to one embodiment of this disclosure, the prevention or treatment of pH can be achieved by removing indole compounds, which are tryptophan metabolites, from the intestine. Furthermore, according to another embodiment of this disclosure, pH can be prevented or treated by increasing the expression level of ACE2 in the intestine.

[0043] Furthermore, according to another embodiment of this disclosure, the concentration of tryptophan, tryptophan metabolites, or ACE2 in feces, intestinal contents, or blood samples can be used as indicators to examine whether PH is present or its severity. Additionally, according to yet another embodiment of this disclosure, the AHR activity in feces or intestinal contents can be used as an indicator to examine whether PH is present or its severity. Attached Figure Description

[0044] [ Figure 1 [Figure 6] To illustrate the increase in serum AhR ligand activity in PAH patients, reflecting the severity of PAH. A shows the serum AHR-Luc activity (HV: n=16, PAH: n=18) of healthy volunteers (HV) and PAH patients as determined by AHR luciferase reporter gene assay; B shows the distribution of AHR-Luc (luciferase) activity stratified by WHO functional classification of pulmonary hypertension (HV: n=16; WHO-FC 1, 2: n=10; WHO-FC 3, 4: n=8); C shows the event-free survival (P=0.0376, two-sided log-rank test) of patients with low AHR-Luc activity (n=10) and patients with high AHR-Luc activity (n=8). It should be noted that in C, the mean AHR-Luc activity was used as the cutoff value to classify patients into those with low AHR-Luc activity and those with high AHR-Luc activity. Additionally, in C, clinical events were defined as death, lung transplantation, and hospitalization due to right heart failure. Statistical values ​​are mean ± standard deviation. P<0.001, P<0.05.

[0045] [ Figure 2 To demonstrate the effect of FICZ, as an endogenous AHR ligand, in inducing severe pulmonary hypertension with intimal lesions in rats when combined with hypoxia stimulation (Non-Patent Literature 6). A is a diagram showing the experimental procedure (FICZ / Hx / Nx model) used to determine whether the combination of FICZ administration and hypoxia stimulation induced PH in rats; B is a diagram showing the right ventricular systolic pressure (RVSP) of FICZ / Hx / Nx rats and Veh / Hx / Nx rats (normodynamic: n=5, Veh / Hx / Nx 5 wks: n=7, FICZ / Hx / Nx 5 wks: n=6, Veh / Hx / Nx 8 wks: n=6, FICZ / Hx / Nx 8 wks: n=7); C is a diagram showing the right ventricular hypertrophy index (Fulton index) of FICZ / Hx / Nx rats and Veh / Hx / Nx rats; D is a diagram showing the Elastica vanilla index of lung tissue sections from the rats in B and C. Image E shows representative images of vascular remodeling in the distal pulmonary acinar arteries of the lung obtained by Gieson (EVG) staining; Image E shows the medial hypertrophy index (normotropic: n=3, Veh / Hx / Nx 5 wks: n=4, FICZ / Hx / Nx 5 wks: n=3, Veh / Hx / Nx 8 wks: n=6, FICZ / Hx / Nx 8 wks: n=6) of FICZ / Hx / Nx rats; Image F shows the results of grading pulmonary artery occlusion lesions in vessels with pulmonary artery outer diameter (OD: <50 μm) of FICZ / Hx / Nx rats into open (no intimal lesions), partially occluded (<50% occlusion), or completely occluded (≥50% occlusion) (normotropic: n=3, Veh / Hx / Nx 5 wks: n=6). Figure G shows the results of pulmonary artery occlusion lesions in FICZ / Hx / Nx rats and Veh / Hx / Nx rats, graded as patent, partially occluded, or completely occluded in vessels with pulmonary artery outer diameter (OD: 50-100 μm) in the same manner as described above. In the figures, the abbreviation "FICZ" represents the FICZ administration group, "Veh" represents the solvent administration group, "Hx" represents the hypoxic load, and "Nx" represents the normoxic conditions. In A, the abbreviation "RHC" represents right heart catheterization. Statistical values ​​are mean ± standard deviation. P<0.0001, P<0.001, P<0.01, P<0.05。

[0046] [ Figure 3[Figure showing AHR knockout rats' resistance to pulmonary hypertension in the SuHx rat model (Non-Patent Document 6).] A represents the experimental procedure used to verify the role of the AHR signaling pathway in the SuHx rat model; B represents the right ventricular systolic pressure (RVSP) at 5-week time points in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (noroxic; Ahr- / -, Ahr+ / +) (noroxic Ahr+ / +: n=7, normoxic Ahr- / -: n=7, SuHx 5 wks Ahr+ / +: n=3, SuHx 5 wks Ahr+ / -: n=7, SuHx 5 wks Ahr- / -: n=8); C represents the Fulton index at 5-week time points in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (noroxic; Ahr- / -, Ahr+ / +); D represents the ratio of SuHx rats (Ahr- / -, Ahr+ / +) to normoxic rats (noroxic; Images of vascular remodeling in the distal pulmonary acinar arteries of representative lung tissue sections obtained by EVG staining at 8-week time points for Ahr- / - and Ahr+ / + rats; E shows the medial hypertrophy index (n=4 for normoxic Ahr+ / +, n=5 for normoxic Ahr- / -, n=3 for normoxic 8-week time points in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (n=3 for normoxic Ahr- / -, Ahr+ / +); F shows the pulmonary artery occlusion lesions in vessels with an outer diameter (OD: <50μm) of the pulmonary arteries at 8-week time points in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (n=3 for normoxic Ahr- / -, Ahr+ / +) as patent (no intimal lesions) or partially (<50%). The results were obtained from pulmonary artery occlusion (≥50% occlusion) or complete occlusion; G represents the results obtained from pulmonary artery occlusion lesions in vessels with pulmonary artery outer diameter (OD: 50-100μm) at 8-week time points in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (noroxic; Ahr- / -, Ahr+ / +), graded as patent, partially occluded, or completely occluded in the same manner as described above. In the figure, the abbreviation "Su" represents the SU5416 administration group, "Hx" represents hypoxic load, "Nx" represents normoxic conditions, "Ahr- / -" represents AHR knockout, "Ahr+ / +" represents AHR not knocked out, and "RHC" represents right heart catheterization. Statistical values ​​are mean ± standard deviation: P<0.0001, P<0.001, P<0.01.

[0047] [ Figure 4 The figures below illustrate the gut microbiota dysbiosis in PH patients. Figure A shows the α-diversity of gut microbiota in PH patients (PH, 89 cases) and healthy individuals (HV, 82 cases), related to Faith PD and Shannon index. Figure B shows the β-diversity (unweighted unifrac PCoA) of gut microbiota in PH patients and healthy individuals. P<0.0001, P<0.05.

[0048] [ Figure 5 The figures below illustrate the gut microbiota dysbiosis in patients with PH. A is a volcano plot comparing the number of bacteria (genus level) constituting the gut microbiota in PH patients and healthy individuals (HV). B is a graph showing the oral resident bacteria scores in the gut of PH patients and healthy individuals. C is a comparison of the proportions of PH patients categorized into oral resident bacteria scores (OS) of 5 or higher and less than 5, according to WHO functional classifications of PH, stages I–IV. D is a graph showing the results of an event-free survival analysis (P<0.01, two-sided log-rank test) of PH patients categorized into oral resident bacteria scores (OS) of 5 or higher and less than 5. E shows the concentrations of acetic acid, propionic acid, and butyric acid in the feces of PH patients and healthy individuals. In D, clinical events are defined as death, lung transplantation, and hospitalization due to right heart failure. Statistical values ​​are mean ± standard deviation. P<0.0001, P<0.001, P<0.01, P<0.05.

[0049] [ Figure 6This diagram illustrates the coexistence of active rumenococci in the gut with various oral bacteria in patients with porcine rumenia (PH), a network associated with poor prognosis. A is a network diagram of active rumenococci and related bacteria, created using the results of a compositional analysis of the gut microbiota in PH patients. B is a diagram showing the results of an event-free survival analysis of PH patients categorized by the abundance of active rumenococci, and Streptococcus, Streptococcus, Rheumatoid, Fusobacterium, or Veillonella species in the gut. In B, clinical events are defined as death, lung transplantation, and hospitalization due to right heart failure.

[0050] [ Figure 7 [Figure showing the dysbiosis of the intestinal bacterial community in rats with pulmonary hypertension (International Publication No. 2021 / 167088). A is a figure showing the preparation procedures for rats with pulmonary hypertension, with the upper section based on hypoxia loading, the middle section based on limonene loading, and the lower section based on Sugen5416 / hypoxia / noroxic loading (SuHx). B is a figure showing the β-diversity of the intestinal bacterial community for each model rat. C is a figure showing the family-level composition of the intestinal bacterial community in each model rat as a bar chart.]

[0051] [ Figure 8 [Figure showing the improvement of PH pathology in rats with pulmonary hypertension model by antibiotic administration (International Publication No. 2021 / 167088). A shows the results of evaluating PH pathology (pulmonary artery media hypertrophy, right ventricular systolic pressure, and right ventricular hypertrophy index) in rats with hypoxia load (Hx) who were given free access to water and antibiotic mixed solution (Abx) or water (vehicle), and in unstimulated SD rats who were given free access to water (control). B shows the results of evaluating PH pathology (pulmonary artery media hypertrophy, right ventricular systolic pressure, and right ventricular hypertrophy index) in rats with MCT model who were given free access to water and antibiotic mixed solution (Abx) or water (vehicle). C shows the results of evaluating PH pathology (pulmonary artery media hypertrophy, right ventricular systolic pressure, and right ventricular hypertrophy index) in rats with SuHx model who were given free access to water and antibiotic mixed solution (Abx) or water (vehicle). Statistical values ​​are mean ± standard deviation:] P<0.0001, P<0.001, P<0.01, P<0.05.

[0052] [ Figure 9 Figure A shows the pathological changes in pulmonary hypertension in gnotobiote model rats. Figure B shows the method for preparing gnotobiote model rats. Figure C shows the results of analyzing the intestinal flora composition of gnotobiote F344 rats with fecal transplantation from PH patients and healthy individuals. Figure C shows the results of measuring right ventricular systolic pressure and right ventricular hypertrophy index in gnotobiote F344 rats with fecal transplantation from PH patients (MCT-PH), healthy individuals (MCT-HV), sterile environment-raised F344 rats (MCT-GF), and SPF-raised F344 rats (MCT-SPF). Statistical values ​​are mean ± standard deviation. P<0.01, P<0.05.

[0053] [ Figure 10 This is a graph showing the RNA-seq analysis results of the lungs of F344 rats (PH) and healthy F344 rats (HV) after fecal transplantation. A is a volcano plot showing the comparison of RNA expression in the lungs. B shows the results of gene ontology term analysis of RNA expression in the lungs. C is a bar chart showing the differences in gene expression related to B.

[0054] [ Figure 11 [Figure A shows the experimental results of vancomycin administration to rats with fecal transplantation from PH patients. Figure B shows the experimental procedure. Figure B shows the results of measuring right ventricular systolic pressure and right ventricular hypertrophy index in rats with fecal transplantation from PH patients administered vancomycin (PH-FMT-VCM) and rats with fecal transplantation from PH patients administered water (medium) (PH-FMT). Statistical values ​​are mean ± standard deviation.] P<0.01, P<0.05.

[0055] [ Figure 12The figures illustrate the results of shotgun analysis of intestinal bacteria from human fecal samples and AHR luciferase reporter gene assays from feces of human and bacteria-limited rats. Figure A shows the results of KEGG module pathway analysis of fecal samples from PH patients and healthy individuals using shotgun metagenomic data. Figure B shows the results of AHR ligand activity assays in fecal samples from PH patients (PH) and healthy individuals (HV) using AHR luciferase reporter gene assays. Figure C shows the results of AHR ligand activity assays in feces from PH model bacteria-limited rats (PH patient fecal transplant F344 rats (PH-FMT) and healthy individual fecal transplant F344 rats (HV-FMT)) using AHR luciferase reporter gene assays. Statistical values ​​are mean ± standard error. P<0.01, P<0.001.

[0056] [ Figure 13 Figure A shows the results of determining the concentration of tryptophan and its metabolites in feces or fecal samples from humans and bacteria-limited rats using targeted LC-MS analysis. Figure B shows the results of determining the concentration of tryptophan (Trp) and its metabolites (tryptophan (TryptA), indole-3-pyruvate (IPyA), indole-3-carboxaldehyde (IAld), indole-3-acetic acid (IAA), indole-3-ethanol (IEt), indole-3-propionic acid (IPA), indole-3-lactic acid (ILA), and indole-3-acrylic acid (IAcr)) in fecal samples from PH patients (PH) and healthy individuals (HV). Figure B shows the results of determining the concentration of tryptophan and its metabolites in fecal samples from PH model bacteria-limited rats (PH patient fecal transplant F344 rats (PH) and healthy individual fecal transplant F344 rats (HV)). Statistical values ​​are mean ± standard deviation. P<0.05 P<0.01, P<0.001, <0.0001.

[0057] [ Figure 14[Figure A shows the results of the experiment involving the administration of the AHR inhibitor (CH223191) to rats with fecal transplantation from PH patients. Figure B shows the experimental procedure. Figure C shows the results obtained by measuring the right ventricular systolic pressure and right ventricular hypertrophy index in rats with fecal transplantation from PH patients administered the AHR inhibitor (CH223191) or corn oil (mediator). Figure C shows the UMAP (Uniform Manifold Approximation and Projection) and its analysis results based on the results of single-cell RNA-seq analysis of immune cells recovered from the lungs of the aforementioned rats with fecal transplantation from PH patients. Statistical values ​​are mean ± standard deviation.] P<0.05, P<0.0001.

[0058] [ Figure 15 This image shows the results of multi-component simultaneous LC-MS analysis of stool samples (HV n=28, PH n=31) and serum samples (HV n=24, PH n=24) from healthy individuals (HV n=28, PH n=31) and patients with PH (PH n=24). The left image shows the results of the stool samples, and the right image shows the results of the serum samples.

[0059] [ Figure 16 This graph shows the tryptophan concentration in stool and serum samples from healthy individuals (HV), patients with heart failure (PH), and patients with heart failure (HF). A represents the measured tryptophan concentration in stool samples, B represents the measured tryptophan concentration in serum samples, and C represents the measured tryptophan concentration in fasting serum samples. Statistical values ​​are the mean ± standard deviation (A, B) or standard error (C). p<0.05, P<0.01, P<0.001.

[0060] [ Figure 17 This figure shows the results obtained by measuring the amino acid concentration in serum samples from healthy individuals and patients with PH using LC-MS. Figure 17 In the middle, starting from the left, the concentrations of tryptophan, valine, proline, asparagine, threonine, alanine, methionine, glycine, glutamic acid, and lysine in serum samples from healthy individuals (HV) and patients with PH (PH) are shown in that order. P<0.05, P<0.01. P<0.001.

[0061] [ Figure 18 [Figure A shows the expression level of ACE2 protein when cultured with 0–500 μM tryptophan. Figure B shows the expression level of ACE2 protein when cultured with 200 μM tryptophan and 0–5 μM AHR inhibitor (BAY-218).] P<0.05, P<0.01.

[0062] [ Figure 19 The diagram illustrates how tryptophan inhibits ACE2 expression in an AHR-dependent manner, leading to decreased tryptophan absorption in the small intestine. A shows the experimental procedure. B shows the Western blotting performed using small intestinal epithelial cell layers. C shows the quantification of Ace2 expression based on the results of B. D shows the results of a tritium-labeled tryptophan intake experiment using the small intestine of wild-type SD rats (Slc6a19 + / +) and Slc6a19 knockout rats (Slc6a19 + / -, - / -). E shows the results of a tritium-labeled tryptophan intake experiment using the small intestine of wild-type SD rats (Ace2 + / y) and Ace2 knockout rats (Ace2 - / y). Statistical values ​​are mean ± standard error. p<0.05 p<0.001.

[0063] [ Figure 20 The diagram illustrates the importance of tryptophan in the formation of pathological pH. A shows the experimental protocol. B shows the results of measuring AHR activity in feces and serum. C shows the results of measuring right ventricular systolic pressure and right ventricular hypertrophy index. Statistical values ​​are mean ± standard deviation. D shows the results of measuring the concentration of tryptophan metabolites in feces. P<0.01, P<0.001, <0.0001.

[0064] [ Figure 21Figure 1 shows the pathological worsening of PH induced by tryptamine uptake. Figure 2 shows the experimental procedure. Figure 3 shows the results obtained from measuring right ventricular systolic pressure and right ventricular hypertrophy index. Figure 4 shows an Elasticavan Gieson staining image of the lungs of rats fed a tryptamine-containing diet. In Figure 5, arrows are used to mark the locations of visible inflammatory cell infiltration. Statistical values ​​are mean ± standard deviation. P<0.05, P<0.01.

[0065] [Figure 22] This diagram illustrates how active rumenococci, in synergy with Streptococcus pasteurianus, worsen pH. A shows the results of whole-genome analysis (shotgun analysis) of fecal samples from healthy individuals (HV) and patients with pH (PH), determining the retention rate of the gene encoding tryptophan decarboxylase (K01593). B shows the results obtained from analyzing the proportion of bacterial species possessing the K01593 gene. C shows the results obtained from the time-varying concentration of tryptophan (TryptA) in the culture medium of active rumenococci, Streptococcus salivarius, Streptococcus pasteurianus, and Streptococcus mutans in vitro. D shows the experimental protocol for administering active rumenococci and Streptococcus pasteurianus to germ-free rats. E shows the results obtained from measuring right ventricular systolic pressure and right ventricular hypertrophy index in experiment D. F shows the results obtained from measuring the expression level of mucin in small intestinal epithelial cells by qPCR in experiment D. In F, "GF" indicates the condition without bacterial inoculation, "Gnavus" indicates the condition with inoculation only of active rumenococci, "Gnavus+St" indicates the condition with inoculation of both active rumenococci and Streptococcus pasteurellis, and "St" indicates the condition with inoculation only of Streptococcus pasteurellis. G represents the results obtained from the culture experiment of active rumenococci with the presence or absence of mucin and the determination of the turbidity of the culture medium after culture. H represents the results obtained from the experiment in D by determining the concentration of tryptophan and its metabolites in feces by LC-MS. In H, "GF" indicates the condition without bacterial inoculation, "Gnavus" indicates the condition with inoculation only of active rumenococci, "St" indicates the condition with inoculation only of Streptococcus pasteurellis, and "Gnavus+St" indicates the condition with inoculation of both active rumenococci and Streptococcus pasteurellis. Statistical values ​​are mean ± standard deviation. P<0.05, P<0.001.

[0066] [ Figure 23[Graphics showing the adsorption and removal of various indole compounds from the intestines of rats by administration of AST-120 adsorbent carbon in a mixed diet. A is a diagram showing the experimental protocol. B is the concentration of tryptophan (TryptA) and indole-3-pyruvate (IPyA) in feces. C is the concentration of indole-3-carboxaldehyde (IAld) in feces. D is the concentration of indole-3-acetic acid (IAA) in feces. E is the concentration of indole-3-ethanol (IEt) in feces. F is the concentration of indole-3-propionic acid (IPA) in feces. G is the concentration of indole-3-lactic acid (ILA) in feces. H is the concentration of tryptophan (Trp) in feces.]

[0067] [ Figure 24 This diagram illustrates the significant improvement in pH-related pathological conditions in pH-model rats after oral administration of AST-120 to remove intestinal tryptophan metabolites. A shows a diagram of the experimental protocol. B shows the results obtained from measuring right ventricular systolic pressure and right ventricular hypertrophy index. C shows the results obtained from measuring AHR ligand activity in feces. D shows the results obtained from measuring the concentrations of tryptophan (TryptA), indole-3-pyruvate (IPyA), indole-3-carboxaldehyde (IAld), indole-3-acetic acid (IAA), indole-3-ethanol (IEt), indole-3-propionic acid (IPA), indole-3-lactic acid (ILA), and tryptophan (Trp) in feces. Statistical values ​​are mean ± standard deviation. P<0.05, P<0.01, P<0.001.

[0068] [ Figure 25 This diagram illustrates how the spontaneous onset of PAH in Regnase-1 Cd11cCre (Reg-1 CKO) mice, used as a model of severe PAH, was suppressed when kept in a sterile environment, and how the administration of adsorbed charcoal to Reg-1 CKO mice suppressed the development of PAH pathogenesis. Figures A and B show the results of measuring right ventricular systolic pressure (A) and right ventricular hypertrophy index (B) after Reg-1 CKO mice were kept in an SPF or sterile (GF) environment. Reg1 f / w in A represents the PAH-free control group. Figure C shows the experimental protocol for administering AST-120 to Reg-1 CKO mice. Figure D shows the results of measuring right ventricular systolic pressure in experiment C. Statistical values ​​are mean ± standard deviation. P<0.01.

[0069] [ Figure 26The figures show the inhibition of PAH pathogenesis in pH model rats when adsorbed charcoal is administered. A shows the results obtained by administering AST-120 to pH model rats under lycopene load and measuring right ventricular systolic pressure. B shows the results obtained by administering AST-120 to pH model rats under hypoxic load and measuring right ventricular systolic pressure. P<0.05.

[0070] [ Figure 27 This diagram illustrates the efficient binding of indole compounds by adsorbent carbons (AST-120, pharmaceutical-grade carbon, and granulated activated carbon). The diagram shows the adsorption rates of each adsorbent carbon for L-valine, L-glutamic acid, 3-aminoisobutyric acid, L-tryptophan, tryptophan, indole-3-carboxaldehyde, and indole-3-acetic acid. Detailed Implementation

[0071] 1. Definition Unless otherwise specified, the terms used in this specification shall have the meanings commonly understood by those skilled in the art in the fields of medicine, pharmacy, molecular biology, microbiology, and organic chemistry. Where a term defined in this specification has a meaning different from its common understanding, the meaning set forth in this specification shall prevail.

[0072] In this publication, "pulmonary hypertension (PH)" refers to a group of progressive diseases with poor prognosis that impair heart and lung function due to elevated blood pressure in the pulmonary arteries. Specifically, it is defined as a mean pulmonary artery pressure (PAP) of 25 mmHg or higher, measured by right heart catheterization at rest. PH is classified according to the Nice Classification as follows: Group 1: Pulmonary Arterial Hypertension (PAH); Group 1': Pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': Neonatal persistent pulmonary hypertension; Group 2: Pulmonary hypertension associated with left heart disease; Group 3: Pulmonary hypertension associated with lung disease and / or hypoxemia; Group 4: Chronic thromboembolic pulmonary hypertension; Group 5: Pulmonary hypertension associated with multifactorial mechanisms of unknown origin.

[0073] In this publication, “severity of PH” is classified according to the WHO functional classification of pulmonary hypertension as shown in Table 1.

[0074] [Table 1] WHO Functional Classification of Pulmonary Hypertension In this publication, "aromatic hydrocarbon receptor (AHR)" refers to a transcription factor that can bind to and activate an agonist (endogenous or exogenous ligand), thereby regulating the expression of downstream genes such as CYP1A1 (cytochrome P450, family 1, subfamily A) and AHRR (AHR repressor).

[0075] In this publication, “B0AT1” refers to the sodium-dependent neutral amino acid transporter B(0)AT1, a protein encoded by the SLC6A19 gene.

[0076] In this disclosure, "angiotensin-converting enzyme 2 (ACE2)" refers to a protein that functions as one of the factors in the renin-angiotensin system and is known to function as a chaperone protein of BOAT1, thereby facilitating the absorption of neutral amino acids in the intestine.

[0077] In this publication, "indole compounds that are metabolites of tryptophan" refers to compounds that have an indole ring among the compounds produced by the metabolism of tryptophan. Indole compounds, which are metabolites of tryptophan, specifically include tryptophan (TryptA), indole-3-carboxaldehyde (IAld), indole-3-pyruvate (IPyA), indole-3-ethanol (IEt), indole-3-acetic acid (IAA), indole-3-propionic acid (IPA), indole-3-acrylic acid (IAcr), indole-3-lactic acid (ILA), indole-3-acetaldehyde, indole-3-acetamide, indole-3-acetonitrile, indolesulfonate, 2-oxyindole, indole-3-butyric acid, 3-methylindole, N-methyltryptamine, N-hydroxytryptamine, 3-methylindolepyruvate, indole-3-acetaldehyde oxime, 3-methyldeoxyindole, 2-oxyindoleacetic acid, 2-oxyindole, indole-3-methanol, indole, and indole-3-glycerophosphate.

[0078] In this public text, “prevention” means suppressing the onset of a disease or symptom, or prolonging the time until the onset of the disease or symptom, and “treatment” means the reduction, alleviation, or slowing of the progression of a disease or symptom.

[0079] In this public document, “blood sample” means a sample derived from blood, including whole blood, serum, and plasma.

[0080] 2. pH prevention or treatment drugs that use the removal of tryptophan metabolites in the intestine as a mechanism (1) The inventors of this application have determined that indole compounds, as metabolites of tryptophan, are ligands of AHRs that play an important role in the pathological formation of pH, and have realized that pH can be prevented or treated by removing these indole compounds from the intestine. Therefore, in one embodiment of this disclosure, a pH prevention or treatment agent (hereinafter referred to as "pH prevention or treatment agent (1)") is provided, which comprises a substance capable of removing indole compounds, as metabolites of tryptophan, from the intestine. The pH prevention or treatment agent (1) of this disclosure will be described in detail below.

[0081] [Active Ingredients] The pH prevention or treatment drug (1) disclosed herein contains a substance as an active ingredient capable of removing indole compounds, which are tryptophan metabolites, from the intestine. The pH prevention or treatment drug (1) disclosed herein can prevent or treat pH by removing tryptophan metabolites (indole compounds) present in the intestine.

[0082] In the pH prevention or treatment drug (1) disclosed herein, there is no particular limitation on the type of indole compound that is to be removed from the intestine, but preferred examples include tryptophan, indole-3-carboxaldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid. The substance used as the active ingredient can be a substance capable of removing one indole compound from the intestine, and preferably a substance capable of removing two or more indole compounds from the intestine. Furthermore, among indole compounds, tryptophan plays a particularly important role in the pathological formation of pH; therefore, the substance used as the active ingredient is preferably a substance capable of removing at least tryptophan from the intestine. Additionally, tryptophan is an essential amino acid; therefore, the substance used as the active ingredient is preferably a substance that is difficult to remove tryptophan from the intestine.

[0083] There are no particular limitations on the types of substances that can remove indole compounds, which are tryptophan metabolites, from the intestines. Specifically, substances that can adsorb or bind to indole compounds, which are tryptophan metabolites, can be cited. By using such substances to adsorb or bind to tryptophan metabolites (indole compounds) present in the intestines, these tryptophan metabolites are prevented from functioning as AHR ligands and are excreted as feces, thereby preventing or treating pH.

[0084] As for substances that can adsorb onto indole compounds, there are no particular limitations as long as they hinder the function of AHR ligands by adsorbing onto indole compounds. Porous inorganic adsorbents (inorganic adsorbents) are a preferred example. Specifically, examples of porous inorganic adsorbents include adsorbent carbon (activated carbon, pharmaceutical charcoal, etc.), activated alumina, silica gel, bentonite, diatomaceous earth, zeolite, molecular sieves, kaolin, silica-magnesium oxide preparations, silica, zinc aluminosilicate, titanium dioxide, iron oxide, tin oxide, titanium hydroxide, iron hydroxide, tin hydroxide, calcium carbide, montmorillonite, hydroxyapatite, talc, kaolin, carbon nanotubes, aluminum silicate, magnesium silicate, hydrotalcite, magnesium metasilicate, alumina, aluminum oxide, aluminum hydroxide gel, silica-alumina minerals (SIBLET, SEKADO, etc.), carbon nitride, platinum, glass, and zeolite. The pore size of porous inorganic adsorbents is not particularly limited and can be any pore size among micropores (below 2 nm), mesopores (2~50 nm), or macropores (above 50 nm). As a preferred example of a porous inorganic adsorbent, a porous inorganic adsorbent with mesopores (mesoporous inorganic adsorbent) can be cited. In addition, the shape of the aforementioned porous inorganic adsorbent is not particularly limited as long as it can be applied to a living organism and can be any shape among powders, granules, etc.

[0085] Other examples of substances that can adsorb onto indole compounds include organometallic structures (porous coordination polymers composed of metal ions and cross-linked organic ligands); tannic acid-based adsorbents such as tannic acid albumin; protein-based adsorbents such as albumin, lactoferrin, lactoglobulin, casein, and their fragments; thickeners such as gelatin, agar, alginic acid, carrageenan, pectin, and dextrin; micelles such as casein micelles; emulsifiers; synthetic adsorbents using polyvinylbenzene, polymethacrylic acid, polymethacrylic acid-divinylbenzene crosslinks, and polystyrene-divinylbenzene crosslinks as parent polymers; ion exchange resins; and similar structures thereof.

[0086] Among substances capable of adsorbing indole compounds, porous inorganic adsorbents (inorganic adsorbents) are preferred examples, and adsorbent carbon is more preferred. Spherical adsorbent carbon AST-120 (trade name: KREMEZIN), spherical adsorbent carbon (trade name: Mylan), and spherical adsorbent carbon (trade name: Nichii Kogyo) have been used clinically for the purpose of improving uremia symptoms in chronic renal failure and delaying the initiation of dialysis, and AST-120, spherical adsorbent carbon (Mylan), or spherical adsorbent carbon (Nichii Kogyo) may also be used as adsorbent carbon in this disclosure.

[0087] As for substances that can bind to indole compounds, there are no particular limitations as long as they interfere with the function of AHR ligands by binding to indole compounds. Specifically, examples include antibodies against indole compounds and their antibody fragments; albumin (recombinant albumin protein, etc.), albumin fragments, some peptides (including recombinant forms, etc.) and their analogues; AHR protein (recombinant AHR protein, etc.), some peptides (including recombinant forms, etc.) and their analogues; F-box protein (TIR1) (recombinant TIR1 protein, etc.), which is a subunit of the auxin (indole-3-acetic acid) receptor SCF (Skp1 / Cullin / F-box) complex, some peptides (including recombinant forms, etc.) and their analogues; serotonin receptor 4 (recombinant serotonin receptor 4 protein, etc.), some peptides (including recombinant forms, etc.) and their analogues; other indole compound-binding proteins (recombinant forms, etc.), some peptides and their analogues, etc. It should be noted that albumin has the property of binding to tryptamine and also the property of adsorbing to indole compounds. Therefore, albumin, albumin fragments, and some of its peptides can be used as any substance that can adsorb to or bind to indole compounds.

[0088] In one embodiment of the pH prevention or treatment drug (1) disclosed herein, the active ingredient is preferably a substance that can adsorb onto indole compounds, more preferably an inorganic adsorbent (porous inorganic adsorbent), further preferably adsorbent carbon, particularly preferably spherical adsorbent carbon, and even more preferably AST-120, spherical adsorbent carbon Mylan, or spherical adsorbent carbon Nichii Kogyo.

[0089] In the pH prevention or treatment drug (1) disclosed herein, a substance capable of removing indole compounds, which are metabolites of tryptophan, from the intestine may be used alone or in combination of two or more.

[0090] [Formulation] The pH prevention or treatment drug (1) disclosed herein can be provided by combining the aforementioned active ingredient with pharmaceutically permissible supports, additives, etc., and preparing it into a desired dosage form. Examples of pharmaceutically permissible supports or additives include, for example, sterile water, physiological saline, stabilizers, excipients, antioxidants, buffers, preservatives, surfactants, chelating agents, binders, etc.

[0091] Examples of dosage forms for the pH prevention or treatment drug (1) of this disclosure include, for example, capsules, tablets, pills, sachet preparations, liquids, powders, granules, fine granules, film-coated tablets, pellets, lozenges, sublingual tablets, chewable tablets, buccal tablets, pastes, syrups, suspensions, elixirs, or emulsions. The content of the aforementioned active ingredient in the pH prevention or treatment drug (1) of this disclosure may be appropriately set according to the dosage, dosage form, etc.

[0092] [Dosage and Usage] In the PH prevention or treatment drug (1) of this disclosure, there is no particular limitation on the clinical classification of the PH that is the target of prevention or treatment, and it can be any PH that is classified into Group 1, Group 1', Group 1'', Group 2, Group 3, Group 4, and Group 5 of the Nice Classification. As one embodiment of the PH prevention or treatment drug (1) of this disclosure, it can be used for the prevention or treatment of Group 1 (PAH) of the Nice Classification.

[0093] In addition, in the PH prevention or treatment drugs (1) of this disclosure, there is no particular limitation on the severity of PH that is the subject of treatment, and it can be any level of severity in the WHO functional classification of pulmonary hypertension from level I to level IV.

[0094] For the route of administration of the PH prevention or treatment drug (1) of this disclosure, as long as the aforementioned active ingredient can be transferred to the intestine, for example, oral administration and enteral administration can be cited, preferably oral administration.

[0095] The dosage of the pH prevention or treatment drug (1) disclosed herein can be appropriately set according to the age of the recipient, the degree of pH pathology, and the type of active ingredient used. For example, for adults, the dosage of the aforementioned active ingredient per day is approximately 1 to 80,000 mg / kg, preferably approximately 10 to 8,000 mg / kg, divided into 1 to 6 times per day, preferably 2 to 4 times per day. More specifically, if a porous inorganic adsorbent (especially adsorbent carbon) is used as the active ingredient, the dosage of the porous inorganic adsorbent per day for adults is approximately 10 to 8,000 mg / kg, preferably approximately 80 to 500 mg / kg, divided into 1 to 6 times per day, preferably 2 to 4 times per day.

[0096] 3. The concentration of tryptophan in feces, digestive tract contents, or blood samples is used as an indicator to check for the presence of the disease. Methods for determining the severity of pH (pH testing method (1)) The inventors of this application have realized that tryptophan absorption is impaired in the intestines of patients with PH, and that PH patients have high concentrations of tryptophan in their feces and digestive tract contents, and low concentrations of tryptophan in their blood compared to healthy individuals. Therefore, in one embodiment of this disclosure, a method for examining whether or not one has PH or the severity of PH is provided, the method comprising measuring the concentration of tryptophan in feces, digestive tract contents, or blood samples collected from a subject (hereinafter referred to as "PH examination method (1)"). The PH examination method (1) of this disclosure will be described in detail below.

[0097] In the PH diagnosis method (1) of this disclosure, the examinee can be anyone who needs to be checked for PH or whose PH severity needs to be checked. For example, those who need to be checked for PH can be healthy individuals or individuals suspected of having PH. Those who need to be checked for the severity of PH can be PH patients or individuals suspected of having PH.

[0098] In the pH testing method (1) of this disclosure, the biological sample from which the tryptophan concentration is to be measured can be any substance from feces, digestive tract contents, or blood samples. Digestive tract contents are preferably contents of the small intestine. Digestive tract contents can be collected, for example, by inserting a nasoenteric tube. Feces are preferably collected in a non-invasive manner. When using feces or digestive tract contents, an extract containing tryptophan can be prepared from the feces or digestive tract contents using an extraction solvent such as water as the sample for determining the tryptophan concentration. Furthermore, the blood sample can be any substance from whole blood, serum, or plasma; serum is a preferred example.

[0099] The concentration of tryptophan in fecal or digestive tract contents or blood samples can be determined using known methods such as high performance liquid chromatography, liquid chromatography-mass spectrometry, gas chromatography-mass spectrometry, and enzyme immunoassay (ELISA).

[0100] In the pH testing method (1) of this disclosure, when checking for PH, subjects with high concentrations of tryptophan in their feces or digestive tract contents are considered to have a high probability of having PH. In the PH testing, the concentration of tryptophan in feces or digestive tract contents can be determined as follows: the average or median concentration of tryptophan in feces or digestive tract contents of healthy individuals and / or PH patients is pre-calculated, or a threshold value between the two is identified as a reference value, and the determination is made based on a comparison with that reference value. For example, if the tryptophan concentration in the subject's feces or digestive tract contents is higher than the average or median concentration in the feces or digestive tract contents of healthy individuals, the subject is considered to have a high probability of having PH. Furthermore, if the tryptophan concentration in the subject's feces or digestive tract contents is equal to or greater than the average or median concentration in the feces or digestive tract contents of PH patients, the subject is considered to have a high probability of having PH. Based on the experimental results described later, the average concentration of tryptophan in feces has been confirmed to be 113.7 μg / g (fecal dry weight) for patients with PH, and the median concentration for patients with PH is 28.9 μg / g (fecal dry weight). The cutoff value with the best sensitivity and specificity between patients with PH and healthy individuals is 26.18 μg / g (fecal dry weight). Therefore, any of these values ​​can be used as a reference value to determine whether the subject has PH.

[0101] Furthermore, in the pH testing method (1) of this disclosure, when checking for PH, subjects with low tryptophan concentrations in their blood samples are considered to have a high probability of having PH. In the PH testing, the level of tryptophan concentration in the blood sample can be determined as follows: the average or median tryptophan concentration in blood samples from healthy individuals and / or PH patients is pre-calculated, or a threshold value between the two is identified as a reference value, and the determination is made based on a comparison with that reference value. For example, if the tryptophan concentration in the subject's blood sample is lower than the average or median tryptophan concentration in blood samples from healthy individuals, the subject is considered to have a high probability of having PH. Additionally, if the tryptophan concentration in the subject's blood sample is equal to or lower than the average or median tryptophan concentration in blood samples from PH patients, the subject is considered to have a high probability of having PH. Based on the experimental results described later, the average serum tryptophan concentration was confirmed to be 7.48 μg / mL for PH patients and 7.35 μg / mL for PH patients. The optimal cutoff value for sensitivity and specificity between PH patients and healthy individuals was below 13.0 μg / mL. Therefore, any of these values ​​can be used as a reference to determine whether a subject has PH.

[0102] Furthermore, in the pH testing method (1) of this disclosure, when examining the severity of pH, subjects with higher concentrations of tryptophan in their feces or digestive tract contents are considered to have a high degree of pH severity. In the examination of pH severity, the concentration of tryptophan in feces or digestive tract contents can be determined as follows: The average or median concentration of tryptophan in feces or digestive tract contents of pH patients is pre-calculated according to severity, or a critical value is identified to distinguish severity levels, and the determination is based on a comparison with this reference value.

[0103] Furthermore, in the pH testing method (1) of this disclosure, when testing the severity of pH, subjects with lower tryptophan concentrations in their blood samples are considered to have a high degree of pH severity. In testing the severity of pH, the level of tryptophan concentration in the blood sample can be determined as follows: The average or median tryptophan concentration of blood samples from patients with pH is calculated according to their severity, or a threshold value is identified as a reference value, and the determination is based on a comparison with this reference value.

[0104] In the pH testing method (1) of this disclosure, when the concentration of tryptophan in feces or digestive tract contents is high and the concentration of tryptophan in blood samples is low, the likelihood of having a high degree of pH or the likelihood of having a high degree of pH can be determined with higher accuracy compared to the case where only one indicator is used for judgment.

[0105] The PH examination method (1) of this disclosure can be performed as an auxiliary examination for the diagnosis of PH. Therefore, for subjects who have been judged to have a high probability of having PH or a high probability of having a severe degree of PH by the PH examination method (1) of this disclosure, it is desirable to perform further examinations such as catheterization, echocardiography, electrocardiography, and chest X-ray for the purpose of diagnosis.

[0106] In another embodiment of this disclosure, a test kit is provided for use in implementing the pH testing method (1). This test kit may contain reagents for determining tryptophan. Additionally, the test kit may, as needed, also contain apparatus for recovering feces or digestive tract contents, reagents for extracting tryptophan from feces or digestive tract contents, etc.

[0107] 4. The concentration of tryptophan metabolites in feces, digestive tract contents, or blood samples is used as an indicator to check for [the following]. Methods for determining whether someone has PH or the severity of PH (PH testing method (2)) The inventors of this application have realized that because the intestinal tract of patients with PH has a high concentration of tryptophan, the concentration of indole compounds (AHR ligands), which are metabolites of tryptophan, is also high in the intestinal bacterial community and in the blood. Therefore, in one embodiment of this disclosure, a method for checking whether someone has PH or the severity of PH is provided, the method comprising measuring the concentration of indole compounds, which are metabolites of tryptophan, in a fecal, digestive tract, or blood sample collected from a subject (hereinafter referred to as "PH testing method (2)"). The PH testing method (2) of this disclosure will be described in detail below.

[0108] In the pH testing method (2) of this disclosure, the subject, feces, digestive tract contents, and blood samples are the same as those in the aforementioned pH testing method (1).

[0109] In the pH testing method (2) of this disclosure, the indole compound to be measured only needs to be at least one selected from the group consisting of tryptophan, indole-3-carboxaldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid. Among these indole compounds, tryptophan concentration has a high correlation with the pathological pH state; therefore, it is preferable that the indole compound to be measured contains at least tryptophan. When two or more indole compounds are used as the measurement object, the total concentration of the two or more indole compounds is calculated.

[0110] The concentration of indole compounds in fecal, digestive tract contents or blood samples can be determined using known methods for tryptophan assay, such as high performance liquid chromatography, liquid chromatography-mass spectrometry, gas chromatography-mass spectrometry, and enzyme immunoassay (ELISA).

[0111] In the pH testing method (2) of this disclosure, when checking for PH, subjects with high concentrations of indole compounds in fecal, digestive tract contents, or blood samples are considered to have a high probability of having PH. In the PH testing, the concentration of indole compounds in fecal, digestive tract contents, or blood samples can be determined as follows: the average or median concentration of indole compounds in fecal, digestive tract contents, or blood samples from healthy individuals and / or PH patients is pre-calculated, or a threshold value between the two is identified as a reference value, and the determination is based on a comparison with that reference value. For example, if the concentration of indole compounds in a subject's fecal, digestive tract contents, or blood samples is higher than the average or median concentration in healthy individuals, the subject can be considered to have a high probability of having PH. In addition, if the concentration of indole compounds in the feces, digestive tract contents, or blood samples of the examinee is equal to or higher than the average or median concentration of indole compounds in feces, digestive tract contents, or blood samples of PH patients, it can be judged that the examinee is highly likely to have PH.

[0112] In the case of checking for PH, the specific reference values ​​inferred from the experimental results described below are as follows: For tryptophan concentration in feces, the average value for PH patients is confirmed to be 4648 ng / g (fecal dry weight), the median value is 1589 ng / g (fecal dry weight), and the optimal cutoff value for sensitivity and specificity between PH patients and healthy individuals is 1559 ng / g (fecal dry weight). For indole-3-carboxaldehyde concentration in feces, the average value for PH patients is confirmed to be 179.9 ng / g (fecal dry weight), the median value is 106.0 ng / g (fecal dry weight), and the optimal cutoff value for sensitivity and specificity between PH patients and healthy individuals is 97.13 ng / g (fecal dry weight). For the concentration of indole-3-pyruvate in feces, the average value was confirmed to be 1177 ng / g (fecal dry weight) in patients with pH, ​​the median value was 623 ng / g (fecal dry weight), and the optimal cutoff value for sensitivity and specificity between patients with pH and healthy individuals was 558 ng / g (fecal dry weight). For the concentration of indole-3-ethanol in feces, the average value was confirmed to be 363.1 ng / g (fecal dry weight) in patients with pH, ​​the median value was 155.9 ng / g (fecal dry weight), and the optimal cutoff value for sensitivity and specificity between patients with pH and healthy individuals was 342.6 ng / g (fecal dry weight). For the concentration of indole-3-acetic acid in feces, the average value was confirmed to be 13986 ng / g (fecal dry weight) in patients with pH, ​​the median value was 4851 ng / g (fecal dry weight), and the optimal cutoff value for sensitivity and specificity between patients with pH and healthy individuals was 6097 ng / g (fecal dry weight). For the concentration of indole-3-propionic acid in feces, the average value was confirmed to be 7238 ng / g (fecal dry weight) in patients with pH, ​​the median value was 2750 ng / g (fecal dry weight), and the optimal cutoff value for sensitivity and specificity between patients with pH and healthy individuals was 12630.8 ng / g (fecal dry weight). For the concentration of indole-3-acrylic acid in feces, the mean value for patients with pH (prone to hysteria) has been confirmed to be 174.1 ng / g (fecal dry weight), the median value for patients with pH is 84.5 ng / g (fecal dry weight), and the cutoff value for optimal sensitivity and specificity between patients with pH and healthy individuals is 159.2 ng / g (fecal dry weight). For the concentration of indole-3-lactic acid in feces, the mean value for patients with pH has been confirmed to be 20099 ng / g (fecal dry weight), the median value for patients with pH is 830.5 ng / g (fecal dry weight), and the cutoff value for optimal sensitivity and specificity between patients with pH and healthy individuals is 249.1 ng / g (fecal dry weight). At least one of these values ​​can be used as a reference to determine whether a subject has pH.

[0113] In the pH testing method (2) of this disclosure, when examining the severity of pH, subjects with higher concentrations of indole compounds in fecal, gastrointestinal contents, or blood samples are considered to have a high degree of pH severity. In the examination of pH severity, the concentration of indole compounds in fecal, gastrointestinal contents, or blood samples can be determined as follows: The average or median concentration of indole compounds in fecal, gastrointestinal contents, or blood samples of patients with pH is pre-calculated according to severity, or a critical value is identified to distinguish the severity level, and the determination is based on a comparison with this reference value.

[0114] The PH examination method (2) of this disclosure can be performed as an auxiliary examination for the diagnosis of PH. Therefore, for subjects who have been judged to have a high probability of having PH or a high probability of having a severe degree of PH by the PH examination method (2) of this disclosure, it is desirable to perform further examinations such as catheterization, echocardiography, electrocardiography, and chest X-ray for the purpose of diagnosis.

[0115] In another embodiment of this disclosure, a test kit is provided for use in implementing the pH test method (2). This test kit may contain reagents for determining indole compounds. Additionally, the test kit may, as needed, also contain apparatus for recovering feces or digestive tract contents, reagents for extracting indole compounds from feces or digestive tract contents, etc.

[0116] 5. Use the AHR activity in feces or digestive tract contents as an indicator to check whether PH is present or the severity of PH. Methods (pH test method (3)) The inventors of this application have realized that indole compounds, as metabolites of tryptophan, are AHR ligands. Since the concentration of these indole compounds is high in the intestines of patients with PH, this results in high AHR activity in feces and digestive tract contents. Therefore, in one embodiment of this disclosure, a method for examining whether PH is present or the severity of PH is provided, the method comprising measuring the AHR activity of feces or digestive tract contents collected from a subject (hereinafter referred to as "PH examination method (3)"). The PH examination method (3) of this disclosure will now be described in detail.

[0117] In the pH testing method (3) of this disclosure, the subject, feces, and digestive contents are the same as in the aforementioned pH testing method (1).

[0118] In the pH testing method (3) of this disclosure, the AHR activity and transcriptional activity of feces or digestive tract contents are measured. The transcriptional activity of AHR can be measured by the following method: A reporter gene detection cell line obtained by introducing a plasmid vector with a reporter gene linked downstream of a heterologous response sequence (XRE) is used. As a reporter gene, a luciferase gene can be used as an example. The aforementioned reporter gene detection cell line is cultured in the presence of a sample prepared from a test subject, and the expression level of the reporter gene is measured. The expression level of the reporter gene is proportional to the AHR activity (transcriptional activity). Therefore, the AHR activity in the aforementioned sample can be evaluated based on the expression level of the reporter gene. When using a luciferase gene as a reporter gene, the expression level of the luciferase gene can be measured by measuring the amount of light emitted by the catalytic reaction of luciferase due to the expression of the luciferase gene using an illuminometer. The reporter gene detection can be performed using commercially available reagents (including the detection cell line). As for reagents used to perform AHR luciferase reporter gene assays, INDIGO Biosciences' IB06001 and others are commercially available.

[0119] In the pH testing method (3) of this disclosure, when checking for PH, subjects with high AHR activity in their feces or digestive tract contents are considered to have a high probability of having PH. In the PH test, the level of AHR activity in feces or digestive tract contents can be determined as follows: the average or median AHR activity of feces or digestive tract contents in healthy individuals and / or PH patients is pre-calculated, or a threshold value between the two is identified as a reference value, and the determination is based on a comparison with that reference value. For example, if the AHR activity of a subject's feces or digestive tract contents is higher than the average or median AHR activity of healthy individuals, the subject is considered to have a high probability of having PH. Furthermore, if the AHR activity of a subject's feces or digestive tract contents is equal to or higher than the average or median AHR activity of PH patients, the subject is considered to have a high probability of having PH.

[0120] Furthermore, in the pH testing method (3) of this disclosure, when examining the severity of pH, subjects with higher AHR activity in feces or digestive tract contents are judged to have a high degree of pH severity. In the examination of pH severity, the level of AHR activity in feces or digestive tract contents can be determined as follows: the average or median AHR activity of feces or digestive tract contents is pre-calculated according to the severity of pH patients, or a critical value is identified to distinguish the severity level as a reference value, and the determination is based on a comparison with this reference value.

[0121] The PH examination method (3) of this disclosure can be performed as an auxiliary examination for the diagnosis of PH. Therefore, for subjects who have been judged to have a high probability of having PH or a high probability of having a severe degree of PH by the PH examination method (3) of this disclosure, it is desirable to perform further examinations such as catheterization, echocardiography, electrocardiography, and chest X-ray for the purpose of diagnosis.

[0122] In another embodiment of this disclosure, a testing kit is provided for use in implementing the pH testing method (3). This testing kit may include reagents for determining AHR activity (e.g., reagents for performing AHR luciferase reporter gene detection). Additionally, the testing kit may, as needed, also include apparatus for recovering fecal or digestive tract contents, reagents for extracting indole compounds from fecal or digestive tract contents, etc.

[0123] 6. Use the concentration of ACE2 in fecal, digestive tract contents, or blood samples as an indicator to check for PH or Methods for assessing the severity of pH (pH testing methods (4)) The inventors of this application have realized that because the indole compound (AHR ligand), a metabolite of tryptophan, is present in high concentrations in the intestines of patients with PH, ACE2 expression is reduced, resulting in low ACE2 concentrations in feces, digestive tract contents, and blood samples. Therefore, in one embodiment of this disclosure, a method for examining whether or not PH is present or the severity of PH is provided, the method comprising measuring the ACE2 concentration in feces, digestive tract contents, or blood samples collected from a subject (hereinafter referred to as "PH examination method (4)"). The PH examination method (4) of this disclosure will be described in detail below.

[0124] In the pH testing method (4) of this disclosure, the subject, feces, digestive contents, and blood samples are the same as those in the aforementioned pH testing method (1).

[0125] The concentration of ACE2 in intestinal bacterial communities or blood samples can be measured using known ACE2 assays such as enzyme immunoassay (ELISA), immunoprecipitation, Western blotting, and LC-MS / MS MRM. It should be noted that only the concentration of ACE2 and soluble ACE2 in blood samples needs to be measured.

[0126] In the pH testing method (4) of this disclosure, when checking for PH, subjects with low ACE2 concentrations in fecal, digestive tract contents, or blood samples are considered to have a high probability of having PH. In the PH testing, the level of ACE2 concentration in fecal, digestive tract contents, or blood samples can be determined as follows: the average or median ACE2 concentration in fecal, digestive tract contents, or blood samples of healthy individuals and / or PH patients is pre-calculated, or a threshold value between the two is identified as a reference value, and the determination is based on a comparison with that reference value. For example, if the ACE2 concentration in a subject's fecal, digestive tract contents, or blood samples is lower than the average or median ACE2 concentration in healthy individuals, the subject is considered to have a high probability of having PH. In addition, if the ACE2 concentration in the feces, digestive tract contents, or blood samples of the examinee is equal to or lower than the average or median ACE2 concentration in patients with PH, it can be judged that the examinee is highly likely to have PH.

[0127] Furthermore, in the pH testing method (4) of this disclosure, when examining the severity of pH, subjects with lower ACE2 concentrations in fecal, gastrointestinal contents, or blood samples are considered to have a high degree of pH severity. In the examination of pH severity, the level of ACE2 concentration in fecal, gastrointestinal contents, or blood samples can be determined as follows: The average or median ACE2 concentration in fecal, gastrointestinal contents, or blood samples of patients with pH is pre-calculated according to severity, or a critical value is identified to distinguish the severity level, and the determination is based on a comparison with this reference value.

[0128] The PH examination method (4) of this disclosure can be performed as an auxiliary examination for the diagnosis of PH. Therefore, for subjects who have been judged to have a high probability of having PH by the PH examination method (4) of this disclosure, it is expected to perform further examinations such as catheterization, echocardiography, electrocardiography, and chest X-ray.

[0129] In another embodiment of this disclosure, a test kit is provided for use in implementing the pH test method (4). This test kit may contain reagents for measuring ACE2 (e.g., anti-ACE2 antibody, etc.). Additionally, the test kit may, as needed, also contain apparatus for recovering intestinal bacterial communities, reagents for extracting ACE2 from feces or digestive tract contents, etc.

[0130] 7. PH prevention or treatment drugs based on the mechanism of increased ACE2 expression in the intestine (2) The inventors of this application have realized that because the indole compound (AHR ligand), a metabolite of tryptophan, is present in high concentrations in the intestines of patients with PH, the expression level of ACE2 is reduced, which leads to a decrease in the function of BOAT1, resulting in the pathological condition of PH. Therefore, in one embodiment of this disclosure, a PH prevention or treatment drug (hereinafter referred to as "PH prevention or treatment drug (2)") is provided, which contains a substance that increases the expression level of ACE2. The PH prevention or treatment drug (2) of this disclosure will be described in detail below.

[0131] [Active Ingredients] The PH prevention or treatment drug (2) disclosed herein contains a substance that increases the expression level of ACE2 as an active ingredient. The PH prevention or treatment drug (2) disclosed herein increases the expression level of ACE2 in the intestine, thereby normalizing the function of BOAT1, thereby preventing or treating PH.

[0132] As for substances that increase ACE2 expression, there are no particular limitations as long as they can promote ACE2 expression and are pharmaceutically permissible. Examples include bile acids (ursodeoxycholic acid, etc.), mineralocorticoid receptor antagonists, 17β-estradiol, atorvastatin, diacetamide triazine, fibroblast growth factor 21 (FGF21), and polyinosinic acid-polycytidylate potassium salt (Poly(I:C)).

[0133] In the PH prevention or treatment drug (2) of this disclosure, the substance that increases the expression of ACE2 can be used alone or in combination with two or more substances.

[0134] [Formulation] The pH prevention or treatment drug (2) disclosed herein can be provided by combining the aforementioned active ingredient with pharmaceutically permissible supports, additives, etc., and preparing it into the desired dosage form. Examples of pharmaceutically permissible supports or additives include, for example, sterile water, physiological saline, stabilizers, excipients, antioxidants, buffers, preservatives, surfactants, chelating agents, binders, etc.

[0135] Examples of dosage forms for the pH prevention or treatment drug (2) of this disclosure include, for example, capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film-coated tablets, pellets, lozenges, sublingual tablets, chewable tablets, buccal tablets, pastes, syrups, suspensions, elixirs, or emulsions. The content of the aforementioned active ingredient in the pH prevention or treatment drug (2) of this disclosure may be appropriately set according to the dosage, dosage form, etc.

[0136] [Dosage and Usage] In the PH prevention or treatment drug (2) of this disclosure, there is no particular limitation on the clinical classification of the PH that is the target of prevention or treatment, and it can be any PH that is classified into Group 1, Group 1', Group 1'', Group 2, Group 3, Group 4, and Group 5 of the Nice Classification. As one embodiment of the PH prevention or treatment drug (2) of this disclosure, it can be used for the prevention or treatment of Group 1 (PAH) of the Nice Classification.

[0137] In addition, in the PH prevention or treatment drugs (2) of this disclosure, there is no particular limitation on the severity of PH that is the subject of treatment, and it can be any severity from grade I to grade IV in the WHO functional classification of pulmonary hypertension.

[0138] For the route of administration of the PH prevention or treatment drug (2) of this disclosure, as long as the aforementioned active ingredient can be transferred to the intestine, for example, oral administration and enteral administration can be cited, preferably oral administration.

[0139] The dosage of the PH prevention or treatment drug (2) disclosed herein can be appropriately set according to the age of the recipient, the degree of PH pathology, and the type of active ingredient used. For example, the dosage of the aforementioned active ingredient for adults is about 1 to 100 mg / kg per day, preferably about 1 to 20 mg / kg, divided into 1 to 4 times per day, preferably 2 to 3 times per day.

[0140] Example The following embodiments are illustrated in more detail, but this disclosure should not be construed as limited to these embodiments.

[0141] 1. Experimental Materials and Methods 1-1. Clinical Research With the approval of the ethics committee, stool and blood samples were collected from 89 patients with pulmonary hypertension (PH) and 82 healthy individuals. The PH patients included: 40 cases of idiopathic / hereditary pulmonary arterial hypertension (PAPH), 19 cases of connective tissue disease-related PAPH, 10 cases of portal pulmonary hypertension, 8 cases of chronic thromboembolic pulmonary hypertension, 7 cases of PAPH due to congenital shunt disease, and 5 other cases. The healthy individuals were a age- and sex-matched group. Background factors for PH patients and healthy individuals are shown in Table 2. Stool samples were collected from the subjects and transported to the laboratory as quickly as possible at 4°C, then stored at -80°C until analysis. Blood samples were centrifuged at 3500 rpm for 5 minutes to recover serum, and stored at -80°C until analysis.

[0142] [Table 2] 1-2. Determination of short-chain fatty acid concentration in feces To determine the organic acids in feces, 100 mg of feces was added to a 2.0 mL tube along with zirconia beads and suspended in MilliQ. The sample was heated at 85 °C for 15 minutes, vortexed at 5 m / s for 45 seconds using a FastPrep 24 5G (MPBiomedicals, CA, USA), centrifuged at 15,350 × g for 10 minutes, and the supernatant was filtered through a 0.2 μm filter. The concentration of organic acids in the filtrate was determined by post-column reaction using a high-performance liquid chromatography (HPLC) system (Prominence, SHIMADZU, Kyoto; detector (CDD-10A, SHIMADZU, Kyoto, Japan), two columns in tandem (Shim-pack SCR-102(H), 300 mm × 8 mm ID, SHIMADZU, Kyoto, Japan) and a guard column (Shim-pack SCR-102(H), 50 mm × 6 mm ID, SHIMADZU, Kyoto, Japan). The mobile phase (5 mM p-toluenesulfonic acid) and reaction solution (5 mM p-toluenesulfonic acid, 100 μM EDTA, 20 mM Bis-Tris) were used in this determination.

[0143] 1-3. Animal experiments All experiments were conducted in accordance with the guidelines of the Animal Committee of the National Center for Cardiology and were also approved by the Facility Review Committee of the National Center for Cardiology. Ahr knockout (Ahr - / -) rats (Masaki et al., PNAS, 2021, 118(11):e2023899118), Ace2 knockout rats (Ace2 - / y), and Slc6a19 knockout rats (Slc6a19 + / -, - / -) were prepared by CRISPR / Cas9 gene editing. All rats were fed a light-dark cycle of 12 hours / 12 hours at 24±1°C and were given standard mouse feed and water.

[0144] 1-3-1. Limitation Test Male germ-free F344 rats were purchased from SLC Corporation of Japan and housed in a sterile isolator environment. Pulmonary hypertension models were established by administering feces from healthy individuals or patients with pulmonary hypertension to 11-week-old rats and by subcutaneously administering mulberry alkaloid (MCT) to 15-week-old rats. Specifically, feces from four healthy individuals were first mixed in an anaerobic chamber and diluted with anaerobic transport medium (containing 20g Lablemco powder, 1g L-cysteine, 0.45g KH₂PO₄, 0.9g NaCl, 0.45g (NH₄)₂SO₄, 0.045g CaCl₂, 0.045g MgSO₄, 400mL glycerol, and 600mL distilled water per 1000mL) to prepare a diluted solution of healthy feces. Similarly, feces from four patients were mixed in an anaerobic chamber and diluted with anaerobic transport medium to prepare a diluted solution of patient feces. Next, 11-week-old rats were orally administered either diluted fecal matter from healthy individuals (final 10-fold dilution) or diluted fecal matter from patients (final 10-fold dilution) in different isolators to create fecal transplantation-based microbial-limited rats that reproduced the intestinal bacterial communities of healthy individuals and patients. Four weeks after fecal transplantation (15 weeks of age), 60 mg / kg of styraxine (Sigma Aldrich) was subcutaneously injected, followed by three weeks of isolating to create a PH model microbial-limited rat based on styraxine loading. The baseline information of PH patients and healthy individuals used for fecal transplantation is shown in Table 3.

[0145] [Table 3] (Bacterial restriction experiment with AHR inhibitor) A pulmonary hypertension (PAH) model was established in 11-week-old germ-free rats by administering feces from patients and subcutaneously administering lily alkaloid at 15 weeks of age. From the day following lily alkaloid administration, the mediator group received corn oil via gastric tube at 8 mg / kg / day, while the AHR inhibitor group received CH223191 (Sellec) via gastric tube at 8 mg / kg / day. On day 21 following lily alkaloid administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organ samples were collected.

[0146] (Bacterial restriction test with low-tryptophan or high-tryptophan diet) Eleven-week-old germ-free rats were fed feces from patients, while 13-week-old rats were divided into low-tryptophan and high-tryptophan diet groups. The low-tryptophan diet group was fed a diet containing 0.1 w / w% tryptophan, while the high-tryptophan diet group was fed a diet containing 1.25 w / w% tryptophan. At 15 weeks of age, lily alkaloids were administered subcutaneously to induce pulmonary hypertension. On day 21 after lily alkaloid administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organs were collected.

[0147] (Bacterial restriction test for transplanting a single bacterium or two types of bacteria) Active rumenococci (JCM6515) and Streptococcus pasteurellii (isolated from the feces of rats transplanted with patient feces) were cultured anaerobically at 37°C in Trypticase Soy Broth. Eleven-week-old germ-free rats were inoculated with either a single strain or both strains of active rumenococci and Streptococcus pasteurellii. Pulmonary hypertension was induced at 15 weeks of age by subcutaneous administration of lycopene. On day 21 following lycopene administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organs were collected.

[0148] (Bacterial restriction test with AST-120) A pulmonary hypertension model was established in germ-free rats by administering feces from patients to 1-week-old rats and subcutaneously administering lily alkaloid at 15 weeks of age. From the day following lily alkaloid administration, the mediator group received a standard sample (CRF-1 powdered diet), while the AST-120 group received CRF-1 powdered diet containing 8 w / w% AST-120. On day 21 after lily alkaloid administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces and organs were collected.

[0149] 1-3-2. Experiments in SPF (Specific Pathogen Free) Environments Sprague-Dawley (SD) rats were purchased from Charles River Pharmaceuticals, Japan, for experiments in an SPF (Spectrum Free) environment. Male rats aged 6-8 weeks were used in the experiments.

[0150] 1-3-3. Experiments using Regnase-1 CD11c-Cre mice Regnase-1 CD11c-Cre (Reg-1 CKO) mice were used, provided by Professor Takeuchi Osamu of the Graduate School of Medicine, Kyoto University (Yaku et al., 2022, Circulation, 146(13):1006-1022).

[0151] 1-3-4. Experiment with the application of tryptophan In 13-week-old germ-free F344 rats, the mediator group was fed a standard diet (CRF-1 powdered diet), while the tryptophan group was fed a CRF-1 powdered diet containing 1.25 w / w% tryptophan. At 15 weeks of age, 60 mg / kg of limonene was subcutaneously administered to induce pulmonary hypertension. On day 21 after limonene administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organs were collected.

[0152] 1-3-5. Experiment with AST-120 (SD rats; determination of tryptophan metabolites) Six-week-old male SD rats were randomly divided into a vector group and an AST-120 group. The vector group was fed a standard diet (CRF-1 powdered diet), while the AST-120 group was fed a CRF-1 powdered diet containing 8 w / w% AST-120. Feces were collected on day 7, and the tryptophan metabolites (indole compounds) in the feces were determined by LC-MS.

[0153] (Measurement of right ventricular systolic pressure in SD rats subjected to wild lily alkaloid loading) Six-week-old male SD rats raised in an SPF environment were randomly divided into a vector group and an AST-120 group. At six weeks of age, both groups were subcutaneously administered 60 mg / kg of limonene to induce pulmonary hypertension. The vector group was fed a standard diet (CRF-1 powdered diet), while the AST-120 group was fed a CRF-1 powdered diet containing 8 w / w% AST-120. Both groups were raised for 3 weeks. Right ventricular systolic pressure was measured 3 weeks after limonene administration.

[0154] (Determination of right ventricular systolic pressure in SD rats under hypoxic load) Six-week-old male SD rats housed in an SPF environment were randomly divided into a vector group and an AST-120 group. Both groups were housed continuously in a chamber under 10% oxygen conditions for 4 weeks. During the 10% oxygen period, the vector group was fed a standard diet (CRF-1 powdered diet), while the AST-120 group was fed a CRF-1 powdered diet containing 8 w / w% AST-120. Right ventricular systolic pressure was measured after 4 weeks of 10% oxygen housing.

[0155] (Regnase-1 CD11c-Cre mouse) Four-week-old Regnase-1 CD11c-Cre (Regnase-1 KO) mice were randomly divided into a vector group and an AST-120 group. The vector group was given a standard sample (CRF-1 powdered diet), while the AST-120 group was given CRF-1 powdered diet containing 8 w / w% AST-120. After four weeks, right ventricular systolic pressure and right ventricular hypertrophy index were measured.

[0156] 1-4. Measurement of right ventricular systolic pressure Rats were sedated and analgesic via inhalation anesthesia using isoflurane (Pfizer). During surgery, the rats' body temperature was maintained at 37°C–38°C using a thermostat-controlled heating pad linked to rectal temperature monitoring. The trachea was opened, and ventilation was performed using a rat ventilator (Harvard apparatus) at a rate of 10 μL / g per breath at 70 breaths / min. Right ventricular pressure (RVP) was measured by inserting a polyethylene tube into the right external jugular vein up to the right ventricle. The RVP signal was detected using a pressure transducer (MLT0670; AD Instruments), relayed by a pressure amplifier (ML117; AD Instruments), continuously sampled using a Power Lab system (AD Instruments Colorado Springs, CO.), and recorded in a computer using Chartsoftware (AD Instruments). Heart rate was calculated based on the peak systolic velocity of the right ventricle.

[0157] Except for (1) setting the ventilator to 160-170 breaths / minute and (2) inserting a 24G needle with a polyethylene-guided catheter into the right ventricle under the diaphragm to measure RVP, the right ventricular systolic pressure in mice was measured under the same conditions as in rats.

[0158] 1-5. Measurement of the right ventricular hypertrophy index (Fulton index) After measuring the right ventricular systolic pressure, rats were euthanized by administering an overdose of anesthetic, and their hearts were removed. After disassembling the atria, the right ventricle was separated from the left ventricle and interventricular septum. After removing water, the weight of the right ventricle and the weight of the left ventricle plus the interventricular septum were measured, and the weight ratio (right ventricle / left ventricle weight ratio) was calculated as the right ventricular hypertrophy index to evaluate right ventricular hypertrophy.

[0159] 1-6.RNA-seq analysis The quality of RNA and library preparation was ensured by TapeStation (Agilent). For RNA-sequencing analysis of rat lungs, 100 ng of total RNA was used to remove ribosomal RNA, followed by library preparation using the TruSeq StrandedmRNA Sample Preparation Kit (Illumina). For RNA-sequencing analysis of human or rat peripheral blood mononuclear cells (PBMCs), 100 pg of total RNA was used, and the library was prepared using the SMART-seq v4 Ultra Low InputRNA Kit (Takara Clontech). Each sample contained 75 bp paired reads, resulting in over 25 million reads. FastQC was used for sequencing data quality management. For each pruned and filtered read, alignment was performed separately for rats using the rat genome (Rn6) and the rat genome Version rn6 reference genome, and for humans using Hisat2 and the human genome (hg38) reference genome. In lung tissue, gene clusters specifically expressed are defined as those showing a change in expression greater than 2-fold or less than 1 / 2, satisfying a false discovery rate (FDR) < 0.05. For gene clusters specifically expressed in PBMCs, this is defined as those showing a change in expression greater than 1.5-fold in humans and greater than 2-fold in rats, satisfying P < 0.05.

[0160] 1-7. Metagenomic Analysis (16S analysis) DNA was extracted from feces using the NecleoSpin DNA stool (Macherey-Nagel). Libraries were prepared according to the protocol using 16S Setagenomic Sequencing Library Preparation (Illumina) and primer sets targeting 16S ribosomal RNA V1-V2 (27Fmod: 5'-AGRGTTTGATCMTGGCTCAG-3' (Sequence No. 1) and 338R: 5'-TGCTGCCTCCCGTAGGAGT-3' (Sequence No. 2)). Amplicon sequencing of 251 bases was performed using the MiSeq System (Illumina). The resulting paired-end reads were merged using PEAR (sco.h-its.org / exelixis / web / software / pear / ) and trimmed using BBtrim (bbmap.sourceforge.net). In addition, up to 20,000 reads were randomly extracted from the sample using random_sequence_sample.pl (ualberta.ca / ~stothard / software.html). The processed sequences were clustered into OTUs (operational taxonomic units) based on UCLUST version 1.2.33q and 99% homology. Each OTU was taxonomically classified using the Silvav138 database, and bioinformatics analysis of the bacterial community was performed using QIIME version 2.

[0161] (Shotgun technique analysis) Whole-genome sequencing was performed using DNBSEQ-G400 (MGI Tech), generating 150-base paired-end reads. The main steps of the quality control (QC) process were (i) trimming of low-quality bases, (ii) removal of duplicate reads, and (iii) identification and masking of human reads. Duplicate reads were marked using PRINSEQ-lite53 (version 0.20.4). The original reads were trimmed using Trimomatic (version 0.39) with Illumina adapters to cut off low-quality bases at both ends. Reads shorter than 60 bp after trimming were discarded. Then, only the longest read among the identical sequence repeats was retained for deduplication. As the final stage of QC, the quality-filtered reads were aligned with the human reference genome (hg38) using bowtie2 (version 2.3.5) and BMTagger (version 3.101). Only reads that failed paired-end alignment in any tool were retained. For phylogenetic annotation and abundance quantification, bowtie2 was used to align filtered paired-end reads to a reference genome dataset. For reads with multiple mappings, only the best alignment was selected based on the alignment score. The number of reads mapped to each genome was divided by the genome length. For each sample, the values ​​for each genome were summed to calculate the relative abundance at the species level (grade).

[0162] Using MEGAHIT (version 1.2.9), filtered paired-end reads were de novo assembled into contigs. Open reading frames (ORFs) on the contigs were predicted using MetageneMark (version 3.38). Next, the ORF catalog was annotated using the Kyoto Encyclopedia of Genes and Genomes (KEGG) protein database (https: / / www.kegg.jp). Annotation was performed using the database of KEGG genes from prokaryotes and MGENES databases of KEGG genes used as metagenomic samples. BLASP (version v0.9.32.133) was used to align the estimated amino acid sequences translated from the ORF catalogs with the KEGG protein database using DIAMOND. To quantify ORF abundance, bowtie2 was used with default parameters to map filtered paired-end reads to the assembled contigs. To avoid gene size bias, ORF abundance was defined as the depth of the region of each ORF in the ORF catalog, based on the mapping results. After sample QC, bacterial biomass data were QC and standardized. Next, the abundance data of orthologs of microbial genes were standardized.

[0163] 1-8. Luciferase assay For AHR luciferase reporter gene assay, INDIGO Biosciences' IB06001 was used, and the procedure was performed according to the instructions except for the stimulation conditions. For stimulation, the culture medium described in the instructions was used, with serum or fecal extract using PBS added to achieve a final concentration of 10 w / v%.

[0164] 1-9. LC-MS Analysis The standard substances of tryptophan and indole compounds, as determined by LC-MS analysis, are shown in Table 4.

[0165] [Table 4] 1-10. Preparation of the test sample For serum, add 4 times the volume of methanol, vortex, and centrifuge. Use the supernatant for analysis. For feces, add 4 times the volume of 0.1% formic acid aqueous solution to break down microbeads and homogenize. Mix the supernatant after centrifugation with an equal volume of methanol. Centrifuge the sample with methanol mixture again, filter the supernatant, and use it for analysis. In the determination of IPyA in serum and feces, when adding methanol, add three times the volume of 0.25 mol / L 2-aminoethanethiol (pH 8.0) to the supernatant, react at room temperature for 1 hour, centrifuge, and use the supernatant as the TAZ for analysis.

[0166] 1-11. LC-MS Analysis Ultra-high performance liquid chromatography (UHPLC) separation was performed using a Shimadzu Nexera UHPLC system. The column used was a Shimadzu GLC Shim-pack Scepter C18 with an inner diameter of 2.1 mm, a length of 100 mm, and a particle size of 3 μm. Mobile phase A consisted of 0.1% formic acid aqueous solution, and mobile phase B consisted of 0.1% formic acid acetonitrile. Mass spectrometry was performed using an LCMS-8060NX or 8060 triple quadrupole mass spectrometer (Shimadzu Corporation). MRM transition optimization was performed using standard solutions. Initial data for metabolites were analyzed using LabSolutions LCMS (Shimadzu).

[0167] Multi-component simultaneous LC-MS analysis was performed using Shimadzu's method package (cell culture profile, primary metabolites) via relative comparisons based on area values. A Supelco Discovery HS F5-3 column with an inner diameter of 2.1 mm, a length of 150 mm, and a particle size of 3 μm was used. Mobile phase A consisted of 0.1% formic acid aqueous solution, and mobile phase B consisted of 0.1% formic acid acetonitrile. Mass spectrometry was performed using an LCMS-8060NX triple quadrupole mass spectrometer (Shimadzu Corporation).

[0168] 1-12. Single-cell RNAseq analysis Immune cells were isolated from surgically harvested lung tissue. Specifically, lung tissue was minced with scissors in a digestive solution containing Hanks balanced salt solution (HBSS) with the addition of collagenase (Sigma), DNase I (Roche), and Dispase (Thermo), followed by mechanical destruction using gentleMACS (Miltenyi Biotec). For the resulting cells, Percoll density gradient centrifugation was applied to concentrate the immune cells, and the fraction containing the immune cells was recovered. Immune cells were isolated using FACS Aria Fusion (BD Biosciences). Dead cells were excluded by 7-aminoactinomycin D (7-AAD) staining. The selected cells were loaded onto Chromium Next GEM ChipG (10x Genomics) on a Chromium Controller (10x Genomics) for barcoding and cDNA synthesis. cDNA amplification and library construction were performed using the ChromiumNext GEM Single Cell 3' GEM, Library & Gel Bead Kit v3.1, or 3' profiling using the Chromium Next GEM Single Cell 3' Kit v3.1 (10x Genomics), following the manufacturer's protocol. Libraries were sequenced using DNBSEQ-G400 (MGI Tech). Droplet libraries were processed using Cell Ranger 5.0.0 (10XGenomics). Sequencing reads were aligned to the GRCh38 human reference genome using STAR (v2.7.2a) 50. Analysis was performed using a filtered expression matrix created using Cell Ranger count. Cells with unique molecular identifiers (UMIs) below the 1st percentile or above the 99th percentile were excluded from each sample. Additionally, cells expressing fewer than 200 genes, and cells with more than 10% of reads from mitochondrial genes or hemoglobin genes were also excluded. Uniform manifold approximation and projection (UMAP), cell type annotation, and expression differential analysis were performed using BBrowser X (BioTuring).

[0169] 1-13. Experiments using CACO-2 cells (in vitro) Human CACO-2 colon cancer cell line obtained from ATCC was used. The culture medium used was minimum essential medium (MEM; Nacalai tesque) supplemented with 20% fetal bovine serum (SIGMA), 1% non-essential amino acids (Nacalai tesque), 100 U / ml penicillin, and 100 μg / ml streptomycin (Nacalaitesque). CACO-2 cells were seeded into 12-well plates and cultured at 37°C in a 5% CO2 humidified incubator. The medium was changed twice a week, and experiments were performed after 21 days. During the experiments, tryptophan or BAY-218 (AChemBlock) was added to the medium at a specified concentration. Cells were recovered after 72 hours, and the expression level of ACE2 protein was measured.

[0170] 1-14. Tritium-labeled tryptophan intake experiment (Ex-vivo) Tritium-labeled tryptophan use 3 H-tryptophan, L-[5- 3 [H] (American Radiolabeled Chemicals). After washing the rat small intestine with cold physiological saline, an everted intestinal ring was prepared using a 1 ml pipette. For the intake experiment, HBSS (Hanks' Balanced Salt Solution, containing Ca2+ and Mg2+) with added COmplete (Roche) was used, with 0.1 μCi of tritium-labeled tryptophan added, and incubated at room temperature for 5 minutes. For Na-free HBSS, NaCl was replaced with choline-Cl and Na2HPO4 was replaced with K2HPO4. After washing the intestine with Na-free HBSS, it was dissolved in liquid scintillation solution (pico-fluor plus, PerkinElmer), and the radiation dose was measured using a liquid scintillation counter (Tri-Carb 4910TR, PerkinElmer). The radiation dose ingested under Na-free HBSS and Na2HPO4 was calculated. + The ratio of ingested radiation to HBSS levels was used to evaluate sodium-dependent tryptophan intake.

[0171] 1-15. Western Imprint Method Proteins were extracted from Caco 2 monolayers or rat small intestinal epithelial cells in radioimmunoprecipitation assay buffer (50 mM Tris pH 7.4, 150 mM sodium chloride, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, and a mixture of 1000 protease inhibitors). Proteins were quantified using the BCA protein assay kit (Thermo Fisher Scientific) after centrifugation at 20,000 × g, 4 °C, for 15 minutes. Equal volumes of protein were loaded onto a SuperSepace 5-20 (FUJIFILM) membrane and transferred to a 0.2 μm polyvinylidene fluoride Plus membrane. After blocking with 5% skim milk (Nacalai tesque) at room temperature for 1 hour, the membrane was incubated overnight at 4 °C with the following primary antibodies: anti-ACE2 antibody (NOVUS) and anti-β-actin antibody (Cell signaling). After washing, the membrane was incubated with horseradish peroxidase (HRP)-labeled secondary antibody (Cell Signaling) at room temperature for 1 hour and visualized using ECL-plus (Thermo Fisher Scientific) and an imaging system (Cytiva). Regarding protein expression, β-actin expression was normalized, and the densitometry of the Western blot bands was analyzed using ImageJ.

[0172] 1-16. Bacterial Culture (In Vitro) Active rumenococci (JCM6515), *Streptococcus salivarius* (JCM5707), *Streptococcus pasteurellis* (isolated from feces of rats with limited bacterial counts after fecal transplantation from patients at the National Center for Circulatory Diseases), *Streptococcus mutans* (JCM5705), and *Rhodotorula argyraceae* (JCM11412) were cultured in trypticase soy medium under anaerobic conditions at 37°C. The indole compounds derived from tryptophan in the culture supernatant were determined by LC-MS. Active rumenococci were cultured in trypticase soy medium and trypticase soy medium containing 0.5% mucin (Sigma) for 24 hours, and turbidity (bacterial count) was determined using a MicroScan Turbidity Meter (BECKMAN).

[0173] 1-17. qPCR Rat or human lung tissue, or PBMCs or cultured cells, were dissolved using TRIzol (Invitrogen). Total RNA was extracted using the PureLink RNA Mini Kit (Invitrogen) and PureLink DNase (Invitrogen). Quantitative real-time RT-PCR was performed using the QuantiFast SYBRGreen RT-PCR kit (Qiagen) or the PrimeScript RT reagent kit (TAKARA BIO) and FastStart Essential DNA Green Master (Roche). When using the former, 80 ng of total RNA was subjected to the following qRT-PCR reaction: transcription at 50°C for 10 min, denaturation at 95°C for 5 min, followed by 45 cycles at 95°C for 10 seconds and 60°C for 30 seconds. Fluorescence data were recovered and analyzed using a LightCycler 96 (Roche). The genes used and their primers are listed below.

[0174] Gapdh: FW: AAAGGGTCATCATCTCCGCC (Serial Number 3) RV: AGTGATGGCATGGACTGTGG (Serial Number 4) Mucin2: FW: ACCACCATTACCACCACCTCAG (Serial Number 5) RV: CGATCACCACCATTGCCACTG (Serial Number 6) 1-18. Determination of the adsorption capacity of adsorbent carbon L-valine, L-glutamic acid, and 3-aminoisobutyric acid were each dissolved in PBS(-) at a concentration of 20 mg / ml to prepare stock solutions. Additionally, L-tryptophan, tryptophan, indole-3-carboxaldehyde, and indole-3-acetic acid were each dissolved in dimethyl sulfoxide at a concentration of 100 mg / ml to prepare stock solutions. The resulting stock solutions were mixed and diluted with PBS(-) to prepare a compound mixture containing each compound at a concentration of 0.1 mg / ml.

[0175] Add 20 mg of each of the following activated carbons to a 15 ml volumetric tube: AST-120 (CAS: 90597-58-3, KUREHACORPORATION), pharmaceutical activated carbon (CAS: 16291-96-6, Nikichi Kogyo Co., Ltd.), and granulated activated carbon (CAS: 7440-44-0, UES Co., Ltd.). Then add the aforementioned compound mixture to bring the total volume of activated carbon and compound mixture to 10 ml. Next, gently stir at 37°C for half a day, remove the activated carbon by filtration, and recover the filtrate. Analyze the obtained filtrate by LC-MS to quantify the concentration of each compound. As a control, the same procedure was performed except that no activated carbon was added. The adsorption rate of the activated carbon for each compound was calculated using the following formula.

[0176] Adsorption rate = {(AB) / A} × 100 A: Compound concentration in the control filtrate B: Compound concentration of the filtrate with added adsorbent carbon 1-19. Statistics All data are presented as mean ± standard error or standard deviation. Significant differences among multiple groups were tested using one-way ANOVA with a post-hoc test. Two-group comparisons were performed using the Student's t-test or the Mann-Whitney test. Event-free survival curves were derived using the Kaplan-Mayer method and compared using the log-rank test. Network analysis was performed using Spearman's rank correlation. A p-value less than 0.05 was considered statistically significant.

[0177] 2. Previous reports from the inventor (Non-patent literature 6) 2-1. In PAH patients, serum AHR activity is elevated, and serum AHR activity reflects the severity of PAH. It was confirmed that, in terms of serum AHR agonist activity (AHR-Luc activity) in PAH patients and healthy volunteers (HV), it was significantly higher in PAH patients compared to HV. Figure 2 A). Furthermore, serum AHR-Luc activity is known to be significantly higher in PAH patients with more severe symptoms (WHO Pulmonary Hypertension Functional Classification III and IV) than in those with milder symptoms (WHO Pulmonary Hypertension Functional Classification I and II). Figure 2 B). Furthermore, it has been reported that PAH patients with high AHR-Luc activity have a significantly higher likelihood of experiencing serious clinical events such as death, lung transplantation, and hospitalization due to right heart failure compared to PAH patients with low AHR-Luc activity. Figure 2C). Thus, the inventors of this application have discovered that the activation of AHR plays an important role in the pathogenesis of PAH, and the activation of AHR in serum can serve as an indicator of the severity of PAH.

[0178] 2-2. FICZ, as an endogenous AHR ligand, induced endometrial lesions in rats by combining with hypoxia stimulation. Severe pulmonary hypertension 6-Formylindolo[3,2-b]carbazole (FICZ) is an endogenous and potent AHR agonist. Results were reported in rats subjected to hypoxia (10% O2) and subcutaneous FICZ administration during the first 3 weeks (FICZ / Hx / Nx rat model). Figure 2 A), right ventricular systolic pressure ( Figure 2 B) and Fulton's index ( Figure 2 C) significantly increased. Additionally, medial thickening was observed not only in the distal pulmonary alveolar arteries of FICZ / Hx / Nx rats. Figure 2 The appearance of D and E can also be seen in obliterative lesions caused by neointimal hyperplasia. Figure 2 The presence of D, F, G). Thus, the inventors of this application have discovered that AHR activation is one of the causes of the onset and severity of PH.

[0179] 2-3. In the SuHx rat model, knocking out AHR significantly suppressed the PAH pathological state. The SuHx rat model is a model of PAH pathology induced by administration of the VEGF receptor antagonist SU5416, followed by hypoxia and normoxic loading. An AHR knockout SuHx rat model (Ahr- / - rats) was established using the CRISPR / Cas9 gene editing system. The results obtained from observing PAH pathology are reported below. No right ventricular systolic pressure (...) was observed in Ahr- / - rats. Figure 3 B) and Fulton's index ( Figure 3 C) increased. In Ahr- / - rats, compared with Ahr+ / +, the medial hypertrophy index of the distal pulmonary alveolar arteries was significantly reduced ( Figure 3 D, E). Furthermore, no occluded vessels were observed in Ahr- / - rats ( Figure 3 (D, F, G). This shows that the effect of blocking AHR signaling is not only effective in inhibiting medial hypertrophy (also seen in mild pulmonary hypertension models such as mice), but also in inhibiting the occurrence of neointimal lesions and plexiform lesions seen in severe pulmonary hypertension in humans, thus demonstrating the possibility of effectiveness in severe cases and treatment-resistant cases where the pathological condition cannot be adequately improved by existing drugs. Thus, the inventors of this application have discovered that blocking AHR is effective in inhibiting the pathogenesis of PAH.

[0180] 3. Refer to the test results 3-1. In patients with PH, intestinal bacterial community dysbiosis characterized by ectopic bacterial colonization in the oral cavity is observed. The gut microbiota of patients with porcine hysteria (PH, 89 cases) and healthy individuals (HV, 82 cases) were analyzed. Compared with healthy individuals, the Faith PD and Shannon index, indicators of α-diversity of the gut microbiota, were significantly reduced in patients with PH. Figure 4 A). Furthermore, compared to healthy individuals, patients with PH exhibit significantly different β-diversity (unweighted unweighted unifrac PCoA) of their gut microbiota. Figure 4 B).

[0181] Furthermore, based on the volcano plot results of the intestinal bacterial community composition analysis (ANCOM), it was found that in patients with PH, there was an increase in oral bacteria such as Streptococcus, Rochezobium, and Actinomyces in the intestine, and a decrease in short-chain fatty acid (SCFA) producing bacteria such as Micrococcus, Ruminococcus, and Faecium. Figure 5 A). Additionally, the oral resident bacteria score (OS) was calculated by scoring the number of oral resident bacteria colonizing the intestines (14 core bacteria present at a frequency of over 1% in over 90% of individuals). The results showed that, compared to healthy individuals, patients with PH had a significantly higher oral resident bacteria score in their intestines. Figure 5 B). Furthermore, patients with high oral resident bacteria scores (OS>5) had elevated WHO functional classifications and more severe symptoms compared to patients with low oral resident bacteria scores (OS≤5). Figure 5 C), the survival rate without events also decreases ( Figure 5 D).

[0182] In addition, compared with the feces of healthy individuals, the concentrations of acetic acid, propionic acid, and butyric acid in the feces of patients with PH were significantly lower. Figure 5 E) indicates that the gut environment has deviated significantly from a healthy state.

[0183] Based on these results, it was confirmed that an imbalance occurred in the gut microbiota of PH patients due to the colonization of oral bacteria.

[0184] 3-2. In the intestines of patients with PH, active rumenococci coexist with various oral bacteria, forming a network. This is related to poor prognosis Based on the analysis of the intestinal bacterial community composition of PH patients, the relative frequency of active rumenococci was high in PH patients with high oral resident bacterial scores. Furthermore, network analysis was performed on bacteria associated with active rumenococci (Spearman rank correlation coefficient > 0.2), which revealed that active rumenococci coexist in the intestine by forming networks with Streptococcus spp., Veillonella spp., Rochezoella spp., and Fusobacterium spp. (all core oral bacteria). Figure 6A). Furthermore, it was determined that in patients with PH who coexisted with Streptococcus spp., Rochezoides spp., Fusobacterium spp., or Veillonella spp. in the intestine, the prognosis was significantly poor (log-rank test; Streptococcus spp. P = 0.007, Rochezoides spp. P = 0.004, Veillonella spp. P = 0.023). Figure 6 B). Based on these results, it was clarified that in patients with PH, active rumenococci coexist in the gut and form a network with various oral bacteria, which is associated with poor prognosis.

[0185] 3-3. Pulmonary hypertension model rats exhibit intestinal bacterial community dysbiosis (International Publication No. 2021 / 167088) PH exists using three representative disease models in rats ( Figure 7 A). Dysbiosis of the intestinal bacterial community was confirmed in these rat models.

[0186] Six-week-old male SD rats were continuously fed in a hypoxic chamber with 10% oxygen for 3 weeks to establish a pulmonary hypertension model based on hypoxia load (Hx). Figure 7 A). Six-week-old male SD rats were subcutaneously administered 60 mg / kg of lily alkaloid and fed in a normal oxygen environment (noroxic) for 3 weeks to establish a rat model of pulmonary hypertension based on lily alkaloid loading (MCT). Figure 7 A). Six-week-old male SD rats were subcutaneously administered Sugen5416, a VEGFR2 inhibitor, at 20 mg / kg, and then continuously fed in a hypoxic chamber with 10% oxygen for 3 weeks, followed by feeding in a normoxic environment (noroxic) for 2 weeks, thereby establishing a rat model of pulmonary hypertension based on Sugen5416 / hypoxia load (SuHx). Figure 7 A).

[0187] The intestinal bacterial communities of rats with various pulmonary hypertension models were analyzed. The results showed that β-difference diversity was dysregulated in rats with Hx, MCT, and SuHx. Figure 7 B). However, the intestinal bacterial community of rats differs significantly from that of humans. Oral bacteria, represented by Streptococcus, are almost undetectable in rats, while bacteria belonging to the Mulibaculaceae family are generally increased, and those belonging to the Lachnospiraceae family are generally decreased. Figure 7 C).

[0188] 3-4. Antibiotic administration in a rat model of pulmonary hypertension improves PH pathological state (International Publication No. 2021 / (No. 167088) For rats with Hx, MCT, and SuHx models, an aqueous solution containing ampicillin 1 g / L, neomycin 1 g / L, metronidazole 1 g / L, and vancomycin 1 g / L (antibiotic mixture) or water was administered, and pH pathology (pulmonary artery medial hypertrophy, right ventricular systolic pressure, and right ventricular / left ventricular weight ratio) was evaluated. In the Hx case, rats were allowed free access to the antibiotic mixture or water during a 3-week period of feeding in a hypoxic chamber with 10% oxygen, and then pH pathology was evaluated. In the MCT case, rats were allowed free access to the antibiotic mixture during a 3-week period of feeding in a normoxic environment after administration of limonene, and then pH pathology was evaluated. In the SuHx case, rats were allowed free access to the antibiotic mixture or water during a 2-week period of feeding in a normoxic environment after hypoxia, and then pH pathology was evaluated. In addition, male SD rats without induced pH were fed under conditions of free access to water in the control group. As a result, all PH model rats administered the mixed antibiotics showed significantly reduced pulmonary artery media hypertrophy, right ventricular systolic pressure, and right ventricular / left ventricular weight ratio compared to rats that were allowed to ingest water. Figure 8 (A~C).

[0189] 3-5. When reconstructing the gut microbiota of PH patients in PH model rats, it promotes PH pathology and targets inflammatory signals in the lungs. Hyperresponsiveness to foreign substances in organisms Germ-free F344 rats aged 11 weeks were administered a diluted fecal solution from PH patients or healthy individuals, and then administered lily alkaloids at 15 weeks of age, followed by further rearing for 3 weeks to create PH model rats with limited bacterial counts (PH patient fecal transplant F344 rats or healthy individual fecal transplant F344 rats). Figure 9 A). Additionally, germ-free F344 rats aged 11 weeks were not given fecal diluent, but were given lily alkaloid at 15 weeks of age, and then further fed in the SPF environment for 3 weeks, thus creating a germ-free environment for F344 rats. Alternatively, germ-free F344 rats aged 11 weeks were not given fecal diluent and were fed in the SPF environment at the National Center for Cardiology and Otolaryngology, but were given lily alkaloid at 15 weeks of age, and then further fed in the SPF environment for 3 weeks, thus creating an SPF environment for F344 rats.

[0190] The composition of the intestinal bacterial community was analyzed in F344 rats with fecal microbiota transplantation (PH) from both PH patients and healthy individuals. The results showed significant differences in the composition of the intestinal bacterial community between the two groups. F344 rats with PH fecal microbiota transplantation were colonized with a large number of *Streptococcus* species, which are oral bacteria, while F344 rats with healthy individuals were colonized with a large number of *Faecalibacterium* species, which are representative butyrate-producing bacteria. Figure 9 B).

[0191] In addition, the right ventricular systolic pressure and right ventricular / left ventricular weight ratio of each rat were measured. The results showed that, compared with the F344 rats raised in the SPF environment, the right ventricular systolic pressure and right ventricular / left ventricular weight ratio were both reduced in the F344 rats raised in the sterile environment, and the pH induced by lily alkaloids was significantly inhibited. Figure 9 C). Furthermore, fecal transplantation into F344 rats from healthy individuals showed the same level of right ventricular systolic pressure and right ventricular / left ventricular weight ratio as in F344 rats raised in a sterile environment, and the phytohexamine-induced pH was significantly inhibited. Figure 9 C). Furthermore, in F344 rats with fecal transplantation from patients, compared to F344 rats with fecal transplantation from healthy individuals, right ventricular systolic pressure was significantly increased (C). Figure 9 C). Based on these results, it was confirmed that by reconstructing the gut microbiota of PH patients in PH model rats, PH pathology becomes readily apparent.

[0192] RNA-seq analysis was performed on the lungs of F344 rats with fecal transplantation from PH patients and F344 rats with fecal transplantation from healthy individuals. The results showed that the RNA expression of Egr1, Cma1, Mcp1, Tnf, and Gzmb was increased in the lungs of F344 rats with fecal transplantation from PH patients. Figure 10 A). Furthermore, according to the results of gene ontology terminology analysis, in PH patients with fecal transplantation to F344 rats, compared with healthy individuals with fecal transplantation to F344 rats, there was an overemphasis on gene clusters related to defense responses against Gram-positive bacteria, gene clusters promoting inflammatory responses, and gene clusters related to responses to exogenous stimuli. Figure 10 B), particularly the overexpression of genes involved in macrophage chemotaxis (C5ar1, Cxcl17, etc.), lymphocyte chemotaxis (Ccl9, Ccl6, etc.), protein processing (Cma1, Gzmb, etc.), IL-6 response (Mcpt1, Prnp, etc.), and xenobiotic stimulation (Cebpa, Egr1, etc.). Figure 10 C). On the other hand, in F344 rats transplanted with fecal matter from healthy individuals, gene clusters related to angiogenesis and vascularization were overexpressed (C). Figure 10 B), especially the hyperexpression of genes involved in angiogenesis (Tmem100, Sox17, etc.). Figure 10 C).

[0193] 3-6. In PH model rats, the promotion of pathological PH caused by gut microbiota remodeling in PH patients can be mitigated by using vancomycin. Mycin reduces and eliminates Gram-positive cocci. The effects of vancomycin administration on PH pathological conditions in PH model rats were investigated. Figure 11A). Specifically, 11-week-old germ-free F344 rats were given a diluted fecal solution from PH patients or healthy individuals, and then allowed free access to an aqueous solution or water containing 1 g / L vancomycin for 4 weeks starting the following day. At 15 weeks of age, they were subcutaneously administered 60 mg / kg of limonene and fed in a normoxic environment for 3 weeks. Right ventricular systolic pressure and right ventricular hypertrophy index were then measured.

[0194] As a result, in the vancomycin group, compared with the water group, the right ventricular systolic pressure and right ventricular hypertrophy index were significantly lower. Figure 11 B). That is, it was clarified that vancomycin-sensitive bacteria (mainly Gram-positive cocci) are involved in the pathological state of PH. By using vancomycin to reduce Gram-positive cocci, the pathological promotion of PH caused by the reconstruction of intestinal flora in PH patients can be eliminated by using vancomycin to reduce Gram-positive cocci.

[0195] 4. Test Results 4-1. In patients with PH, the gut microbiota exhibits hypertryptophan metabolism, resulting in the production of abundant AHR ligands. The mechanism by which the characteristic gut microbiota dysbiosis in patients with porcine pharyngitis (PH) exacerbates the condition was explored. First, whole-genome shotgun sequencing was performed on stool samples from 52 healthy individuals and 71 patients. Using the KEGG module database, metagenomic biological pathways that showed significant changes compared to healthy individuals in PH patients were analyzed. The results showed that among the pathways significantly overactive in PH patients, tryptophan metabolism (…) ranked fifth. Figure 12 A) revealed that, compared to healthy individuals, the gut microbiota of patients with PH exhibited increased tryptophan metabolism. Furthermore, AHR ligand activity in fecal samples from PH patients and healthy individuals was measured using AHR luciferase reporter gene assay. The results showed that AHR ligand activity was significantly increased in fecal samples from PH patients compared to those from healthy individuals. Figure 12 B). That is, based on these results, it was clarified that the intestines of PH patients produced abundant AHR ligands using tryptophan as a raw material.

[0196] In addition, AHR luciferase reporter gene assays were performed on the feces of the aforementioned PH model rats (PH patient fecal transplant F344 rats and healthy human fecal transplant F344 rats). The results showed that the AHR ligand activity in the feces of PH patient fecal transplant F344 rats was significantly higher than that of healthy human fecal transplant F344 rats. Figure 12 C), confirming that fecal transplantation of F344 rats from PH patients also reflected the characteristics of the intestinal flora of PH patients.

[0197] Next, to identify the AHR ligand from intestinal bacteria that is key to pathogenesis, targeted LC-MS analysis was performed on fecal samples from PH patients and healthy individuals to determine the concentrations of tryptophan and its metabolites. The results showed that, compared to healthy individuals, the concentrations of tryptophan metabolites in the fecal samples of PH patients were increased. Figure 13 A). In particular, compared with healthy individuals, patients with PH showed significantly higher concentrations of ILA, Trp, TryptA, IPyA, IAA, and IAld in their fecal samples, while IAcr, IPA, and IEt also showed an increasing trend.

[0198] In addition, the concentrations of tryptophan and its metabolites in the feces of the aforementioned pH model rats (PH patient fecal transplant F344 rats and healthy F344 rats) were determined by targeted LC-MS analysis. The results showed that the concentration of TryptA in the feces of PH patient F344 rats was significantly higher than that of healthy F344 rats. Figure 13 B).

[0199] These results indicate that the gut microbiota of PAH patients has the ability to produce indole compounds centered on TryptA, which participate in the exacerbation of PH pathological conditions caused by gut microbiota dysbiosis. Furthermore, the feces of PH patients show high concentrations of tryptophan, and the concentration of AHR ligands (indole compounds) produced from tryptophan metabolism is also elevated. This confirms that the concentrations of tryptophan and its metabolites in feces or intestinal contents, as well as the activity of AHR in feces or intestinal contents, can be used as biomarkers for PH.

[0200] 4-2. Pathological exacerbation caused by gut microbiota in patients with PH can be eliminated by AHR inhibitors. The effects of administration of AHR inhibitors to PH model rats with limited bacterial counts on PH pathological conditions were investigated. Figure 14 A). Specifically, 11-week-old germ-free F344 rats were administered a fecal dilution from PH patients, followed by subcutaneous administration of limonene at 15 weeks of age. Starting the day after limonene administration, CH223191 (an AHR inhibitor) or corn oil was administered via gastric tube at 8 mg / kg / day daily. Right ventricular systolic blood pressure and right ventricular hypertrophy index were measured 21 days after limonene administration, and immune cells were subsequently recovered from the lungs. In the group receiving the AHR inhibitor (CH223191), both right ventricular systolic blood pressure and right ventricular hypertrophy index were significantly improved compared to the group receiving corn oil (the medium). Figure 14 B).

[0201] Therefore, to understand the AHR signal-dependent changes in immune cells in the lung, a single-cell RNA-seq analysis was performed to assess the effect of CH223191. Specifically, based on the results of single-cell RNA-seq analysis of immune cells recovered from the lung, a UMAP (Uniform Manifold Approximation and Projection) was constructed to visualize the characteristics of gene expression patterns. The results showed that in the group treated with the AHR inhibitor (CH223191), the proportion of Ifnγ-positive cells in Cluster 3 (Th17 cells) expressing IL17a was significantly reduced, indicating that Th17 cells transformed into pathogenic Th17 cells in an AHR-dependent manner. Figure 14 C).

[0202] Based on the above results, it can be concluded that Th17 cells in the lungs are key to promoting PH pathology. AHR signaling in the gut induces the differentiation of MLN into effector memory T cells and the associated polarization of pathogenic Th17 cells in the lungs, which exacerbates PH.

[0203] 4-3. In patients with PH, tryptophan malabsorption occurs in the intestines, resulting in a decrease in the concentration of tryptophan in the intestinal contents. Increased levels and decreased serum tryptophan concentration. Multi-component simultaneous LC-MS analysis was performed on stool and serum samples from healthy individuals and patients with pneumococcal pneumonia (PH). The results showed that in PH patients, the concentration of tryptophan in stool samples was high, while the concentration of tryptophan in serum samples was low. Figure 15 ).

[0204] In addition, tryptophan concentrations were measured in stool and serum samples from healthy individuals, patients with pneumococcal pneumonia (PH), and patients with heart failure. The stool tryptophan concentration was significantly higher in PH patients than in healthy individuals, while the serum tryptophan concentration was significantly lower in PH patients than in both healthy individuals and patients with heart failure. Figure 16 A, B). In addition, tryptophan concentration was measured in serum samples collected from healthy individuals and PH patients during fasting. The results showed that PH patients had significantly lower levels of tryptophan compared to healthy individuals. Figure 16 C). The disease specificity of this phenomenon was investigated, and the results showed that it was not observed in patients with heart failure, indicating that it is specific to patients with PH (problem-related heart failure). Figure 16 A, B).

[0205] These results suggest that tryptophan malabsorption occurs in patients with PH, leading to increased tryptophan concentrations in feces and intestinal contents, and decreased blood tryptophan concentrations.

[0206] 4-4. Neutral amino acid transport activity is reduced in the intestines of patients with PH. This study reported that tryptophan is primarily absorbed by BOAT1, a neutral amino acid transporter located at the brush border of the small intestine, while ACE2, as a chaperone protein of BOAT1, regulates its expression and function. Therefore, the concentrations of amino acids in serum samples from healthy individuals and patients with porcine leukemia (PH) were determined by LC-MS. The results showed that the concentrations of neutral amino acids—tryptophan, valine, proline, asparagine, threonine, alanine, and methionine—were significantly decreased in the serum samples of PH patients, while no decrease was observed in the concentrations of acidic amino acids (glutamate) and basic amino acids (lysine). Figure 17 Based on these results, it can be concluded that the neutral amino acid transport activity is reduced in the intestines of patients with PH.

[0207] 4-5. In intestinal epithelial cells, the expression of ACE2 protein decreases in an AHR-dependent manner. To verify the effects of high concentrations of tryptA in the intestines of patients with PH on intestinal cells, an in vitro experiment was conducted using the intestinal epithelial cell line CACO-2.

[0208] Specifically, tryptophan was added to the culture medium containing CACO-2 cells at a concentration of 0–500 μM. After culturing for 72 hours, the cells were recovered, and the expression level of ACE2 protein was measured. The results showed that the expression level of ACE2 protein in CACO-2 cells decreased depending on the tryptophan concentration. Figure 18 A).

[0209] In addition, 200 μM tryptophan and 0–5 μM AHR inhibitor (BAY-218) were added to the culture medium containing CACO-2 cells. After culturing for 72 hours, the cells were recovered, and the expression level of ACE2 protein was measured. The results showed that the decrease in ACE2 protein expression induced by tryptophan was inhibited by the AHR inhibitor (BAY-218). Figure 18 B). That is, based on these results, it was clarified that the expression of ACE2 protein in intestinal epithelial cells is reduced in an AHR-dependent manner.

[0210] 4-6. Tryptophan reduces B0AT1 (Slc6a19) function in an AHR-dependent manner by mediating decreased ACE2 expression, thereby blocking... Hinders the absorption of tryptophan Wild-type SD rats and Ahr knockout (Ahr-KO) rats were orally administered tryptophan at a dose of 100 mg / kg / day for one week using a mixed diet. Small intestines were then removed for Western blot analysis and ex-vivo tritium-labeled tryptophan uptake experiments. Figure 19 A). In wild-type SD rats, tryptophan administration reduced ACE2 protein expression, but in Ahr-KO rats, tryptophan administration did not reduce ACE2 protein expression. Figure 19B, C). Additionally, as a result of the in vitro tryptophan uptake experiment, tryptophan uptake in the small intestine was reduced in wild-type SD rats administered tryptophan, but no reduction in tryptophan uptake in the small intestine was observed in Ahr-KO rats administered tryptophan. Figure 19 F).

[0211] In addition, the small intestines of wild-type SD rats, Slc6a19 knockout (Slc6a19-KO) rats, and Ace2 knockout (Ace2-KO) rats were harvested for tritium-labeled tryptophan intake experiments. In Slc6a19-KO rats with the Slc6a19 (B0AT1) gene knocked out as a neutral amino acid transporter, sodium-dependent tryptophan intake was reduced along with the decrease in the number of Slc6a19 alleles (wild-type (+ / +) → heterozygous (+ / -) → homozygous (- / -)). Figure 19 D). Additionally, sodium-dependent tryptophan intake was also reduced in Ace2-KO rats ( Figure 19 E).

[0212] 4-7. High tryptophan dietary load promotes pathological pH through increased AHR agonists. For high-tryptophan diets in pH-model rats with limited bacteria thing The effects of load on pathological pH were studied. Figure 20 A). Specifically, 11-week-old germ-free F344 rats were given a diluted fecal solution from PH patients and fed a low-tryptophan diet (0.1 w / w% tryptophan) or a high-tryptophan diet (1.25 w / w% tryptophan) starting at 13 weeks of age. At 15 weeks of age, lily alkaloids were administered subcutaneously. 21 days after lily alkaloid administration, feces and serum were collected, and right ventricular systolic pressure and right ventricular hypertrophy index were measured.

[0213] The AHR activity in feces and serum was measured using the AHR luciferase reporter gene assay. The results showed that the AHR activity in feces and serum was increased in the group fed a high-tryptophan diet compared with the group fed a low-tryptophan diet. Figure 20 B). Furthermore, in the group given a high-tryptophan diet, right ventricular systolic pressure and the right ventricular hypertrophy index increased, and the pathological pH worsened ( Figure 20 C). Furthermore, the concentration of tryptophan metabolites (indole compounds) in feces was determined by LC-MS. The results showed that in the group fed a high-tryptophan diet, the concentration of tryptophan metabolites (indole compounds) increased significantly. Figure 20 D). That is, based on these results, it was confirmed that tryptophan in the gut is important for the formation of pathological pH.

[0214] 4-8. AHR ligands inhibit tryptophan uptake by reducing ACE2 expression in intestinal epithelial cells, and intestinal memory... Positive feedback closed loop of AHR ligand enrichment Based on the results shown above, it can be concluded that PH pathological condition is formed based on the following mechanisms (1) to (4).

[0215] (1) Oral bacteria that produce tryptophan metabolites (indole compounds) that act as AHR ligands colonize the intestinal bacterial community, thereby causing intestinal flora imbalance.

[0216] (2) Due to the dysbiosis of the intestinal flora, the production of AHR ligands (tryptophan metabolites) from tryptophan in the intestine is increased.

[0217] (3) Due to the increased production of AHR ligands (tryptophan metabolites), Th17 cells are differentiated and transferred to the lungs, forming PH pathology.

[0218] (4) Due to the increased production of AHR ligands (tryptophan metabolites) in the intestine, AHR-dependent ACE2 expression decreases, resulting in tryptophan malabsorption. This leads to a vicious cycle of further increase in tryptophan concentration in the intestine and further increased production of AHR ligands (tryptophan metabolites) in the intestine.

[0219] 4-9. Tryptophan, as an AHR ligand, worsens PH pathological conditions. The effects of tryptophan administration on pH pathology in germ-free rats were investigated. Figure 21 A). Specifically, 11-week-old germ-free F344 rats were fed a standard diet or a diet containing 1.25 w / w% tryptophan. At 15 weeks of age, lily alkaloids were administered subcutaneously. Twenty-one days after the administration of lily alkaloids, right ventricular systolic pressure and right ventricular hypertrophy index were measured. Subsequently, the lungs were recovered for histological analysis of pulmonary vascular tissue.

[0220] In the group given tryptophan-containing diet, compared with the group given standard diet, the right ventricular systolic pressure and right ventricular hypertrophy index were significantly increased. Figure 21 B). Additionally, based on Elastica van Gieson (EVG) staining images of the lungs, rats fed a diet containing 1.25 w / w% tryptophan showed medial thickening of the pulmonary arterioles and infiltration of inflammatory cells. Figure 21 C).

[0221] 4-10. Active rumen cocci cause pH deterioration through synergistic effects with Pasteurella multocida. To identify TryptA-producing bacteria, a metagenomic study was conducted focusing on metabolic enzymes. TryptA is produced from tryptophan via L-tryptophan decarboxylase (K01593). Therefore, whole-genome analysis (shotgun analysis) was performed on fecal samples from healthy individuals and patients with PH to determine the retention rate of the gene encoding tryptophan decarboxylase (K01593). The results showed that the proportion of bacteria possessing the K01593 gene was significantly higher in PH patients than in healthy individuals (Figure 22A). In addition, the proportion of bacterial species carrying the K01593 gene was analyzed. The results showed that the bacteria carrying the K01593 gene included active rumenococci, Streptomyces ficellus, Faecalicatena sp. Marseille, copper-tolerant bacteria (Cupriavidus metalligurans), slow-growing rhizobia (Bradyrhizobium), Sphingopyxismacrogoltabida, and Blautia hansenii, with active rumenococci accounting for the majority (Figure 22B).

[0222] In addition, active rumenococci, streptococci, pasteurellococci, and mutant streptococci were cultured anaerobicly in vitro, and tryptamine levels in the culture medium were measured over time. The results showed that only active rumenococci were confirmed to produce tryptamine (Figure 22C).

[0223] Based on the above results, it can be concluded that *Ruminococcus viridans* is the causative bacterium that produces TryptA, thereby worsening pH. Therefore, an experiment was conducted in germ-free rats involving the administration of *Ruminococcus viridans* and *Streptococcus pasteurellis* (Figure 22D). Specifically, *Ruminococcus viridans* and *Streptococcus pasteurellis* were inoculated individually or in combination into 11-week-old germ-free F344 rats, and these bacteria were allowed to colonize the intestines for 4 weeks. At 15 weeks of age, lycopene was administered subcutaneously. Twenty-one days after the administration of lycopene, right ventricular systolic pressure and right ventricular hypertrophy index were measured, qPCR analysis of small intestinal epithelial cells was performed, and the concentrations of tryptophan and its metabolites in feces were measured.

[0224] No significant increase in right ventricular systolic blood pressure or right ventricular hypertrophy index was observed when inoculated with either active rumenococci or Pasteurella multocida. However, a significant additive increase in right ventricular systolic blood pressure and right ventricular hypertrophy index was observed when inoculated with a combination of active rumenococci and Pasteurella multocida (Figure 22E). Given that active rumenococci coexist with oral bacteria such as Streptococcus spp. and are thus correlated with pH severity, the possibility that Streptococcus spp. supports the proliferation of active rumenococci can be considered.

[0225] It is known that *Streptococcus* species act on the host's small intestinal epithelial cells to promote mucin production. In fact, based on qPCR results of small intestinal epithelial cells, it was confirmed that mucin production in these cells only increases in the presence of *Streptococcus pasteurellis* (Fig. 22F). Furthermore, to confirm the effect of mucin on the proliferation of active rumenococci, culture experiments were conducted with and without mucin. The results showed that in the absence of mucin, even in anaerobic in vitro culture of active rumenococci, turbidity did not increase, and proliferation was not promoted. However, in the presence of mucin, turbidity increased and proliferation was promoted in anaerobic in vitro culture of active rumenococci (Fig. 22G). These results demonstrate that active rumenococci produce TryptA, which is important for the formation of PH pathological conditions, and that *Streptococcus* species promote host mucin production, while active rumenococci utilize the produced mucin as a carbon source, thus supporting their proliferation and acting synergistically.

[0226] Furthermore, the concentrations of tryptophan and its metabolites in feces were quantified by LC-MS. The results showed that when active rumenococci were taken up alone, the concentrations of tryptophan and IPA increased (Figure 22H). In addition, when active rumenococci and Streptococcus pasteurellis were inoculated together, the concentrations of ILA, IPA, etc. also increased (Figure 22H), suggesting an increase in AHR activity in feces.

[0227] 4-11. Adsorbent carbon adsorbs and removes a variety of tryptophan metabolites. AST-120, an adsorbent carbon, is an oral adsorbent that adsorbs indolesulfonic acid, thereby inhibiting its absorption in the intestine, and is widely used in the treatment of patients with chronic renal failure. Therefore, this study investigated whether administration of AST-120 could remove tryptophan metabolites from the intestine. Specifically, 6-week-old SD rats were fed a standard diet or a diet containing 8 w / w% AST-120 for one week, and then fecal tryptophan metabolites were analyzed using LC-MS. Figure 23 A). As a result, a significant reduction in fecal tryptophan metabolites (TryptA, IAld, IAA, IEt, IPA, and ILA) was observed in the AST-120 administration group. Figure 23 BG). On the other hand, administration of AST-120 did not reduce fecal tryptophan levels (BG). Figure 23 Based on these results, it was confirmed that the application of adsorbed charcoal in the intestine does not reduce tryptophan, an essential amino acid, and is able to remove tryptophan metabolites (indole compounds).

[0228] 4-12. Adsorbent carbon adsorbs tryptophan metabolites from intestinal bacteria, thereby improving pH. The effects of administration of adsorbed carbon AST-120 to pH-model rats with limited bacteria on pH pathogenesis were investigated. Figure 24A). Specifically, 11-week-old germ-free F344 rats were administered a diluted fecal solution from PH patients, followed by subcutaneous administration of limonene at 15 weeks of age. From the day following limonene administration, rats were fed a standard diet or a diet containing 8 w / w% AST-120 for 3 weeks, after which right ventricular systolic pressure and right ventricular hypertrophy index were measured, fecal AHR activity was measured, and fecal LC-MS analysis was performed.

[0229] In the AST-120 administration group, right ventricular systolic blood pressure and right ventricular hypertrophy index were significantly suppressed, and PH pathological condition was improved. Figure 24 B). Additionally, in the AST-120 administration group, fecal AHR activity was also significantly reduced ( Figure 24 C). In addition, the concentrations of tryptophan and its metabolites in feces were determined by LC-MS analysis. The results showed that in the AST-120 administration group, the fecal concentrations of tryptophan metabolites (TryptA, IAld, IAA, IEt, IPA, and ILA) were significantly reduced, but no decrease in the fecal concentration of tryptophan was observed. Figure 24 D). That is, based on these results, it was confirmed that removing tryptophan metabolites from the intestine using adsorbed carbon can improve the pathological pH state.

[0230] 4-13. Regnase-1 CD11c-Cre (Reg-1 CKO) mice, which serve as a natural pathogenesis model of severe PAH, were used in... The natural onset of PAH was suppressed when the mice were raised in a sterile environment, and the pathogenesis of PAH was inhibited when Reg-1 CKO mice were given adsorbed charcoal. inhibition Regnase-1 CD11c-Cre (Reg-1 CKO) mice, to be reported as a novel model of the natural onset of severe PAH, were raised to 12 weeks of age in either an SPF or sterile environment. Right ventricular systolic pressure and right ventricular hypertrophy index were then measured. Results showed that right ventricular systolic pressure was significantly increased in Reg-1 CKO mice raised in an SPF environment, but the increase was inhibited in a sterile environment. Figure 25 A). The right ventricular hypertrophy index showed no significant difference in either group. Figure 25 B).

[0231] Next, an experiment was conducted to confirm the effect of administering adsorbed charcoal AST-120 to Reg-1 CKO mice on the natural pathogenesis of PAH. Figure 25 C). Specifically, 0-week-old Reg-1 CKO mice were raised for 4 weeks, followed by a standard diet or a diet containing 8 w / w% AST-120 for 4 weeks. Right ventricular systolic pressure and right ventricular hypertrophy index were measured. Results showed that in Reg-1 CKO mice administered AST-120, right ventricular systolic pressure was significantly reduced, and PH pathological formation was inhibited. Figure 25 D).

[0232] These results also confirm that dysbiosis of the gut microbiota is involved in the formation of pH pathology, and that removing tryptophan metabolites from the gut can improve pH pathology.

[0233] 4-14. Pathological pH morphology in rats with alkaloid-induced pH loading and those with hypoxia-induced pH loading after administration of adsorbed carbon. Suppressed The effect of administering adsorbed carbon AST-120 to a lycopene-induced pH model rat was confirmed. Specifically, 6-week-old male SD rats were subcutaneously administered lycopene and fed a standard diet or a diet containing 8 w / w% AST-120 for 3 weeks, after which right ventricular systolic pressure was measured. Results showed that AST-120 administration significantly reduced right ventricular systolic pressure in rats, inhibiting the formation of pH pathophysiology. Figure 26 A).

[0234] Furthermore, the effects of administering adsorbed charcoal AST-120 to a hypoxic pH model rat on pH pathogenesis were confirmed. Specifically, 6-week-old male SD rats were placed in a chamber maintained at 10% oxygen and fed a standard diet or a diet containing 8 w / w% AST-120 for 4 weeks. Right ventricular systolic pressure and right ventricular hypertrophy index were then measured. Results showed that AST-120 administration significantly reduced right ventricular systolic pressure in rats, inhibiting the formation of pH pathogenesis. Figure 26 B).

[0235] Based on these results, it was also confirmed that removing tryptophan metabolites from the intestine can improve PH pathological conditions.

[0236] 4-15. Adsorption of indole compounds by adsorbent carbon The adsorption capacity of AST-120 (CAS: 90597-58-3, KUREHA CORPORATION), pharmaceutical charcoal (CAS: 16291-96-6, Nikichi Kogyo Co., Ltd.), and granulated activated carbon (CAS: 7440-44-0, UES Co., Ltd.) for various compounds was evaluated. Specifically, each adsorbent carbon (AST-120, pharmaceutical charcoal, and granulated activated carbon) was added to an aqueous solution containing 3-aminoisobutyric acid, L-valine, L-glutamic acid, L-tryptophan, tryptophan, indole-3-carboxaldehyde, or indole-3-acetic acid, and the adsorption rate of each compound was measured. The results showed that AST-120, pharmaceutical charcoal, and granulated activated carbon had low adsorption rates for 3-aminoisobutyric acid, L-valine, and L-glutamic acid, while their adsorption rates for L-tryptophan, tryptophan, indole-3-carboxaldehyde, and indole-3-acetic acid were relatively high. Figure 27 Based on these results, it is clear that adsorbent carbon can efficiently adsorb indole compounds.

[0237] This disclosure is not limited to the description of the embodiments and examples of the invention described above. Various modifications that can be conceived by those skilled in the art without departing from the claims are also included in this invention. All contents of the documents shown in this specification are incorporated herein by reference.

Claims

1. Medications for the prevention or treatment of pulmonary hypertension, which contain substances that can remove indole compounds, which are metabolites of tryptophan, from the intestine.

2. The preventive or therapeutic agent for pulmonary hypertension as described in claim 1, wherein, The substance is a substance that can adsorb or bind to indole compounds, which are metabolites of tryptophan.

3. The drug for the prevention or treatment of pulmonary hypertension as described in claim 1 or 2, wherein, The indole compound is selected from at least one of the following groups: tryptamine, indole-3-carboxaldehyde, indole-3-propionate, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid.

4. The preventive or therapeutic agent for pulmonary hypertension as described in claim 1 or 2, wherein, The substance is a porous inorganic adsorbent.

5. The preventive or therapeutic agent for pulmonary hypertension as described in claim 1 or 2, wherein, The substance is adsorbed carbon.

6. A treatment for pulmonary hypertension, comprising the step of removing indole compounds, which are tryptophan metabolites, from the intestine of a patient with pulmonary hypertension.

7. The treatment method for pulmonary hypertension as described in claim 6, wherein, The indole compound is removed from the intestine of pulmonary hypertension patients by administering a therapeutically effective amount of a substance that can adsorb or bind to an indole compound, which is a metabolite of tryptophan, to the patients.

8. Examination methods, which are methods for checking whether pulmonary hypertension is present and the severity of pulmonary hypertension. The examination method includes the step of measuring the concentration of tryptophan in fecal, intestinal contents, or blood samples collected from the subject.

9. A test kit for determining whether someone has pulmonary hypertension or the severity of pulmonary hypertension, which includes reagents for measuring tryptophan.

10. Examination methods, which are used to check whether pulmonary hypertension is present and the severity of pulmonary hypertension. The examination method includes the step of measuring the concentration of indole compounds, which are metabolites of tryptophan, in fecal, intestinal contents, or blood samples collected from the subject.

11. The inspection method as described in claim 10, wherein, The indole compound is selected from at least one of the following groups: tryptamine, indole-3-carboxaldehyde, indole-3-propionate, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid.

12. A test kit for determining whether a person has pulmonary hypertension or the severity of pulmonary hypertension, which contains reagents for measuring indole compounds, which are metabolites of tryptophan.

13. Examination methods, which are methods for checking whether pulmonary hypertension is present and the severity of pulmonary hypertension. The examination method includes the step of measuring the activity of aromatic hydrocarbon receptors in feces or intestinal contents collected from the subject.

14. A test kit for determining whether or not a patient has pulmonary hypertension or the severity of pulmonary hypertension, which contains reagents for measuring the activity of aromatic hydrocarbon receptors in feces or intestinal contents.

15. Examination methods, which are methods for checking whether pulmonary hypertension is present and the severity of pulmonary hypertension. The examination method includes the step of measuring the concentration of angiotensin-converting enzyme 2 in fecal, intestinal contents, or blood samples collected from the subject.

16. A test kit for determining whether a person has pulmonary hypertension or the severity of pulmonary hypertension, which contains reagents for measuring angiotensin-converting enzyme 2.

17. Drugs for the prevention or treatment of pulmonary hypertension, which contain substances that increase the expression of angiotensin-converting enzyme 2.

18. A treatment for pulmonary hypertension, comprising the step of administering a therapeutically effective amount of a substance that increases the expression of angiotensin-converting enzyme 2 to a patient with pulmonary hypertension.

Images