Methods for preventing the generation of unwanted cells during differentiation of human pluripotent stem cells

Abstract

The present invention relates generally to stem cells, and in particular to methods for preventing unwanted cells, i.e. off-target cell populations such as stromal cells, non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium. Other types of off-target cell populations are mesoderm cell populations and / or residual human pluripotent stem cells generated during in vitro differentiation of human pluripotent stem cells into definitive endoderm. The mesoderm cell population formation is inhibited by inactivating one or more genes required for the formation of the cell population in the human pluripotent stem cells. The residual human pluripotent stem cells are eliminated or reduced by culturing the human pluripotent stem cells in a medium comprising a WNT signaling agonist, wherein one or more genes required for the formation of the mesoderm cell population have been inactivated. The present invention also relates to homogenous cell populations of definitive endoderm obtained from such methods.

Description

Technical Field

[0001] This invention generally relates to the field of stem cells. In particular, this invention relates to a method for preventing the generation of specific types of unwanted cells during the differentiation of human pluripotent stem cells (hPSCs) into defined endoderm (DE) or neurons or non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium.

[0002] Sequence lists are merged by reference sequence list This application is submitted electronically along with the sequence list. The entire contents of the sequence list are hereby incorporated by reference. Background Technology

[0003] Human pluripotent stem cells (hPSCs) can replicate indefinitely while retaining the ability to differentiate into all cell types in the human body. One such cell type is pancreatic endocrine cells (PECs), including insulin-producing beta cells. By performing stepwise in vitro differentiation of hPSCs to obtain an inexhaustible source of PECs, PECs are being explored as a transplantable stem cell therapy product for the treatment of diabetes.

[0004] However, a major obstacle to using PECs or other cell types differentiated from hPSCs as cell therapy products is the potential safety risks of contamination by unwanted cells. One type of unwanted cell is residual (undifferentiated) hPSCs, which may remain due to inefficient differentiation. Another type of unwanted cell is one or more off-target cell populations generated during the early stages of hPSC differentiation from one or more different germ layers: ectoderm, mesoderm, and endoderm. One such off-target cell population that appears in all germ layers is cells from the ventral mesobrain lineage (ectoderm), cardiomyocytes (mesoderm), and pancreatic islet lineage (endoderm) of in vitro differentiation protocols and contributes to a heterogeneous mixture, being a stromal or fibroblast cell type. Stromal cells have been found to be a common component of heterologous hPSC-derived differentiation protocols and are considered an unwanted cell type. Other types of off-target cell populations are non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium.

[0005] Another type of off-target cell population is the mesodermal cell population generated during the differentiation of hPSCs into PECs. The first step is to induce an intermediate cell population called protostomes (PS), which can then branch into the desired defined endoderm (DE) or the unwanted off-target mesodermal cell population.

[0006] Several attempts have been made to reduce off-target cell populations from the mesoderm, such as by enrichment via cell sorting or by pharmacological inhibition to reduce the lineage of mesoderm-derived cells.

[0007] Cuesta-Gomez et al. (Cell reports 40, August 23, 2022) disclosed a new method for enriching endocrine populations and removing off-target cells.

[0008] However, controlling lineage-specific differentiation (especially during the initial endoderm and mesoderm bifurcation) remains a challenge, particularly when scaling up differentiation schemes.

[0009] Due to the low differentiation efficiency of hPSCs, incomplete induction of degenerative reactions (DEs) may occur, resulting in unwanted residual hPSCs. Residual hPSC contamination of PECs can lead to teratoma formation when PECs are transplanted into patients. Several strategies are dedicated to detecting and eliminating residual hPSCs in stem cell-derived products intended for clinical use.

[0010] Aghazadeh et al. (Stem Cell Reports, Vol. 17, 964-978, April 12, 2022) published that GP2-rich pancreatic progenitor cells generate functional insulin-producing cells in vivo and eliminate the risk of teratoma formation.

[0011] However, more effective strategies and methods are still needed to prevent the formation of residual hPSCs and / or mesodermal off-target cell populations during the in vitro differentiation of hPSCs into DE (which can subsequently differentiate into PECs) or into differentiated cells (such as neurons or non-pancreatic endoderm or pancreatic acinar cells or ductal epithelium). Cell therapy products that are free of or have significantly reduced numbers of off-target cells such as mesodermal cells and / or residual hPSCs are also needed. Such cell therapy products could be used to treat diabetes and other diseases. Summary of the Invention

[0012] This invention relates to an in vitro method for inhibiting or reducing unwanted cells generated during the differentiation of hPSCs into DE or into neurons, non-pancreatic endoderm, pancreatic acinar cells, or ductal epithelium.

[0013] In one aspect, the present invention provides a method for inhibiting or reducing the formation of a mesodermal cell population during the in vitro differentiation of hPSCs into DE, the method comprising inactivating or reducing the expression of one or more genes in the hPSCs, wherein the one or more genes are required for the formation of the mesodermal cell population.

[0014] In another aspect, the present invention provides a method for inhibiting or reducing the formation of mesodermal cell populations during the in vitro differentiation of hPSCs into DE, the method comprising inactivating or reducing the expression of one or more genes in the hPSCs, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0015] In one aspect, the present invention provides a method for differentiating hPSCs into DEs, the method comprising culturing the hPSCs in a cell culture medium, wherein one or more genes required for the formation of a mesodermal cell population in the hPSCs have been inactivated.

[0016] In another aspect, the present invention provides a method for differentiating hPSCs into DEs, the method comprising culturing the hPSCs in a cell culture medium wherein one or more genes required for the formation of a mesodermal cell population selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1 in the hPSCs have been inactivated.

[0017] In one aspect, the present invention provides a method for differentiating hPSCs into DEs, the method comprising culturing the hPSCs in a cell culture medium containing a WNT signaling activator, wherein one or more genes required for the formation of a mesodermal cell population in the hPSCs have been inactivated.

[0018] In another aspect, the present invention provides a method for differentiating hPSCs into DEs, the method comprising culturing the hPSCs in a cell culture medium containing a WNT signaling activator, wherein one or more genes required for the formation of a mesodermal cell population selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1 in the hPSCs have been inactivated.

[0019] In one aspect, the present invention provides one or more genetically engineered cells or cell populations thereof, wherein the one or more cells comprise or consist of one or more of the following: MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1 genes that have been inactivated or have reduced expression.

[0020] In another aspect, the present invention provides one or more genetically engineered cells or cell populations thereof, wherein the one or more cells are genetically modified to prevent the formation of mesodermal cells during the differentiation of human pluripotent stem cells into well-defined endoderm, pancreatic endoderm, or pancreatic endocrine cells, wherein the genetically engineered cells comprise one or more of, or consist of, one or more of, the following genes that have been inactivated or have reduced expression: MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0021] In another aspect, the present invention provides an in vitro cell population of genetically engineered cells or fixed endoderm derived from human pluripotent stem cells according to the foregoing aspects, wherein one or more genes required for the formation of the mesodermal cell population in the human pluripotent stem cells have been inactivated, wherein the one or more genes are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0022] In another aspect, the present invention provides a cell population of genetically engineered cells or DE derived from hPSCs, wherein the cell population comprises less than 1% or 2% mesodermal cells and / or less than 0.05% hPSCs. This means that in a cell population generated from the differentiation of hPSCs into DEs, less than 1% of the cells in the cell population are mesodermal cells, or less than 2% of the cells in the cell population are mesodermal cells, and / or less than 0.05% of the cells in the cell population are residual hPSCs.

[0023] In one aspect, the present invention provides a cell composition comprising a cell culture medium and a population of genetically engineered cells or DE cells derived from hPSCs (in which one or more genes required for the formation of a mesodermal cell population have been inactivated), the cell population being used for further differentiation or differentiation into PECs or insulin-producing cells, the PECs or insulin-producing cells being used as a medicament for treating diabetes by administering, transplanting or implanting the PECs or insulin-producing cells or tissues or organs derived from the PECs or insulin-producing cells into a subject.

[0024] The present invention can also solve other problems that are obvious from the disclosure of exemplary embodiments. Attached Figure Description

[0025] Figure 1 A shows a schematic overview of the differentiation of hPSCs into the three germ layers: ectoderm (EC), mesoderm (ME), and DE. These three germ layers arise through two nested lineage bifurcations. First, the hPSC bifurcates into the ectoderm or protostome (PS), and the PS subsequently bifurcates into the DE or ME. In cases of hPSC differentiation, incomplete differentiation may occur, resulting in surviving remnant hPSCs (shown by dashed lines).

[0026] Figure 1B illustrates a schematic paradigm for hPSC differentiation into DE. hPSC differentiation into PS is induced by activation of the Wnt signaling pathway via an activator (illustrated here using CHIR99021 as an example). Insufficient activation, i.e., low CHIR99021 concentration, leads to contamination due to residual hPSCs remaining after differentiation into DE. High Wnt signaling pathway activation, i.e., high CHIR99021 concentration, leads to mesodermal contamination.

[0027] Figure 2 A schematic outline of the protocol for differentiating hPSCs into DEs is shown. hPSCs were treated with different concentrations of Wnt signaling activators (illustrated by the example of CHIR99021) for 24 hours to induce PS, and then treated with activin A for 72 hours.

[0028] Figure 2 B shows according to Figure 2 A series of flow cytometry dot plots of hPSCs differentiated into DE04 according to the protocol outlined in A. hPSCs were treated with CHIR99021 at concentrations ranging from 2.5 μM to 6 μM for the first 24 hours of differentiation, and then treated with a constant concentration of activin A for 72 hours before cell analysis. Cells were stained for FOXA2, SOX17, and OCT3 / 4. Co-expression of SOX17 and FOXA2 marked DE. Expression of OCT3 / 4 marked residual hPSCs. When low concentrations of CHIR99021 (2.5–3.5 μM) were applied, residual hPSCs or undifferentiated cells (OCT3 / 4+) were observed in the DE04 phase. Increasing the concentration of CHIR99021 (4–6 μM) reduced residual undifferentiated cells in DE04, but also led to an increase in the formation of off-target mesodermal cells (SOX17+ / FOXA2- and SOX17- / FOXA2-). In this specific experiment, the optimal CHIR99021 concentration appeared to be between 3.5 and 4 uM. However, at these CHIR99021 concentrations, the presence of undifferentiated cells and off-target mesodermal cells was still observed.

[0029] Figure 3 A shows a t-distribution random neighborhood embedding (t-SNE) plot of the expression levels of the housekeeping gene ACTB and the pan-endocrine genes NKX2-2 and SYP in a single cell. Endocrine cells are marked with dashed lines. Cells outside the dashed lines are non-endocrine cells.

[0030] Figure 3B shows the expression levels of typical mesenchymal / stromal cell genes VIM, COL1A1, COL3A1, LUM, PDGFRA, and PDGFRB in the scRNA-seq dataset. Cells co-expressing these markers are highlighted with solid circles. The presence of an off-target population of stromal cells in the DP stage indicates mesodermal contamination during hPSC differentiation into DE.

[0031] Figure 4 A shows an analysis of a PEC graft approximately 16 weeks after subcapsular transplantation in mice. The graft was stained with DAPI to visualize all cells, SYP (a marker of endocrine cells), and human KU80 (a marker of human cells). The presence of SYP- / KU80+ indicates the presence of a non-endocrine off-target population within the graft.

[0032] Figure 4 B shows the graft analysis after 12 weeks of PEC transplantation under the renal capsule in mice. The graft was stained with DAPI to visualize all cells, VIM (a marker of mesenchymal / stromal-like cells), and CK19 (KRT19) (a marker of epithelial duct-like cells). The presence of abundant mesenchymal / stromal-like cells indicates unwanted cell growth from an in vivo off-target population of mesodermal cells.

[0033] Figure 5 A shows as follows Figure 2 The uniform manifold approximation and projection (UMAP) plot of the scRNA-seq time series of hPSC differentiation into DE as outlined in section A. The UMAP contains data from three replicates (differentiation #1, #2, and #3) of the same differentiation protocol, with cells collected every 24 hours for analysis. hPSCs and PSs are marked with dashed circles. At approximately 24 hours after the onset of hPSC differentiation, bifurcation was observed at the original streak (PS) = DE01. However, at 48 hours after the onset of hPSC differentiation, at DE02(+), the downstream effects of the bifurcation, where cells differentiate into DE (endoderm) or mesoderm, are more clearly observed, marked by arrows.

[0034] Figure 5 B shows UMAP plots of composite samples from three replicates (differentiation #1, differentiation #2, and differentiation #3) of the same differentiation protocol, focusing on the DE / mesodermal bifurcation stages (DE02 and DE03 stages). Markers of DE (FOXA2, SOX17, and EPCAM) and mesoderm (HAND1, NCAM1, and GYPB) are shown in the UMAP plots.

[0035] Figure 5C shows the UMAP of samples from two of three replicates (differentiation #1 and differentiation #3) from the same differentiation protocol, focusing on the DE / mesoderm bifurcation stages (DE02 and DE03 stages). Markers for DE (FOXA2, SOX17, and EPCAM) and mesoderm (HAND1, NCAM1, and GYPB) are shown in the UMAP plot. Most mesodermal cells originate from differentiation #1 and differentiation #3.

[0036] Figure 5 D shows the UMAP of a sample from one of three replicates (differentiation #2) of the same differentiation protocol, focusing on the DE / mesoderm bifurcation stages (DE02 and DE03 stages). Markers of DE (FOXA2, SOX17, and EPCAM) and mesoderm (HAND1, NCAM1, and GYPB) are shown in the UMAP plot. Limited mesodermal cells were observed in this sample.

[0037] Figure 6 A shows a schematic overview of the initial differentiation into the three germ layers; as shown in Figure A. Figure 1 The ectoderm (EC), mesoderm (ME), and DE are shown in Figure A. Inhibiting mesoderm formation in hPSCs by inactivating one or more genes required for mesoderm formation (lineage restriction) effectively promotes differentiation into DE.

[0038] Figure 6 Figure B shows (above) that under standard conditions, there is a narrow range of CHIR99021 concentrations, where too low a CHIR99021 concentration leads to incomplete differentiation, resulting in residual hPSC contamination, while too high a CHIR99021 concentration leads to mesoderm contamination.

[0039] (See figure below) Mesodermal formation is inhibited by lineage restriction, which enables effective DE induction with CHIR99021 over a wide range of applications without residual hPSC.

[0040] Figure 7 A shows a set of UMAP plots (top) of scRNA-seq time sequences during hPSC to DE differentiation, showing FOXA2 expression and (bottom) MESP1 expression (e.g., ...). Figure 2 The analysis summarized in section A is as follows: Figure 5 As shown in A). The mesodermal / endoderm bifurcation expected to be observed in DE02 / DE03 (see...). Figure 5The results were determined at the DE01 (PS) stage. UMAP plots are shown for DE01 (PS, 24-hour time point) samples, as well as for all three replicates of differentiation #1, #2, and #3 from the same differentiation protocol (left panel); UMAP plots for two replicates (differentiation #1 and #3) from the same differentiation protocol (mesodermal contamination observed in DE02-DE03) (middle panel); and UMAP plots for samples containing a single replicate (differentiation #2) from the same differentiation protocol (limited mesodermal contamination observed in DE02-DE03) (right panel). FOXA2 was predefined as a target gene for further DE differentiation, and MESP1 was predefined as an off-target gene. This analysis indicates that there was more and higher MESP1 expression in the two differentiations with mesodermal contamination, and vice versa for FOXA2.

[0041] Figure 7 B shows the DE01 (PS) scores in the target and off-target modules. Three genes were predefined as target genes (FOXA2, LEFTY1, GDF3), and three genes were predefined as off-target genes (HES7, MESP1, TBX6) for further DE differentiation. The predefined genes were used to calculate the scores in the target and off-target modules. DE01 cells with unique scores in the target module (bottom right of the figure, 578 cells), DE01 cells with unique scores in the off-target module (top left of the figure, 638 cells), and undefined DE01 cells (middle of the figure, 2271 cells) were extracted.

[0042] Figure 7 C shows a volcano plot of differentially expressed DE01 genes in target cells (right) and off-target cells (left). Selected genes are highlighted by name.

[0043] Figure 8 Flow cytometry analysis of the pluripotency markers SOX2 and OCT3 / 4 (POU5F1) in two MESP1 / MESP2 hPSC double knockout (KO) clones (EST008.B1 and EST008.B2) and three control hPSC clones (controls 1, 2, and 3) (all derived from the same parental hPSC line) is presented. This analysis demonstrates high and comparable expression of SOX2 and OCT3 / 4, indicating that all five hPSC clones retain the expression of key pluripotency transcription factors after genetic engineering.

[0044] Figure 9A schematic overview of differentiation is shown for MESP1 / MESP2 double knockout (KO) clones (EST008.B1, EST008.B2) and control clones (controls 1, 2, and 3). Undifferentiated hPSCs were seeded as single cells (UD00) in a small-scale bioreactor to form undifferentiated hPSC aggregates for 72 hours (DE00). The hPSC aggregates were fractionated into 6-well low-attachment plates and treated with 4, 5, or 6 μM CHIR99021 for 24 hours, followed by treatment with a constant concentration of activin A for 72 hours. DE markers, hPSC markers, and mesodermal markers in DE (in DE04) cells were analyzed by flow cytometry.

[0045] Figure 10 The basis for analysis by flow cytometry is shown. Figure 9 The experiment outlines the undifferentiated hPSC markers OCT3 / 4 and SOX2 obtained from DE (in DE04) cells. (Top) Dot plot shows samples treated with 4 µM CHIR99021 24 hours before differentiation. (Middle) Dot plot shows samples treated with 5 µM CHIR99021 24 hours before differentiation. (Bottom) Dot plot shows samples treated with 6 µM CHIR99021 24 hours before differentiation.

[0046] Figure 11 Show Figure 10 The summary graph of flow cytometry results shown is presented. Treatment with increasing concentrations of CHIR99021 resulted in a decrease in the percentage of residual hPSCs (SOX2+, OCT3 / 4+ cells) observed at DE04 in the samples (control clones and two MESP1 / 2 KO lines).

[0047] Figure 12 Showing according to Figure 9 The experiment outlines flow cytometry analysis of hPSCs differentiated into DE (in DE04). (Top panel) Dot plot shows samples treated with 4 µM CHIR99021 in the first 24 hours before differentiation. (Middle panel) Dot plot shows samples treated with 5 µM CHIR99021 in the first 24 hours before differentiation. (Bottom panel) Dot plot shows samples treated with 6 µM CHIR99021 in the first 24 hours before differentiation. DE markers FOXA2 and SOX17 were analyzed in DE (in DE04) cells.

[0048] Figure 13 Show Figure 12The summary graph of flow cytometry results is shown. Increasing concentrations of CHIR99021 resulted in a decrease in the percentage of DE cells (in DE04) in the three control clones, but not in the percentage of DE cells in the two MESP1 / 2 KO lines (EST008 B1, EST008 B2).

[0049] Figure 14 Showing according to Figure 9 The experiment outlines flow cytometry analysis of hPSCs differentiated into DE (in DE04). DE marker SOX17 and mesodermal / endothelial marker VE-CADHERIN (VE-CAD) were analyzed in DE (in DE04) cells.

[0050] Figure 15 As shown Figure 14 The figure shown is a summary plot of the expression of mesodermal markers VE-CAD and SOX17 in DE(DE04) samples at three different concentrations of CHIR99021, analyzed by flow cytometry. Increasing concentrations of CHIR99021 led to an increase in VE-CAD+ cells in the three control clones, but not in the two MESP1 / 2 KO lines (EST008 B1 and EST008 B2).

[0051] Figure 16 A schematic overview of differentiation experiments of MESP1 / MESP2 KO clones (EST008.B1, EST008.B2) and control clones (Controls 1, 2, and 3) in a small-scale bioreactor. Undifferentiated hPSCs were seeded in the small-scale bioreactor as single cells (UD00) to form undifferentiated hPSC aggregates for 72 hours (DE00). hPSC aggregates from MESP1 / MESP2 KO clones (EST008.B1, EST008.B2) were pooled 1:1 in the small-scale bioreactor, and control clones (Controls 1, 2, and 3) were pooled 1:1:1 in the small-scale bioreactor. The hPSC aggregates were treated with 5 µM CHIR99021 for 24 hours, followed by treatment with a constant concentration of activin A for 72 hours. Markers of DE and hPSCs in DE (in DE04) cells were analyzed by flow cytometry.

[0052] Figure 16 B shows according to Figure 16Experiment A outlines the flow cytometry analysis of hPSCs differentiated into DE (in DE04) cells. The dot plot shows samples analyzed for FOXA2 and SOX17 in both the MESP1 / MESP2 KO clonal pool and the control pool. DE differentiation efficiency was higher in the MESP1 / MESP2 KO clonal pool compared to the control pool (99.2% vs. 95.2% SOX17+ / FOXA2+ cells, respectively). Higher levels of mesodermal contaminants (SOX17+ / FOXA2- and SOX17- / FOXA2-) were observed in the control pool compared to the MESP1 / MESP2 KO clonal pool.

[0053] Figure 17 A is a schematic overview of the differentiation of hPSCs into the first DE, then into the pancreatic endoderm, and finally into endocrine cells, including β cells. Genes listed below the cell stages in the schematic diagram, analyzed by flow cytometry, serve as markers for different cell populations. Cells co-expressing ISL1 and NKX6-1 are considered hPSC-derived β cells. Both the MESP1 / 2 KO and control hPSC lines differentiated in a small-scale bioreactor format according to the schematic diagram.

[0054] Figure 17 B shows flow cytometry analysis of SOX17 and FOXA2 in MESP1 / 2 and control hPSCs differentiating towards DE. The dot plot is a representative example, and the figure summarizes the percentage of cells co-expressing SOX17 and FOXA2 at the DE stage, n = 4 for the MESP1 / 2 hPSC line and n = 5 for the control hPSC line. *P < 0.05. The significantly lower percentage of DE in the control hPSC line compared to the MESP1 / 2 KO line is a result of varying levels of mesodermal contamination occurring only in the control line.

[0055] Figure 17 Figure C shows flow cytometry analysis of PDX1 and NKX6-1 in MESP1 / 2 and control hPSCs differentiating into the pancreatic endoderm. The dot plot is a representative example, and the figure summarizes the percentage of cells co-expressing PDX1 and NKX6-1 at the pancreatic endoderm stage, n = 4 for the MESP1 / 2 hPSC line and n = 5 for the control hPSC line. There were no statistically significant differences between the two groups.

[0056] Figure 17Figure D shows the flow cytometry analysis of ISL1 and NKX6-1 in MESP1 / 2 and control hPSCs differentiating towards the β-cell stage. The dot plot is a representative example, and the figure summarizes the percentage of cells co-expressing ISL1 and NKX6-1 at the β-cell stage, n = 4 for the MESP1 / 2 hPSC line and n = 5 for the control hPSC line. There were no statistically significant differences between the two groups. Together, these results indicate that both MESP1 / 2 KO and control hPSCs can effectively differentiate into pancreatic lineages and β-cells.

[0057] Figure 18 A shows flow cytometry analysis of FOXA2 and VE-CADHERIN (VE-CAD) in MESP 1 / 2 cells and control hPSCs differentiated to the pancreatic endoderm (PE) stage at day 4. Dot plots are shown as representative examples of MESP 1 / 2 and control hPSC differentiation. VE-CAD is primarily expressed in mesodermal-derived cells. FOXA2-positive cells are endoderm-derived.

[0058] Figure 18 Figure B shows the percentage of FOXA2 cells expressing VE-CAD, n = 2. Flow cytometry analysis indicated that knockout of MESP1 / 2 eliminated the presence of mesodermal-derived cells during differentiation into the pancreatic lineage.

[0059] Figure 19 A shows a uniform manifold approximation and projection (UMAP) plot of scRNA-seq data from control and MESP1 / 2 KO clones differentiated into pancreatic endocrine cells. Eight distinct cell populations (clusters) were identified and annotated based on gene expression characteristics. Cluster 1 contains hPSC-derived β cells expressing INS, ISL1, and NKX6-1.

[0060] Figure 19 B shows the expression levels of selected genes in β cells (INS, ISL1), α cells (ARX, GCG), δ cells (SST, HHEX), and enterochromaffin cells (TPH1, LMX1A) in a single UMAP.

[0061] Figure 19 C shows the expression of selected genes in off-target cells of mesoderm origin as displayed in a single UMAP (cluster 8 marked with a dashed circle).

[0062] Figure 20UMAP scRNA-seq analysis of single control and MESP1 / 2 KO clone hESC lines differentiated into pancreatic endocrine cells is shown. All endocrine subsets, including β cells (cluster 1), were present in both control and MESP1 / 2 KO clones, supporting that the ability to generate β cells is not affected by MESP1 / 2 knockout. Notably, mesodermal-derived off-target cells were identified only in both control hPSC lines (cluster 8, marked by dashed circles), while no mesodermal-derived off-target cells were detected in the MESP1 / 2 KO samples. Therefore, preventing mesoderm during differentiation into DE results in the absence of mesodermal-derived off-target lineages upon further differentiation into pancreatic endocrine lineages (including β cells).

[0063] Figure 21 Flow cytometry analysis of the pluripotency markers SOX2 and OCT3 / 4 (POU5F1) in two TBXT hPSC knockout (KO) clones (TBXT_7_36_KO and TBXT_10_22 KO) and two control hPSC clones (Control 1 and 3) (both derived from the same parental hPSC line) is shown. This analysis demonstrates high and comparable expression of SOX2 and OCT3 / 4, indicating that all four hPSC clones retained pluripotency after genetic engineering.

[0064] Figure 22 Data evaluating TBXT knockout at the protein level are shown. hPSCs were treated with 4 uM CHIR for 24 h to induce differentiation to the original streak (PS) stage, in which TBXT is expressed. Both control and TBXT KO clones were differentiated and harvested for flow cytometry analysis of TBXT expression. Histograms of control and TBXT KO hPSC lines differentiated to the PS stage. Solid lines represent control clones, and dotted lines represent TBXT KO clones. Compared to the TBXT KO clone with reduced TBXT expression, the control clones showed significantly higher TBXT expression, thus validating TBXT knockout at the protein level.

[0065] Figure 23 A is a schematic diagram outlining the differentiation of hPSCs into the first DE, then into the pancreatic endoderm, and finally into endocrine cells, including β cells. Genes listed below the diagram, analyzed by flow cytometry, serve as markers for different cell populations. Cells co-expressing ISL1 and NKX6-1 are considered hPSC-derived β cells. Both TBXT KO and control hPSC lines differentiated in a small-scale bioreactor configuration according to the diagram.

[0066] Figure 23B shows flow cytometry analysis of SOX17 and FOXA2 in TBXT and control hPSCs differentiating towards DE. The dot plot is a representative example, and the figure summarizes the percentage of cells co-expressing SOX17 and FOXA2 at the DE stage, n = 2 for both TBXT and control hPSC lines. The lower percentage of DE in the control hPSC line compared to the TBXT KO line is likely a result of increased levels of mesodermal contamination occurring only in the control line.

[0067] Figure 23 C shows flow cytometry analysis of PDX1 and NKX6-1 in TBXT and control hPSCs differentiating into the pancreatic endoderm. The dot plot is a representative example, and the figure summarizes the percentage of cells co-expressing PDX1 and NKX6-1 at the pancreatic endoderm stage, n = 2 for both the TBXT hPSC and control hPSC lines.

[0068] Figure 23 D shows the flow cytometry analysis of ISL1 and NKX6-1 in TBXT and control hPSCs differentiating towards the β-cell stage. The dot plot is a representative example, and the figure summarizes the percentage of cells co-expressing ISL1 and NKX6-1 at the β-cell stage, n = 2 for both the TBXT hPSC and control hPSC lines. The results indicate that both TBXT KO and control hPSCs can effectively differentiate into pancreatic lineages and β-cells.

[0069] Figure 24 A shows flow cytometry analysis of FOXA2 and VE-CADHERIN (VE-CAD) in TBXT cells differentiated to the pancreatic endoderm stage at day 4. Dot plots are shown as representative examples of TBXT and control hPSC differentiation. VE-CAD is primarily expressed in mesodermal-derived cells. FOXA2-positive cells are considered to be of endoderm-derived origin.

[0070] Figure 24 Figure B shows the percentage of FOXA2 cells expressing VE-CAD, n = 2. Flow cytometry analysis indicated that TBXT knockout reduced the presence of mesodermal-derived cells during differentiation into the pancreatic lineage.

[0071] Figure 25A is a schematic diagram outlining the differentiation of hPSCs into DE. Cells were induced to differentiate 24 hours prior to differentiation in the presence of the Wnt signaling agonist 4 µM CHIR or 1 µM MCP21R7. DE cells then differentiated into pancreatic endoderm for 4 days. Both MESP1 / 2 KO and control hPSC lines were differentiated in a small-scale bioreactor configuration according to the schematic diagram. Cells co-expressing FOXA2 and SOX17 during the DE phase were considered DE. Cells expressing FOXA2 and PDX1 during the PE phase were considered pancreatic endoderm. In both DE and PE, cells expressing only SOX17 (SOX17+, FOXA2-) were considered an off-target population derived from the mesoderm.

[0072] Figure 25 B shows the SOX17 and FOXA2 flow cytometry analyses of MESP1 / 2 and control hPSCs differentiating towards DE. The MESP1 / 2 KO hPSC lines differentiated towards DE much more efficiently than the control hPSC lines, regardless of whether CHIR or CP21R27 was used to induce differentiation. Much higher levels of mesodermal contamination were observed in the control hPSC lines.

[0073] Figure 25 C shows flow cytometry analyses of MESP1 / 2 and control hPSCs differentiating towards DE (as in B) and further towards pancreatic endoderm, using SOX17 and FOXA2. Compared to the control hPSC line, the MESP1 / 2 KO hPSC line differentiated towards PE much more efficiently, regardless of the use of CHIR or CP21R27. Much higher levels of mesodermal contamination were observed in the control hPSC line, also independent of the use of CHIR or CP21R27 for differentiation induction. In summary, these results indicate that knockout of MESP1 and MESP2 prevents off-target mesodermal formation during differentiation towards DE and its downstream lineages, independent of the Wnt signaling agonist used to induce hPSC differentiation.

[0074] Figure 26 A is a schematic diagram outlining the differentiation of hPSCs into the first DE (DE). Cells were induced to differentiate 24 hours prior to differentiation in the presence of 4 μM or with an alternative Wnt signaling agonist (1 µM CP21R7). The DEs then differentiated into the pancreatic endoderm for 4 days. Both MESP1 / 2 KO and control hPSC lines were differentiated in a small-scale bioreactor configuration according to the schematic diagram.

[0075] Figure 26B shows that cells expressing FOXA2 (FOXA2+, VE-CAD-) at the PE stage are considered pancreatic endoderm, while cells expressing VE-CAD (FOXA2-, VE-CAD+) are considered an off-target population derived from mesoderm. Much higher levels of mesodermal contamination (FOXA2-, VE-CAD+) were observed in control hPSC lines, independent of the use of CHIR or CP21R27 to induce differentiation. In summary, these results indicate that knockout of MESP1 and MESP2 prevents mesodermal off-target formation during differentiation into DE and its downstream lineages, independent of the Wnt signaling agonist used to induce hPSC differentiation. Detailed Implementation

[0076] Differentiation of hPSCs into DEs includes an intermediate step in PS formation. This is a bifurcation step where PSs can differentiate into the desired DEs or the unwanted mesoderm (i.e., off-target cell populations) (see [link to relevant documentation]). Figure 1 A) The fate of differentiation into DE or mesoderm depends on the activation of the Wnt signaling pathway, which can be achieved by WNT signaling activators. However, efficient differentiation of hPSCs into DE is challenging. This is because, on the one hand, insufficient WNT activation leads to incomplete induction of DE, meaning not all hPSCs differentiate into DE, resulting in unwanted / contaminated residual (undifferentiated) hPSCs. On the other hand, excessive WNT activation leads to the patterning of PSCs into mesoderm rather than DE, resulting in the formation of unwanted / contaminated off-target mesodermal cell populations (see [link to relevant documentation]). Figure 1 B). Off-target mesodermal cell populations persist throughout downstream differentiation, up to the PEC stage. This is evidenced by the presence of off-target mesodermal-derived cell populations in drug substances (DS) / drug products (DP) (see [link]). Figure 3 and Figure 4 ).

[0077] Residual hPSCs and / or off-target mesodermal cell populations pose a significant safety risk through unwanted cell growth observed in vivo upon implantation of PECs, which are obtained by further differentiation of DEs containing residual hPSCs and / or off-target mesodermal cell populations.

[0078] The inventors have demonstrated that, when used to differentiate hPSCs into DE, for the same differentiation protocol, the presence or absence of off-target mesodermal cell populations or the degree of mesodermal contamination varies between replicates (see [link]). Figure 5 C and Figure 5 D; and Figure 7 A). Therefore, variations between repetitions of the same differentiation protocol raise significant questions regarding unwanted cells generated during the differentiation of hPSCs into DE.

[0079] This further underscores the need for robust, reliable, reproducible, and effective methods for suppressing the formation of these mesodermal cell populations and / or eliminating or reducing residual hPSCs. These methods can then be used alone or in combination with already optimized differentiation protocols, focusing on eliminating unwanted cells generated during the differentiation of hPSCs into DE.

[0080] The inventors have discovered an effective method for inducing DE from hPSCs by inhibiting the formation of off-target mesodermal cell populations and / or by eliminating or reducing residual hPSCs during the differentiation of hPSCs into DEs.

[0081] The present invention provides a method for inhibiting the formation of off-target mesoderm cell populations during the differentiation of hPSCs into DE by inactivating one or more genes required for the formation of one or more off-target cell populations in hPSCs (i.e., prior to differentiation).

[0082] Advantageously, the present invention also provides an efficient method for differentiating hPSCs into DE cells, wherein one or more genes required for the formation of a mesodermal cell population have been inactivated, resulting in no residual hPSCs and / or mesodermal cells or a reduced number of residual hPSCs and / or mesodermal cells. This efficient differentiation process (in which most or all hPSCs differentiate into DE cells) produces a homogeneous and pure DE cell population, which can be further differentiated in a stepwise manner to obtain PEC cells for use as an improved cell therapy product for treating type 1 diabetes, which is safer for patients.

[0083] This invention relates to a method for suppressing the expression of one or more genes in a DE cell population, the method comprising the following steps: a) Obtain hPSC, b) Inactivate one or more genes required for the formation of off-target cell populations in the hPSCs. c) Differentiate the hPSCs into DE cells by treating them in a culture medium.

[0084] The inventors have also discovered that once the formation of the mesodermal cell population is inhibited by inactivating the genes necessary for the formation of the mesodermal cell population during the differentiation of hPSCs into DEs, the number of residual hPSCs can be eliminated by increasing the concentration range of WNT signaling activators that can promote DE induction.

[0085] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise indicated, the practice of this invention employs conventional chemical, biochemical, biophysical, molecular biological, cell biological, genetic, immunological, and pharmacological methods known to those skilled in the art.

[0086] It should be noted that all headings and subheadings used herein are for convenience only and should not be construed as limiting the invention in any way.

[0087] Unless otherwise stated, the use of any and all instances or exemplary language (e.g., “such as”) provided herein is intended only to better illustrate the invention and does not constitute a limitation on the scope of the invention.

[0088] definition General definition As used herein, “a / an” or “the” may mean one or more species. Unless otherwise specified in the specification, terms presented in the singular also include the plural.

[0089] As used herein, “and / or” means and covers any and all possible combinations of one or more of the related listed items, as well as combinations missing when interpreted in the alternative (“or”) sense. Furthermore, the invention also contemplates that, in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted.

[0090] Alleles As used in this article, the term "allelic" refers to a variant of a given gene. For example, MESP1_allelic 1 and MESP1_allelic 2 are variants of the MESP1 gene, also known as alleles or isotypes.

[0091] stem cells As used herein, the term "stem cell" refers to an undifferentiated cell that possesses the capacity for proliferation (especially self-renewal) but retains the potential for differentiation. The term "stem cell" includes categories such as pluripotent stem cells and multipotent stem cells, based on their differentiation potential.

[0092] As used herein, the term "pluripotent stem cell" (PSC) refers to a stem cell capable of being cultured in vitro and possessing the potential to differentiate into any cell lineage (pluripotency) belonging to the three germ layers (ectoderm, mesoderm, and endoderm) and / or extraembryonic tissues. Examples of pluripotent stem cells (PSCs) include embryonic stem cells (ESCs), EG cells (embryonic germ cells), induced pluripotent stem cells (iPSCs), and the like.

[0093] In one embodiment, the cells used in the method of the present invention are pluripotent stem cells.

[0094] In one embodiment, the DE cell population of the present invention is obtained from pluripotent stem cells.

[0095] As used in this article, “hPSC” refers to an hPSC that can be derived from any source and, under appropriate conditions, can produce human offspring of different cell types. It is a derivative of any of the three germ layers (endoderm, mesoderm, and ectoderm) that can further differentiate into various human cell types.

[0096] In one embodiment, the cells used in the method of the present invention are hPSCs.

[0097] In one embodiment, the DE cell population of the present invention is obtained from hPSC.

[0098] In one embodiment, the hPSC cells of the method of the present invention are double-positive for SOX2+ / OCT3 / 4+. OCT3 / 4 refers to the gene identified by ENSG00000204531.

[0099] As used in this article, the term "induced pluripotent stem cells" (also known as iPS cells or iPSCs) refers to a type of pluripotent stem cell that can be directly generated from non-PSC cells that have a nucleus. Non-pluripotent cells can be converted into pluripotent stem cells by introducing the products of a specific set of pluripotency-related genes.

[0100] In one embodiment, the cells used in the method of the present invention are induced pluripotent stem cells.

[0101] In one embodiment, the DE cell population of the present invention is obtained from induced pluripotent stem cells.

[0102] As used herein, the term "embryonic stem cell" means a pluripotent stem cell derived from parthenogenetic cells, as described, for example, in WO2003 / 046141. Preferably, the methods and products of the present invention are based on human PSCs, i.e., stem cells derived from human induced pluripotent stem cells or human embryonic stem cells (including parthenogenetic cells).

[0103] As used in this article, the term "pluripotent stem cell" refers to a stem cell that has the potential to differentiate into multiple types of tissues or cells, but not all types and is usually limited to one germ layer.

[0104] As used herein, the term "artificial" in relation to cells can include materials that exist naturally in nature but are modified to resemble non-natural constructs. This includes human stem cells, which differentiate into non-natural cells that mimic human cells.

[0105] As used in this article, the terms “undifferentiated” pluripotent stem cells, or human pluripotent stem cells, or induced pluripotent stem cells, refer to such cells that have not yet differentiated into another cell type.

[0106] method As used herein, the term "method" refers to a process that includes performing one or more steps to obtain a desired result or product, or is composed of said one or more steps.

[0107] Throughout this application, the terms “method” and “scheme” are used interchangeably when referring to a process used for cell differentiation.

[0108] As used herein, the term "step" in connection with methods described herein should be understood as a phase in which something is done and / or an action is performed. Those skilled in the art will understand that one or more steps to be performed are first steps or intermediate or final steps occurring between one or more steps, and / or the steps performed are simultaneous and / or sequential and / or continuous.

[0109] As used herein, the term "day" and similar in vitro culture day (DIV) refer to a specific time during which certain steps are performed in a differentiation procedure. Those skilled in the art will understand that days may alternatively be expressed in hours.

[0110] Generally, unless otherwise stated, "Day 0" refers to the start of a protocol, which can be achieved, for example, but not limited to, plating or transferring cells to an incubator or contacting cells with compounds in their current cell culture medium before transfer. Typically, a protocol will be initiated by transferring cells (such as, for example, undifferentiated stem cells, DE cells, pancreatic endoderm cells, pancreatic endocrine progenitor (EP) cells, or pancreatic endocrine (PEC) cells) to different cell culture media and / or containers, such as, but not limited to, plating or incubation, and / or the initial contact of cells with one or more compounds that affect undifferentiated stem cells in a manner that initiates the differentiation process.

[0111] When referring to "Day X," such as Day 1, Day 2, etc., it is relative to the start of the procedure on Day 0. Those skilled in the art will recognize that, unless otherwise stated, the exact time of day used to perform this step can vary. Therefore, "Day X" means a time span encompassing, such as + / - 10 hours, + / - 8 hours, + / - 6 hours, + / - 4 hours, + / - 2 hours, or + / - 1 hour. Those skilled in the art will understand that days can be used in combination with cellular stages, for example, DE02 represents Day 2 (DE), DE04 represents Day 4 (DE), etc.

[0112] As used herein, the phrase “from approximately day X to approximately day Y” refers to the date the event begins. This phrase provides the number of days in which the event may begin. For example, if “exposed cells to differentiation factors from approximately day 3 to approximately day 5”, this should be interpreted as covering all options: “exposed cells to differentiation factors from approximately day 3,” “exposed cells to differentiation factors from approximately day 4,” and “exposed cells to differentiation factors from approximately day 5.” Therefore, this phrase should not be interpreted as the event occurring only during the interval between day 3 and day 5. This, along with the necessary changes, applies to the phrase “from approximately day X to approximately day Y.”

[0113] Cultured stem cells As used herein, the term "culture" refers to a continuous procedure used throughout the method to maintain the viability of cells at various stages. After the cells of interest are isolated from, for example, but not limited to, living tissue or embryos, they are subsequently held under carefully controlled conditions. These conditions vary depending on the cell type but generally consist of a suitable container with a substrate and / or culture medium that provides essential nutrients (amino acids, carbohydrates, vitamins, minerals), growth factors, hormones, and gases (CO2, O2), and regulates the physiological and chemical environment (pH buffer, osmotic pressure, temperature).

[0114] As used herein, the term "cell culture medium" refers to a liquid or gel designed to support cell growth. Cell culture media typically contain a suitable energy source and compounds that regulate the cell cycle. Cell culture media for PSCs, ESCs, iPSCs, DE, insulin-secreting cells, etc., are well-defined in this art. [Reversal of diabetes withinsulin-producing cells derived in vitro from human pluripotent stem cells - PubMed (nih.gov)] As used herein, the term "incubator" refers to any suitable incubator that can support cell cultures. Non-limiting examples include culture dishes, petitves dishes and plates (microtiter plates, microplates, deep-well plates, etc. with 6 wells, 24 wells, 48 ​​wells, 96 wells, 384 wells, 9600 wells, etc.), flasks, chamber slides, tubes, cell factories, roller flasks, spin flasks, hollow fibers, microcarriers, or beads.

[0115] As used herein, the term "providing or obtaining stem cells," when referenced in the protocol, means obtaining a batch of cells by methods such as those described above, and optionally transferring the cells to a different environment, such as by seeding onto a new substrate. Those skilled in the art will readily recognize that stem cells are fragile for such transfer, and that the procedure requires caution, and that maintaining the stem cells in the original cell culture medium before replacing the cell culture medium with another cell culture medium more suitable for further differentiation promotes more sustainable cell transfer.

[0116] As used in this article, the term “gene inactivation” refers to the process of disrupting the function of a specific gene through genetically engineered knockout or transient knockdown via siRNA or similar technologies.

[0117] As used herein, the term “treatment” refers to the application of a cell culture medium containing factors (growth factors and / or small molecule agonists / antagonists) to hPSCs, where “treatment” results in a response from the hPSCs, in this case, a response called “differentiation”.

[0118] Differentiated stem cells As used herein, the term "expressing" or "expression" in relation to genes or proteins refers to the presence of RNA molecules and / or proteins, wherein the RNA molecules can be detected using assays such as quantitative reverse transcription polymerase chain reaction (RT-qPCR), RNA sequencing, etc., and the proteins can be detected, for example, using antibody-based assays such as flow cytometry, immunocytochemistry / immunofluorescence, etc. Depending on the sensitivity and specificity of the assay, the detection of at least one molecule, such as in RNA sequencing, can be considered as gene or protein expression, or a detection limit higher than the background / noise level can be defined relative to a control sample, such as in flow cytometry.

[0119] As used herein, the term "marker" refers to a naturally occurring, identifiable expression produced by a cell that can be associated with certain characteristics of the cell. In a preferred embodiment, the marker is a genetic or proteomic expression that can be detected and associated with the cell's identity. The marker can be referred to as a gene. This can be readily translated into the expression of the corresponding mRNA and protein.

[0120] As used herein, the terms “negative” or “-” when referring to any biomarker disclosed herein, such as a surface protein or transcription factor, means that the biomarker is not expressed in cells or cell populations, while the terms “weak” or “low” mean that the biomarker is expressed at a reduced level in cells compared to the average expression of the biomarker in a cell population or compared to a reference sample.

[0121] As used herein, the term “reduced expression” in relation to a gene refers to a decrease in the amount or level of RNA transcripts (e.g., mRNA) of a gene, a decrease in the amount or level of proteins encoded by the gene, and / or a decrease in the amount or level of gene activity in a cell or cell population compared to an appropriate reference (e.g., a reference cell or cell population).

[0122] As used in this article, the term "double negative" refers to the absence of expression of two markers in cells or cell populations.

[0123] As used herein, the terms “positive” or “+” when used to refer to any marker disclosed herein, such as a surface protein or transcription factor, means that the marker is expressed in cells or a population of cells, while the terms “high” or “strong” mean that the marker is expressed at an increased level in cells compared to the average expression of the marker in a population of cells or compared to a reference sample.

[0124] As used in this article, the term "double positive" refers to the expression of two markers in a cell or cell population.

[0125] As used herein, the terms “differentiation” or “differentiating” broadly refer to the process by which cells progress from an undifferentiated state or a state different from their expected differentiation state to a specific differentiation state (e.g., from an immature state to a less immature state or from an immature state to a mature state), a process that can occur continuously as the method is performed. Changes in cell interactions and maturation occur when cells lose markers of undifferentiated cells or acquire markers of differentiated cells. The loss or acquisition of a single marker can indicate that a cell has “fully differentiated” or “terminally differentiated.” “Terminally differentiated” cells represent the final stage of the developmental lineage and cannot differentiate further.

[0126] hPSCs differentiate into pancreatic endocrine (PEC) cells in a progressive manner through different stages. These stages include DE, pancreatic endoderm (PE), endocrine progenitor cells (EP), and finally differentiate into islet cells (also known as PECs) (Madsen et al. - Nat Biotechnol. - Dec 2006, 24(12):1481-3).

[0127] The term "differentiation factor" refers to a compound added to stem cells to enhance their differentiation into mature cells. In one embodiment, a differentiation factor is added to pluripotent stem cells to enhance their differentiation into DE cells.

[0128] Exemplary differentiation factors include hepatocyte growth factor, keratinocyte growth factor, sarcodactyl exotropic peptide-4, basic fibroblast growth factor, insulin-like growth factor-1, epidermal growth factor, platelet-derived growth factor, and glucagon-like peptide-1. In aspects of the invention, cell differentiation includes culturing cells in a culture medium containing one or more differentiation factors.

[0129] In one embodiment, cell differentiation includes culturing cells in a culture medium containing one or more differentiation factors.

[0130] As used in this article, the terms “for further differentiation” or “capable of further differentiation” refer to the ability of a differentiated cell to progress directly or gradually from a differentiated state to a more mature state. For example, when DE is “for further differentiation” as an insulin-producing cell, it means that DE cells can differentiate into insulin-producing cells when subjected to a suitable differentiation protocol.

[0131] In some implementations, the DE obtained by the method of the present invention can be further differentiated into pancreatic endocrine cells.

[0132] As used herein, the term “residual hPSC” refers to “undifferentiated” pluripotent stem cells or hPSCs or iPSCs that have not differentiated into another cell type and remain in the cell culture medium even after the cells have undergone a suitable differentiation protocol.

[0133] As used herein, the term "contact" in relation to culturing or differentiating cells refers to exposing cells to, for example, a specific compound by placing it in a location that would allow it to contact the cells, thus creating "contacted" cells. Contact can be accomplished using any suitable means. A non-limiting example of contact is adding a compound to the cell culture medium. It is assumed that cell contact occurs whenever the cells and the specific compound are in close proximity, for example, when the compound is present in a suitable concentration in the cell culture medium.

[0134] As used herein, the term "inhibiting" or "inhibition" refers to the reduction, suppression, or downregulation of processes (such as signaling pathways) that can promote cell differentiation or cell population formation. Inhibition can be partial or complete.

[0135] As used herein, the term "inhibitor" refers to a compound that reduces, inhibits, or downregulates processes (such as signaling pathways) that can promote cell differentiation or cell population formation.

[0136] As used in this article, the term “activation” refers to the induction, stimulation, or upregulation of processes (such as signaling pathways) that can promote cell differentiation or cell population formation.

[0137] As used herein, the term "activator" refers to a compound that induces, stimulates, or upregulates processes (such as signal transduction pathways) that promote cell differentiation or cell population formation.

[0138] As used herein, “WNT signaling activator” or “WNT agonist” refers to a WNT ligand protein in a signaling pathway or any component of a signaling pathway other than the ligand protein (e.g., receptor, transduction factor, signal transduction mediator).

[0139] Non-limiting examples of WNT signaling activators include CHIR99021 or CP21R7 or WNT3a or BIO, or other family members of the WNT signaling pathway.

[0140] In one implementation, the WNT signal transduction activator is CHIR99021. In one implementation, the WNT signal transduction activator is CP21R7. In one embodiment, the present invention relates to a method for differentiating hPSCs into DE cells, the method comprising culturing the hPSCs in a cell culture medium containing a WNT signaling agonist.

[0141] In one embodiment, the method of the present invention includes a WNT signaling activator in a culture medium at a concentration in the range of 0.5-25 µM.

[0142] In one embodiment, the method of the present invention includes a WNT signaling activator at a concentration of at least 1 μM.

[0143] In one embodiment, the method of the present invention comprises a WNT signaling activator at a concentration in the range of 2-8 µM.

[0144] In one embodiment, the method of the present invention includes a WNT signaling activator at a concentration in the range of 3-6 µM.

[0145] In one embodiment, the method of the present invention includes a WNT signaling activator at a concentration of at least 4 μM.

[0146] In one embodiment, the method of the present invention includes a WNT signaling activator at a concentration of at least 5 μM.

[0147] In one embodiment, the method of the present invention includes a WNT signaling activator at a concentration of at least 6 μM.

[0148] Inhibitors of glycogen synthase kinase 3 CHIR is a known component of glycogen synthase kinase 3 (Gsk3b) inhibitors and well-defined tissue culture media for maintaining mouse embryonic stem cells in a pluripotent state (Ying et al., Nature 453, 519-523). Gsk3b has multiple targets, but is known to primarily regulate the degradation and / or nuclear translocation of β-catenin. The role of stable β-catenin in PS formation from human embryonic stem cells (hESCs) has been described using other glycogen synthase kinase 3 (Gsk3b) inhibitors such as BIO. However, CHIR is the most selective Gsk3b inhibitor reported to date.

[0149] As used herein, “CHIR” or “CHIR99021” is a patented, commercially available glycogen synthase kinase 3 (Gsk3b) inhibitor covered in patent US6417185 and described by Goff, DA et al. (2002).

[0150] In one implementation, the WNT signal transduction activator is CHIR99021.

[0151] In one embodiment, the present invention relates to a method for differentiating hPSCs into DE cells, the method comprising culturing the hPSCs in a cell culture medium containing CHIR99021.

[0152] In one embodiment, the method of the present invention includes CHIR99021 at a concentration in the range of 0.5-25 µM.

[0153] In one embodiment, the method of the present invention includes CHIR99021 at a concentration in the range of 2-8 µM.

[0154] In one embodiment, the method of the present invention includes CHIR99021 at a concentration in the range of 3-6 µM.

[0155] In one embodiment, the method of the present invention includes CHIR99021 at a concentration of at least 4 μM.

[0156] In one embodiment, the method of the present invention includes CHIR99021 at a concentration of at least 5 μM.

[0157] In one embodiment, the method of the present invention includes CHIR99021 at a concentration of at least 6 μM.

[0158] As used herein, when describing the steps of the protocol, cells may be referred to as “cells,” “differentiated cells,” or in some cases, PSCs or “cells derived from PSCs.” Those skilled in the art will recognize that during the protocol used to differentiate PSCs into specialized cells, the cells lose their pluripotency at some point. Therefore, when “cells,” “PSCs,” or “hPSCs” are mentioned in steps such as contacting the cells with the compound, it means cells that were originally pluripotent stem cells.

[0159] As used herein, the term "in vitro" means the provision and maintenance of cells outside of a human or animal body, such as in a container like a flask, multi-well plate, or Pettiter's dish. Thus, cells are cultured in a cell culture medium.

[0160] As used herein, the term "target cell population" refers to a desired cell lineage obtained through cell differentiation specifically targeting the stated cell lineage. For example, when morphological endoderm cells are the desired cells and these cells are obtained through directed differentiation of human pluripotent stem cells, the morphological endoderm is referred to as the "target cell population."

[0161] In one implementation, the shaped endoderm is in the target cell population.

[0162] In one implementation, the pancreatic endocrine cell population is a target cell population.

[0163] As used herein, the term "off-target cell population" refers to a population of unwanted cells, which may consist of the same type or a mixture of different types of cells or cell lineages. Mesodermal, ectodermal, or endothelial cell populations are "off-target cell populations" because they are unwanted cell populations acquired during the differentiation of hPSCs into DE.

[0164] As used herein, the terms "mesoderm cell population," "mesodermal-derived cell population," "mesodermal subtype," or "mesodermal cell population" refer to a cell population characterized by expressing a marker, including but not limited to biomarkers. HAND1 , NCAM1 , GYPB and / or CDH5 (VE-CAD).

[0165] In a preferred embodiment, the off-target cell population is a mesodermal cell population.

[0166] In one implementation, the off-target cell population of mesodermal cells is endothelial cells.

[0167] Original (PS) As used in this article, the term "arche" refers to a transient structure that occurs during early human development. It is a region of the epiblast that the precursor cells of the mesoderm and the final endoderm enter during gastrulation as they undergo the transition from epithelium to mesenchyme.

[0168] Definitive endoderm (DE) As used herein, the terms “DE,” “DE cell,” or “DE” refer to cells characterized by the expression of the biomarker FOXA2. Optionally, other biomarkers for DE are one or more of the following SOX17. DE cells are important for, for example, the development of pancreatic cells.

[0169] As used in this article, "SOX17" (SRY-box 17) is a member of the SOX (SRY-associated HMG box) transcription factor family, which is involved in embryonic development regulation and cell fate determination. It refers to the gene identified by ENSG00000164736.

[0170] In one embodiment, the DE cells of the method of the present invention are SOX17+ positive.

[0171] As used in this article, "FOXA2" (Forkhead Box A2) is a member of the forkhead class of DNA-binding proteins. It refers to the gene identified by ENSG00000125798.

[0172] In one embodiment, the DE cells of the method of the present invention are SOX17+ / FOXA2+ double positive.

[0173] In one implementation, DE is obtained by culturing hPSCs in a medium containing WNT signaling agonists.

[0174] DE cell populations can be obtained through one or more known protocols. The following are known protocols for differentiating hPSCs into DE cells: DE is usually obtained by treating hPSCs with transforming growth factor β and WNT / β-catenin agonists (D'Amour et al. - Nat Biotechnol. - Dec 2005; 23(12):1534-41, 2006, 2008; Rezania et al. - Diabetes - Jan 2011; 60(1):239-47; Kubo et al. - Development - Apr 2004; 131(7):1651-62; Rezania et al. - Nat Biotechnol. - Nov 2014; 32(11):1121-33; Funa et al. - Cell Stem Cell. - Jul 4 2015; 16(6):639-52).

[0175] In one embodiment, the DE cell population according to the invention can be obtained by means of the scheme described in WO2012 / 175633 (which is incorporated herein by reference in its entirety).

[0176] In a preferred embodiment, the DE cell population according to the invention can be obtained by the method described in Example 4.

[0177] In one embodiment, the present invention relates to an in vitro DE cell population that can be obtained by the method of the present invention.

[0178] In one embodiment, the present invention provides a DE cell population comprising elevated endoderm gene expression and significantly reduced mesoderm gene expression.

[0179] In one embodiment, the present invention provides DE cells with increased SOX17+ / FOXA2+ co-expression, i.e., increased SOX17+ / FOXA2+ double-positive cell expression.

[0180] In one embodiment, the present invention provides a DE cell population that does not have VE-cadherin+ cell expression or has reduced / decreased VE-cadherin+ cell expression.

[0181] In one embodiment, the present invention provides a method that does not have HAND1 , NCAM1 and GYPB A population of DE cells that co-express or whose co-expression is reduced.

[0182] In one embodiment, the present invention provides a DE cell population, wherein less than 2% or less than 1% of the cell population are mesodermal cells.

[0183] In one embodiment, the present invention provides a DE cell population that can be obtained by the method of the present invention, which has no or fewer SOX2+ / OCT3 / 4+ double-positive cells.

[0184] In one embodiment, the present invention provides a DE cell population obtainable by the method of the present invention, wherein the population contains less than 2% or less than 1% or less than 0.05% residual hPSCs.

[0185] In one embodiment, the present invention provides a DE cell population, wherein less than 2% of the cell population consists of mesodermal cells and less than 0.05% consists of residual hPSCs.

[0186] In one embodiment, the present invention provides a DE cell population, wherein less than 1% of the cell population consists of mesodermal cells and less than 0.05% consists of residual hPSCs.

[0187] Pancreatic endoderm (PE) As used herein, the terms “pancreatic endoderm,” “pancreatic endoderm cells,” “pancreatic progenitor cells,” or “PE” refer to cells characterized by the expression of the markers PDX1 and NKX6.1.

[0188] As used in this article, "PDX1" refers to a homologous domain transcription factor involved in pancreatic development. PDX1 is the gene identified by the Ensembl identifier ENSG00000139515.

[0189] As used in this article, "NKX6.1" is a member of the NKX transcription factor family. NKX6.1 refers to the gene identified by the Ensembl identifier ENSG00000163623.

[0190] In one embodiment, a population of DE cells obtainable by the method of the present invention may be further differentiated into pancreatic endoderm using one or more known methods.

[0191] In the following text, reference is made to a known protocol for differentiating DE into pancreatic endoderm: DE is further specialized in vitro into a PDX1+ NKX6.1+ PE population. Fibroblast growth factor, retinoic acid, sine hedgehog factor, epidermal growth factor, and bone morphogenetic protein signaling pathways are all involved in pancreatic development, and manipulating these pathways at different stages of differentiation promotes a highly enriched PE population (D'Amour et al. - Nat Biotechnol. - Nov 2006; 24(11): 1392-401; Kroon et al. - Nat Biotechnol. - Apr 2008; 26(4): 443-52; Nostro et al. - Development - Mar 2011; 138(5): 861-71; Rezania et al. - Diabetes - Aug 2012; 61(8): 2016-29; Mfopou et al. - Gastroenterology - Jun 2010; 138(7): 2233-45; Ameri et al. - Stem cells - January 2010; 28(1):45-56; Russ et al. - EMBO J. - July 2, 2015; 34(13):1759-72). Other pathways, including protein kinase C, nicotinamide, WNT, Rho-associated kinase, and TGFβ, have also been identified as involved in the specialization of hPSCs into the pancreatic lineage (Chen et al. - Nat Chem Biol. - April 2009; 5(4):258-65; Rezania et al. - Diabetes - August 2012; 61(8):2016-29; Rezania et al. - Stem Cell - November 2013; 31(11):2432-42; Nostro et al. - Stem Cell Reports - April 14, 2015; 4(4):591-604; Sharon et al. - Cell Rep. - May 21, 2019; 27(8):2281-2291.e5; Toyoda et al. - StemCell Rep. - August 8, 2017; 9(2):419-428).

[0192] Non-limiting examples of PE-inducing schemes are described in WO2014 / 033322, which is incorporated herein by reference in its entirety.

[0193] Pancreatic endocrine progenitor cells (EP cells) As used herein, the terms “pancreatic endocrine progenitor cell” or “endocrine progenitor cell” or “EP” refer to cells characterized by expressing one or more of NEUROG3 and optionally NeuroD and NKX2.2 (markers of EP cells committed to endocrine cell fate).

[0194] As used in this article, “NEUROG3” is a member of the neurogenin family of basic cyclic-helical-cyclic transcription factors. NEUROG3 refers to the gene identified by the Ensembl identifier ENSG00000122859.

[0195] As used in this article, “NKX2.2” and “NKX6.1” are members of the NKX transcription factor family. NKX2-2 refers to the gene identified by ENSG00000125820.

[0196] As used in this article, "NeuroD" is a member of the NeuroD family of basic helical-loop-helical (bHLH) transcription factors. NeuroD refers to the gene identified by the Ensembl identifier ENSG00000162992.

[0197] In one embodiment, a population of DE cells obtainable by the method of the present invention can be further differentiated into pancreatic endocrine progenitor cells using one or more known methods.

[0198] In the following, reference is made to known protocols for differentiating pancreatic endodermis into pancreatic endocrine progenitor cells. Pancreatic endocrine specialization from PE depends on the expression of the transcription factor NEUROG3 (McGrath et al. - Diabetes - July 2015; 64(7):2497-505; Zhang et al. - Dev. Cell - August 5, 2019; 50(3):367-380.e7.). Several approaches have been explored to induce EP and PEC from PE. Culture of PE in an air-liquid interface resulted in upregulation of NEUROG35 transcripts and pancreatic hormones insulin (INS) and glucagon (GCG) compared to cells cultured in planar culture (Rezania et al. - Nat Biotechnol. - November 2014; 32(11):1121-33). NEUROG3 expression in PE cells has been shown to induce endocrine differentiation (Zhu et al. - Cell Stem Cell. - 2 June 2016; 18(6):755-768). Regulation of the actin cytoskeleton and the dispersion of PE cells into single cells followed by re-aggregation into clusters can induce NEUROG3 expression and differentiation into EP and hPSC-endocrine cells. (Mamidi - Nature. - Dec 2018; 564(7734):114-118; Hogrebe et al. - Nat Biotechnol. - Apr 2020; 38(4):460-470). Inhibition of TGFβ and Notch signaling leads to progression of PE to the pancreatic endocrine phenotype (Rezania et al. - Diabetes. - Jan 2011; 60(1): 239-47; Nostro et al. - Development. - Mar 2011; 138(5): 861-71; Pagliuca et al. - Cell. - Oct 9 2014; 159(2): 428-39; Rezania et al. - Nat 15 Biotechnol. - Nov 2014; 32(11): 1121-33; Rezania et al. - Differentiation of humanembryonic stem cells - June 23 2015). However, allowing TGFβ signaling appears to be necessary for differentiation into more mature insulin-producing-like cells (Velazco-Cruz et al. - Stem Cell Reports. - 12 Feb 2019; 12(2):351-365).

[0199] The protocol for generating pancreatic endocrine progenitor cells is described in WO2015 / 028614, which is incorporated herein by reference in its entirety.

[0200] Pancreatic endocrine cells (PECs) As used in this article, the term "pancreatic endocrine cells" or "PEC" refers to cells that express CHGA and ISL1.

[0201] In one embodiment, the DE cell population obtained by the method of the present invention is further differentiated into pancreatic endocrine cells using one or more known protocols. In the following, reference is made to known protocols for differentiating pancreatic endocrine progenitor cells into pancreatic endocrine cells: α-like cells expressing glucagon derived from hPSCs exhibit molecular and functional characteristics of true pancreatic α cells (Rezania et al. - Diabetes - Jan 2011; 60(1):239-47; Peterson et al. - Nat Commun. - May 7 2020; 11(1):2241). A differentiation protocol for maturing hPSC-derived insulin-producing-like cells that are capable of secreting insulin in response to elevated glucose concentrations has recently been reported (Rezania et al. - Nat Biotechnol. - Nov 2014; 32(11): 1121-33; Pagliuca et al. - Cell. - Oct 9 2014; 159(2): 428-39; Velazco-Cruz et al. - Stem Cell Reports. - Feb 12 2019; 12(2): 351-365; Hogrebe et al. - Nat Biotechnol. - Apr 2020; 38(4): 460-470; Liu et al. - Nat Commun. - Jun 7 2021; 12(1): 3330; Nair et al. - Nat Cell Biol. - Feb 2019; 21(2): 263-274).

[0202] Single-cell gene expression analysis elucidated the pathway by which hPSCs differentiate into pancreatic endocrine (PEC) cells, including insulin-producing cells (Petersen et al. - Stem Cell Reports. - 10 Oct 2017; 9(4): 1246-1261; Ramond et al. - Development. - 15 Aug 2018; 145(16): dev165480; Docherty et al. - Diabetes. - Nov 2021; 70(11): 2554-2567; Veres et al. - Nature. - May 2019; 569(7756): 368-373), and detailed characterization of hPSC-derived insulin-producing cells in vitro and in vivo revealed many similarities to true pancreatic insulin-producing cells (Velazco-Cruz et al. - Stem Cell Reports). - Feb 12, 2019; 12(2):351-365; Augsornworawat et al. - Cell Rep. - Aug 25, 2020; 32(8):108067; Balboa et al. - Functional, metabolic and transcriptional maturation of stem cell derived insulin producing cells - 2021.03.31.437748v1). Interestingly, the formation of non-endocrine cells and non-pancreatic endocrine enterochromaffin cells has recently been reported for use in protocols aimed at differentiating hPSCs into the pancreatic endocrine lineage (Petersen et al. - Stem Cell Reports. - Oct 10, 2017; 9(4):1246-1261; Veres et al. - Nature. - May 2019; 569(7756):368-373).

[0203] Pancreatic endocrine (PEC) cells obtained by differentiation of DE produced by the method of the present invention include islet-like cells. Islet-like cells include α-like cells, insulin-producing cells, ε-like cells, δ-like cells, and γ-like cells.

[0204] As used herein, the term "islet-like cells" refers to islet cells obtained in vitro after culturing stem cells. Islet-like cells include insulin-producing cells, α cells, δ cells, and γ cells.

[0205] As used herein, the term "alpha cell" refers to a cell that expresses one or more of GCG and optionally ISL1 and ARX. In the pancreas, alpha cells produce the glucagon hormone.

[0206] As used herein, the term "insulin-producing cell" or "insulin-like cell" refers to cells residing in small clusters of cells called Langerhans islets in the pancreas. Insulin-producing cells express INS (gene), as well as one or more of PDX1, ISL1, and NKX6.1 optionally. Insulin-producing cells are characterized by the co-expression of INS / NKX6.1 and C-PEP / NKX6.1. In the pancreas, insulin-producing cells produce insulin and amylin hormones.

[0207] In one embodiment, a population of DE cells obtainable by the method of the present invention can be further differentiated into insulin-producing cells using one or more known methods.

[0208] The protocol for generating insulin-producing cells is described in WO2017 / 144695, which is incorporated herein by reference in its entirety.

[0209] As used herein, the term "δ cell" refers to a cell that expresses SST and optionally one or more of ISL1 and HHEX. In the pancreas, δ cells secrete the peptide hormone somatostatin.

[0210] As used herein, the term "ε cell" refers to a cell that expresses GHRL and optionally one or more of ISL1, ARX, and ETV1. In the pancreas, ε cells produce growth hormone-releasing peptide hormone.

[0211] As used herein, the term “γ cell” is used interchangeably with “pancreatic polypeptide cell,” “PP cell,” “γ cell,” or “F cell” in the current context and refers to endocrine cells that express PPY, and optionally one or more of ISL1 and PAX6. In the pancreas, they help synthesize and regulate the release of pancreatic polypeptide (PP).

[0212] stem cell-derived products As used herein, the term "differentiated cell" refers to a cell that has progressed from an undifferentiated state to a less mature state, such as a pluripotent stem cell. Differentiated cells can be, for example, less mature specialized cells (such as progenitor cells) or fully matured into specialized / terminal cell types.

[0213] As used in this article, the term “cell lineage” refers to the developmental origin of one or more cell types that begin as pluripotent stem cells and progress to less mature cells, and further to specialized / terminally differentiated cell types.

[0214] As used herein, the term "cell population" refers to a plurality of cells in the same culture. A cell population can be, for example, a mixture of different types of cells, or cells at different developmental stages, such as cells at different stages of maturity toward the same or similar specialized characteristics, or it can be a more homogeneous composition of cells with common markers.

[0215] In a preferred embodiment, the cell population is a DE cell population.

[0216] In one implementation, the cell population is a mesodermal cell population.

[0217] Genes required for mesodermal formation In one implementation, one or more genes required for the formation of a mesodermal cell population are essential or critical for the formation of the mesodermal cell population.

[0218] In one embodiment, one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0219] In one implementation, one or more genes required for the formation of mesodermal cell populations are listed in Table 1 below.

[0220] In one embodiment, one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, or CDX4.

[0221] In one implementation, one or more genes required for the formation of mesodermal cell populations include MESP1 and / or MESP2.

[0222] In one implementation, one of the genes required for the formation of mesodermal cell populations is MESP1.

[0223] In one implementation, one of the genes required for the formation of mesodermal cell populations is MESP2.

[0224] In one implementation, one or more genes required for the formation of mesodermal cell populations are MESP1 and MESP2.

[0225] In one implementation, one of the genes required for the formation of mesodermal cell populations is TBXT.

[0226] In one implementation, one or more genes required for the formation of mesodermal cell populations are MESP1 and / or MESP2 or TBXT.

[0227] In one implementation, one or more genes required for the formation of mesodermal cell populations are CDX1 and CDX2.

[0228] In one implementation, one or more genes required for the formation of a mesodermal cell population are CDX1, CDX2, and CDX4.

[0229] As used herein, the terms “genetically modified” and “genetically engineered” are used interchangeably and refer to cells that have undergone artificial manipulation, modification, or recombination of DNA or other nucleic acid molecules to alter the cell’s characteristics (phenotype). Such cells can no longer be considered naturally occurring cells. In the case of genetically modified stem cells, traits produced by gene editing persist even as the stem cells further differentiate into specialized cells, thus making the specialized cells genetically modified and artificial, i.e., not naturally occurring.

[0230] In one implementation, one or more genes are inactivated by using genetic engineering techniques selected from MAD7 nuclease, CRISPR nuclease, base editing, leader editing, zinc finger nuclease, and transcription activator-like effector nuclease.

[0231] In one implementation, alternative approaches may also be considered, such as silencing essential lineage genes via siRNA or analogues to inactivate one or more genes required for the formation of mesodermal cell populations.

[0232] Methods for preventing stromal cell-like formation As used herein, the term "stromal cell" or "stromal-like cell" refers to differentiated cells that are abundant in the bone marrow, but can also be found throughout the body. Stromal cells can transform into connective tissue cells of organs. Stromal cells may also be called mesenchymal stromal cells. These cells are non-hematopoietic, pluripotent, and self-replicating. Some stromal cells can be considered stem cells, but not all stromal cells are stem cells, and therefore they cannot all be collectively referred to as stem cells.

[0233] As used in this article, “PRRX1” refers to the gene identified by the Ensembl identifier ENSG00000116132.

[0234] As used in this article, “PRRX2” refers to the gene identified by the Ensembl identifier ENSG00000167157.

[0235] As used in this article, “ERG” refers to the gene identified by the Ensembl identifier ENSG00000157554.

[0236] As used in this article, “ANXA1” refers to the gene identified by the Ensembl identifier ENSG00000135046.

[0237] As used in this article, “TBX18” refers to the gene identified by the Ensembl identifier ENSG00000112837.

[0238] As used in this article, “RUNX1” refers to the gene identified by the Ensembl identifier ENSG00000159216.

[0239] As used in this article, “CREB5” refers to the gene identified by the Ensembl identifier ENSG00000146592.

[0240] As used in this article, “FOSL1” refers to the gene identified by the Ensembl identifier ENSG00000175592.

[0241] As used in this article, “FOSL2” refers to the gene identified by the Ensembl identifier ENSG00000075426.

[0242] As used in this article, "PROX1" refers to the gene identified by the Ensembl identifier ENSG00000117707.

[0243] As used in this article, “TCEA3” refers to the gene identified by the Ensembl identifier ENSG00000204219.

[0244] As used in this article, “DACH1” refers to the gene identified by the Ensembl identifier ENSG00000276644.

[0245] As used in this article, “SOX4” refers to the gene identified by the Ensembl identifier ENSG00000124766.

[0246] As used in this article, “TCF12” refers to the gene identified by the Ensembl identifier ENSG00000140262.

[0247] As used in this article, “TWIST1” refers to the gene identified by the Ensembl identifier ENSG00000122691.

[0248] As used in this article, “TWIST2” refers to the gene identified by the Ensembl identifier ENSG00000233608.

[0249] As used in this article, “NFATC4” refers to the gene identified by the Ensembl identifier ENSG00000100968.

[0250] As used in this article, “SMAD3” refers to the gene identified by the Ensembl identifier ENSG00000166949.

[0251] As used in this article, “TEAD2” refers to the gene identified by the Ensembl identifier ENSG00000074219.

[0252] Methods for preventing ductal epithelial and nonpancreatic endodermal infections As used herein, the term "ductal epithelium" refers to the cells lining the epithelium in the pancreas that form branching ducts that deliver enzymes produced by pancreatic acinar cells into the duodenum. These cells also secrete bicarbonate, which neutralizes gastric acid.

[0253] As used herein, the term "non-pancreatic endoderm" means that the morphological endoderm is the germ layer that produces the gastrointestinal system (including the respiratory and digestive tracts), thyroid gland, thymus, liver, and pancreas. Non-pancreatic endoderm is defined as a subtype of endoderm capable of developing into all of these lineages except the pancreatic lineage.

[0254] As used in this article, "GATA4" refers to the gene identified by the Ensembl identifier ENSG00000136574.

[0255] As used in this article, "GATA5" refers to the gene identified by the Ensembl identifier ENSG00000130700.

[0256] As used in this article, “OSR1” refers to the gene identified by the Ensembl identifier ENSG00000143867.

[0257] As used in this article, “OSR2” refers to the gene identified by the Ensembl identifier ENSG00000164920.

[0258] As used in this article, “HNF1A” refers to the gene identified by the Ensembl identifier ENSG00000135100.

[0259] As used in this article, "HNF4A" refers to the gene identified by the Ensembl identifier ENSG00000101076.

[0260] As used in this article, "HNF4G" refers to the gene identified by the Ensembl identifier ENSG00000164749.

[0261] As used in this article, “ASCL1” refers to the gene identified by the Ensembl identifier ENSG00000139352.

[0262] As used in this article, “SOX4” refers to the gene identified by the Ensembl identifier ENSG00000124766.

[0263] As used in this article, “SOX21” refers to the gene identified by the Ensembl identifier ENSG00000125285.

[0264] As used in this article, “OTX2” refers to the gene identified by the Ensembl identifier ENSG00000165588.

[0265] As used in this article, "CDX1" refers to the gene identified by the Ensembl identifier ENSG00000113722.

[0266] As used in this article, "CDX2" refers to the gene identified by the Ensembl identifier ENSG00000165556.

[0267] As used in this article, “ONECUT2” refers to the gene identified by the Ensembl identifier ENSG00000119547.

[0268] As used in this article, “ONECUT3” refers to the gene identified by the Ensembl identifier ENSG00000205922.

[0269] As used in this article, “FOSL2” refers to the gene identified by the Ensembl identifier ENSG00000075426.

[0270] As used in this article, “KLF3” refers to the gene identified by the Ensembl identifier ENSG00000109787.

[0271] As used in this article, “KLF5” refers to the gene identified by the Ensembl identifier ENSG00000102554.

[0272] As used in this article, “KLF6” refers to the gene identified by the Ensembl identifier ENSG00000067082.

[0273] As used in this article, “ELF3” refers to the gene identified by the Ensembl identifier ENSG00000163435.

[0274] As used in this article, “HES1” refers to the gene identified by the Ensembl identifier ENSG00000114315.

[0275] As used in this article, "HES4" refers to the gene identified by the Ensembl identifier ENSG00000188290.

[0276] As used in this article, “HEY1” refers to the gene identified by the Ensembl identifier ENSG00000164683.

[0277] As used in this article, “PITX1” refers to the gene identified by the Ensembl identifier ENSG00000069011.

[0278] As used in this article, “PITX2” refers to the gene identified by the Ensembl identifier ENSG00000164093.

[0279] As used in this article, “HHEX” refers to the gene identified by the Ensembl identifier ENSG00000152804.

[0280] As used in this article, “SALL4” refers to the gene identified by the Ensembl identifier ENSG00000101115.

[0281] As used in this article, “TBX1” refers to the gene identified by the Ensembl identifier ENSG00000184058.

[0282] As used in this article, “BARX2” refers to the gene identified by the Ensembl identifier ENSG00000043039.

[0283] As used in this article, “TGIF1” refers to the gene identified by the Ensembl identifier ENSG00000177426.

[0284] As used in this article, “FOXA1” refers to the gene identified by the Ensembl identifier ENSG00000129514.

[0285] As used in this article, “IRX3” refers to the gene identified by the Ensembl identifier ENSG00000177508.

[0286] As used in this article, "MAF" refers to the gene identified by the Ensembl identifier ENSG00000178573.

[0287] As used in this article, “LITAF” refers to the gene identified by the Ensembl identifier ENSG00000189067.

[0288] As used in this article, “NFIA” refers to the gene identified by the Ensembl identifier ENSG00000162599.

[0289] As used in this article, “NFIB” refers to the gene identified by the Ensembl identifier ENSG00000147862.

[0290] As used in this article, “EHF” refers to the gene identified by the Ensembl identifier ENSG00000135373.

[0291] As used in this article, “GLIS3” refers to the gene identified by the Ensembl identifier ENSG00000107249.

[0292] As used in this article, “MYRF” refers to the gene identified by the Ensembl identifier ENSG00000124920.

[0293] As used in this article, "HNF1B" refers to the gene identified by the Ensembl identifier ENSG00000275410.

[0294] As used in this article, “IER2” refers to the gene identified by the Ensembl identifier ENSG00000160888.

[0295] As used in this article, “CEBPA” refers to the gene identified by the Ensembl identifier ENSG00000245848.

[0296] As used in this article, "ATF3" refers to the gene identified by the Ensembl identifier ENSG00000162772.

[0297] As used in this article, “MAFK” refers to the gene identified by the Ensembl identifier ENSG00000198517.

[0298] As used in this article, "TRNP1" refers to the gene identified by the Ensembl identifier ENSG00000253368.

[0299] As used in this article, "JDP2" refers to the gene identified by the Ensembl identifier ENSG00000140044.

[0300] As used in this article, “NABP1” refers to the gene identified by the Ensembl identifier ENSG00000173559.

[0301] As used in this article, “CREB3L1” refers to the gene identified by the Ensembl identifier ENSG00000157613.

[0302] As used in this article, “RELB” refers to the gene identified by the Ensembl identifier ENSG00000104856.

[0303] As used in this article, “NFKB2” refers to the gene identified by the Ensembl identifier ENSG00000077150.

[0304] As used in this article, “ELK4” refers to the gene identified by the Ensembl identifier ENSG00000158711.

[0305] As used in this article, "HMGA2" refers to the gene identified by the Ensembl identifier ENSG00000149948.

[0306] As used in this article, “ID4” refers to the gene identified by the Ensembl identifier ENSG00000172201.

[0307] As used in this article, “TCF4” refers to the gene identified by the Ensembl identifier ENSG00000196628.

[0308] Methods for preventing pancreatic acinar cells As used herein, the term "pancreatic acinar cell" refers to the functional unit of the exocrine pancreas. These cells synthesize, store, and secrete digestive enzymes.

[0309] As used in this article, “RBPJL” refers to the gene identified by the Ensembl identifier ENSG00000124232.

[0310] As used in this article, “PTF1A” refers to the gene identified by the Ensembl identifier ENSG00000168267.

[0311] As used in this article, “HHEX” refers to the gene identified by the Ensembl identifier ENSG00000152804.

[0312] As used in this article, “BHLHA15” refers to the gene identified by the Ensembl identifier ENSG00000180535.

[0313] As used in this article, “EPAS1” refers to the gene identified by the Ensembl identifier ENSG00000116016.

[0314] As used in this article, “NR5A2” refers to the gene identified by the Ensembl identifier ENSG00000116833.

[0315] As used in this article, “NR4A1” refers to the gene identified by the Ensembl identifier ENSG00000123358.

[0316] As used in this article, “MECOM” refers to the gene identified by the Ensembl identifier ENSG00000085276.

[0317] As used in this article, “CEBPD” refers to the gene identified by the Ensembl identifier ENSG00000221869.

[0318] As used in this article, "ATF4" refers to the gene identified by the Ensembl identifier ENSG00000128272.

[0319] As used in this article, “EEF1D” refers to the gene identified by the Ensembl identifier ENSG00000104529.

[0320] As used in this article, “XBP1” refers to the gene identified by the Ensembl identifier ENSG00000100219.

[0321] As used in this article, “YBX3” refers to the gene identified by the Ensembl identifier ENSG00000060138.

[0322] As used in this article, “APLP2” refers to the gene identified by the Ensembl identifier ENSG00000084234.

[0323] As used in this article, “SOX6” refers to the gene identified by the Ensembl identifier ENSG00000110693.

[0324] As used in this article, “MAFF” refers to the gene identified by the Ensembl identifier ENSG00000185022.

[0325] Knock-in and knock-out As used in this article, the term "knock-in" or "knocking-in" refers to the insertion of a gene into the genome. With knock-in technology, gene insertion is targeted, meaning that the gene is inserted into a specific locus at a predefined and specifically targeted location on the genome, as opposed to random gene insertion using other genetic engineering methods.

[0326] As used in this article, "knock-out" or "knocking-out" refers to the inactivation of a gene by deleting or disrupting it from the genome. To achieve the deletion or disruption of a given gene of interest, knockout techniques typically require genetic modifications at specific target sites on the genome.

[0327] In one implementation, the gene is inactivated by knocking out one or more genes required for the formation of a mesodermal cell population in hPSCs prior to hPSC differentiation.

[0328] In one embodiment, the method according to the invention inactivates one or more genes in hPSCs as a double knockout.

[0329] In one embodiment, the method according to the invention inactivates one or more genes in hPSCs as a triple knockout.

[0330] Several knock-in and knock-out techniques exist and are well-defined in this field.

[0331] As used herein, the term "cell composition" refers to a cell culture medium and one or more cell populations.

[0332] In one embodiment, the cell composition is a therapeutic cell composition.

[0333] The method according to the invention is described in more detail below by way of non-limiting embodiments and examples.

[0334] Compositions comprising DE obtained by any method of the present invention On the other hand, this document describes a medicine comprising pancreatic endocrine cells (PECs) or insulin-producing cells, which are obtained by differentiating DE cells derived from hPSCs containing one or more inactivated genes by any method of the invention according to this specification.

[0335] In a preferred embodiment, the medicament described herein comprises enriched or homogenized, thawed and reassembled cryopreserved pancreatic endocrine cells (PECs) or insulin-producing cells obtained by differentiation of DEs that can be obtained by any method of the present invention.

[0336] Medical Uses of Pancreatic Endocrine (PEC) Cells Obtained by Any Method of the Invention This document also provides methods for treating diabetes (type 1 and type 2). For example, this document provides a method for treating type 1 diabetes in mammals. In some embodiments, the method includes the steps of: selecting a mammal suffering from type 1 diabetes and administering pancreatic endocrine cells or insulin-producing cells obtained by further differentiating DE cells obtained by any method of the present invention to the mammal. In other embodiments, the method includes preventing type 1 diabetes in a mammal by administering endocrine cells obtained by any method of the present invention to a mammal at risk of developing type 1 diabetes.

[0337] In the current context, the term "mammal" includes both humans and veterinary subjects.

[0338] In the current context, the term "mammal" refers to, for example, humans, horses, pigs, rabbits, dogs, sheep, goats, non-human primates, cattle, cats, guinea pigs, or rodents. The term does not indicate a specific age or sex.

[0339] Those skilled in the art can use any diagnostic and identification method to identify and select mammals with type 1 diabetes and mammals at risk of developing type 1 diabetes. For example, diagnosis is based on elevated fasting blood glucose levels or a glucose tolerance test. Furthermore, the diagnosis of type 1 diabetes includes a variety of physical symptoms and characteristics.

[0340] Mammals with insulin-dependent type 2 diabetes or at risk of developing type 2 diabetes similarly benefit from the administration of pancreatic endocrine cells obtained by any method of the present invention. Therefore, a method is provided herein comprising the steps of: selecting a mammal with type 2 diabetes or at risk of developing type 2 diabetes and administering a sufficient quantity of pancreatic endocrine cells obtained by any method of the present invention to said mammal. Diagnosis is typically based on fasting blood glucose levels, a glucose tolerance test, or blood insulin levels.

[0341] The invention is further described through the following non-limiting embodiments: 1. A method for inhibiting or reducing the formation of a mesodermal cell population during the in vitro differentiation of hPSCs into DE, the method comprising inactivating or reducing the expression of one or more genes in the hPSCs, wherein the one or more genes are required for the formation of the mesodermal cell population.

[0342] 2. The method according to embodiment 1, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0343] 3. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2 or CDX4.

[0344] 4. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1 and MESP2 or TBXT.

[0345] 5. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population include MESP1 or MESP2 or TBXT.

[0346] 6. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population are MESP1 and MESP2.

[0347] 7. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population are TBXT.

[0348] 8. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population are CDX1 and CDX2.

[0349] 9. The method according to any one of the foregoing embodiments, wherein the one or more genes required for the formation of the mesodermal cell population are CDX1, CDX2 and CDX4.

[0350] 10. The method according to any one of embodiments 1 to 9, wherein the reduction in the expression of the one or more genes is achieved by reducing the amount of RNA transcripts (mRNA) of the one or more genes, reducing the amount of proteins encoded by the one or more genes, and / or reducing the amount of activity of the one or more genes.

[0351] 11. The method according to any one of the foregoing embodiments, wherein the inactivation or reduction of the expression of one or more genes required for the formation of the mesodermal cell population is performed by knocking out or knocking down the genes in the hPSCs.

[0352] 12. The method according to any one of the foregoing embodiments, wherein the inactivation or reduction of the expression of the one or more genes required for the formation of the mesodermal cell population is performed by using a genetic engineering technique selected from MAD7 nuclease, CRISPR nuclease, base editing, leader editing, zinc finger nuclease, transcription activator-like effector nuclease, or homologous recombination.

[0353] 13. The method according to any one of the foregoing embodiments, wherein the hPSC is a human embryonic stem cell or a human induced pluripotent stem cell.

[0354] 14. An in vitro method for differentiating hPSCs into DEs, the method comprising culturing the hPSCs in a cell culture medium, wherein one or more genes required for the formation of a mesodermal cell population in the hPSCs have been inactivated.

[0355] 15. The method according to embodiment 14, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, TBXT, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0356] 16. The method according to embodiment 14, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, or CDX4.

[0357] 17. The method according to embodiment 14, wherein the one or more genes required for the formation of the mesodermal cell population include MESP1 and MESP2.

[0358] 18. The method according to embodiment 17, wherein the one or more genes required for the formation of the mesodermal cell population are MESP1 or MESP2.

[0359] 19. The method according to embodiment 17, wherein the one or more genes required for the formation of the mesodermal cell population are MESP1 and MESP2 or TBXT.

[0360] 20. The method according to embodiment 14, wherein the one or more genes required for the formation of the mesodermal cell population are CDX1 and CDX2.

[0361] 21. The method according to embodiment 14, wherein the one or more genes required for the formation of the mesodermal cell population are CDX1, CDX2 and CDX4.

[0362] 22. The method according to embodiment 14, wherein the cell culture medium comprises a WNT signal transduction activator.

[0363] 23. The method according to embodiment 22, wherein the WNT signal transduction activator is CHIR99021, CP21R7, or WNT3a and BIO.

[0364] 24. The method according to embodiment 22, wherein the concentration of the WNT signal transduction activator is about 0.5-25 µm.

[0365] 25. The method according to embodiment 22, wherein the concentration of the WNT signal transduction activator is about 1-8 µm.

[0366] 26. The method according to embodiment 22, wherein the concentration of the WNT signal transduction activator is about 2-8 µm.

[0367] 27. The method according to embodiment 22, wherein the concentration of the WNT signal transduction activator is about 3-6 µm.

[0368] 28. The method according to any one of the foregoing embodiments 24-25, wherein the concentration of the WNT signal transduction activator is about 1 µm.

[0369] 29. The method according to any one of the foregoing embodiments 25-27, wherein the concentration of the WNT signal transduction activator is 4 µm.

[0370] 30. The method according to any one of the foregoing embodiments 25-27, wherein the concentration of the WNT signal transduction activator is 5 µm.

[0371] 31. The method according to any one of the foregoing embodiments 25-27, wherein the concentration of the WNT signal transduction activator is 6 µm.

[0372] 32. The method according to any one of the foregoing embodiments 14-31, wherein the step of culturing the hPSCs in a cell culture medium containing a WNT signaling activator lasts for at least 24 hours.

[0373] 33. The method according to embodiment 23, wherein the concentration of CHIR99021 is about 0.5-25 µm, or the concentration of CP21R7 is about 1 µm.

[0374] 34. According to the method described in Implementation Scheme 23, the concentration of CHIR99021 is approximately 2-8 µm.

[0375] 35. According to the method described in Implementation Scheme 23, the concentration of CHIR99021 is approximately 3-6 µm.

[0376] 36. The method according to any one of embodiments 33-35, wherein the concentration of CHIR99021 is 4 µm.

[0377] 37. The method according to any one of embodiments 33-35, wherein the concentration of CHIR99021 is 5 µm.

[0378] 38. The method according to any one of embodiments 33-35, wherein the concentration of CHIR99021 is 6 µm.

[0379] 39. The method according to any one of embodiments 23-38 above, wherein the step of culturing the hPSCs in a cell culture medium containing CHIR99021 or CP21R7 lasts for at least 24 hours.

[0380] 40. The method according to any one of the foregoing embodiments 14-39, comprising an intermediate step of differentiating the hPSC into original bars.

[0381] 41. The method according to embodiment 40, wherein one or more genes required for the formation of the mesodermal cell population in the hPSC are inactivated to prevent the primitive streak from differentiating into mesoderm.

[0382] 42. The method according to any one of the foregoing embodiments 14-41, wherein the hPSC is a human embryonic stem cell or a human induced pluripotent stem cell.

[0383] 43. The method according to embodiment 40 further includes differentiating the original strip into DE.

[0384] 44. The method according to embodiment 43, comprising culturing the original strip in a culture medium containing activator A.

[0385] 45. The method according to embodiment 44, which includes culturing original strips in a culture medium containing 20-100 ng / ml activator A.

[0386] 46. ​​The method according to embodiment 45, which includes culturing the original strips in a culture medium containing 100 ng / ml activin A.

[0387] 47. The method according to embodiment 44, which includes culturing the original strips in a culture medium containing activator A for 72 hours.

[0388] 48. The method according to any one of the foregoing embodiments 14-47, wherein the DE is used for further differentiation into pancreatic endoderm.

[0389] 49. The method according to any one of the aforementioned embodiments 14-47, wherein the DE is used for further differentiation into endocrine progenitor cells.

[0390] 50. The method according to any one of the foregoing embodiments 14-47, wherein the DE is used for further differentiation into pancreatic endocrine cells.

[0391] 51. The method according to any one of the foregoing embodiments 14-47, wherein the DE is used for further differentiation into insulin-producing cells.

[0392] 52. A method for inhibiting or reducing the expression of one or more genes in a DE cell population, the method comprising the steps of: (i) Obtain hPSC, (ii) Inactivating one or more genes in the hPSCs, wherein the one or more genes are required for the formation of the mesodermal cell population. (iii) The hPSCs obtained in step (ii) are differentiated into DE cells by treating them in a culture medium.

[0393] 53. The method according to embodiment 52, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, TBXT, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0394] 54. The method according to any one of embodiments 52 to 53, wherein the reduction in the expression of the one or more genes is achieved by reducing the amount of RNA transcripts (mRNA) of the one or more genes, reducing the amount of proteins encoded by the one or more genes, and / or reducing the amount of activity of the one or more genes.

[0395] 55. The method according to embodiment 54, wherein, compared with DE cells obtained from the hPSC, the method reduces the expression of one or more genes required for the formation of the mesodermal cell population in the DE population, wherein the one or more genes required for the formation of the mesodermal cell population have not been inactivated.

[0396] 56. The method according to embodiment 52, wherein the culture medium comprises a WNT signal transduction activator.

[0397] 57. The method according to embodiment 56, wherein the WNT signal transduction activator is used at a concentration of 0.5-25 µm.

[0398] 58. The method according to embodiment 57, wherein the WNT signal transduction activator is used at a concentration of 2-8 µm.

[0399] 59. The method according to any one of embodiments 56-58, wherein the WNT signal transduction activator is used at a concentration of 4 µm.

[0400] 60. The method according to any one of embodiments 56-58, wherein the WNT signal transduction activator is used at a concentration of 5 µm.

[0401] 61. The method according to any one of embodiments 56-58, wherein the WNT signal transduction activator is used at a concentration of 6 µm.

[0402] 62. The method according to embodiments 56 to 61, wherein the WNT signal transduction activator is CHIR99021, CP21R7, WNT3a, or BIO.

[0403] 63. The method according to embodiment 62, wherein the WNT signal transduction activator is CHIR99021.

[0404] 64. A genetically engineered cell, wherein the cell is genetically modified to prevent mesodermal cell formation during the differentiation of hPSCs into DE, PE, or PEC cells.

[0405] 65. The genetically engineered cell according to embodiment 64, wherein the cell is genetically modified by knocking out one or more genes selected from the following: MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, TBXT, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0406] 66. The genetically engineered cell according to embodiment 64, wherein the cell contains MESP1 and / or MESP2 or TBXT genes that have been inactivated or have reduced expression.

[0407] 67. The genetically engineered cell according to any one of embodiments 64 to 66 above, wherein the cell is a mammalian cell, preferably a human cell.

[0408] 68. The genetically engineered cell according to any one of embodiments 64 to 67 above, wherein the genetically engineered cell is a human pluripotent stem cell (hPSC).

[0409] 69. The genetically engineered cells according to embodiment 68, wherein the human pluripotent stem cells are human embryonic stem cells or induced human pluripotent stem cells.

[0410] 70. The genetically engineered cell according to any one of embodiments 64 to 67 above, wherein the genetically engineered cell is a DE cell.

[0411] 71. The genetically engineered cell according to any one of embodiments 64 to 67 above, wherein the genetically engineered cell is a pancreatic endoderm cell.

[0412] 72. The genetically engineered cell according to any one of embodiments 64 to 67 above, wherein the genetically engineered cell is an endocrine progenitor cell.

[0413] 73. The genetically engineered cell according to any one of embodiments 64 to 67 above, wherein the genetically engineered cell is a pancreatic endocrine cell.

[0414] 74. The genetically engineered cell according to any one of embodiments 64 to 67 above, wherein the genetically engineered cell is an insulin-producing cell.

[0415] 75. An in vitro cell population of genetically engineered cells or DE derived from human pluripotent stem cells according to embodiment 64, wherein one or more genes required for the formation of the mesodermal cell population in the human pluripotent stem cells have been inactivated, wherein the one or more genes are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, TBXT, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

[0416] 76. The in vitro cell population according to embodiment 75, which is derived from human pluripotent stem cells, said human pluripotent stem cells containing inactivated MESP1 and / or MESP2 or TBXT genes or reduced expression of MESP1 and / or MESP2 or TBXT genes.

[0417] 77. A cell population according to any one of embodiments 75 or 76 above, wherein the population contains less than 2% or 1% and / or 0.05% hPSCs.

[0418] 78. The cell population according to any one of the foregoing embodiments 75-77, wherein the human pluripotent stem cells are human embryonic stem cells or human induced pluripotent stem cells.

[0419] 79. A cell population according to any one of embodiments 75-78 above, which is used to further differentiate into pancreatic endocrine cells or insulin-producing cells, said pancreatic endocrine cells or insulin-producing cells being used as a drug for treating diabetes by administering, transplanting or implanting said pancreatic endocrine cells or insulin-producing cells or tissues or organs derived from said pancreatic endocrine cells or insulin-producing cells into a subject.

[0420] 80. A cell population according to any one of embodiments 76 to 79 above, wherein the cell population comprises genetically engineered cells according to any one of embodiments 64 to 74.

[0421] 81. A cell composition comprising genetically engineered cells according to any one of embodiments 64 to 74 or an in vitro cell population according to any one of embodiments 75 to 79 and a cell culture medium.

[0422] 82. A method for inhibiting the formation of stromal cells and / or stromal-like cells during the in vitro differentiation of hPSCs into defined cell types, the method comprising reducing the expression of one or more genes in the hPSCs, said one or more genes being selected from the group consisting of: PRRX1, PRRX2, ERG, ANXA1, TBX18, RUNX1, CREB5, FOSL1, FOSL2, PROX1, TCEA3, DACH1, SOX4, TCF12, TWIST1, TWIST2, NFATC4, SMAD3, and TEAD2.

[0423] 83. The method according to embodiment 82, wherein the hPSC is a human embryonic stem cell or an induced hPSC.

[0424] 84. The method according to embodiments 82 to 83, wherein the reduction in the expression of the one or more genes is achieved by reducing the amount of RNA transcripts (mRNA) of the one or more genes, reducing the amount of proteins encoded by the one or more genes, and / or reducing the amount of activity of the one or more genes.

[0425] 85. The method according to embodiments 82 to 84, wherein the expression is reduced by epigenetic silencing, interfering RNA transcripts, and / or genetic engineering.

[0426] 86. The method according to embodiments 82 to 85, wherein the hPSC differentiates into nerve cells, cardiomyocytes, photoreceptor cells, retinal pigment epithelial cells, renal cells, or islet-like cells.

[0427] 87. The method according to embodiment 86, wherein the nerve cells are forebrain nerve cells, ventral midbrain nerve cells, hindbrain nerve cells, or spinal cord nerve cells.

[0428] 88. The method according to embodiments 86 to 87, wherein the hPSC differentiates into nerve cells, and wherein the expression of PRRX1 and PRRX2 is reduced.

[0429] 89. The method according to embodiment 88, wherein the nerve cells are ventral midbrain nerve cells.

[0430] 90. The method according to embodiments 82 to 89, wherein the expression of one or more genes is reduced at least during the differentiation of the cell into a differentiated cell.

[0431] 91. A genetically engineered cell, wherein the cell is genetically modified to prevent differentiation into a matrix-like cell.

[0432] 92. The genetically engineered cell according to embodiment 91, wherein the cell is genetically modified by knocking out one or more genes selected from the following: PRRX1, PRRX2, ERG, ANXA1, TBX18, RUNX1, CREB5, FOSL1, FOSL2, PROX1, TCEA3, DACH1, SOX4, TCF12, TWIST1, TWIST2, NFATC4, SMAD3, and TEAD2.

[0433] 93. The genetically engineered cell according to any one of embodiments 91 to 92, wherein the cell is a mammalian cell, preferably a human cell.

[0434] While certain features of the invention have been described and illustrated herein, many modifications, substitutions, variations, and equivalents will now occur to those skilled in the art. Therefore, it should be understood that the appended claims are intended to cover all such modifications and alterations falling within the true spirit of the invention.

[0435] Example The following are non-limiting embodiments for carrying out the present invention.

[0436] Example 1: Identification of genes involved in mesodermal differentiation Applying hPSC scRNA sequencing time series to DE differentiation ( Figure 5 We focused on the PS population to identify genes involved in mesodermal differentiation at this stage. Cells with low unique molecular identifier (UMI) counts and those in the G2 / M cell cycle were excluded from the analysis. We predefined three target marker genes (LEFTY1, GDF3, and FOXA2) and three off-target marker genes (HES7, MESP1, and TBX6). Instances of FOXA2 and MESP1 were shown in... Figure 7 In section A, we used the SeuratR package to calculate the on-target and off-target module scores for all cells from the DE01 sample using predefined genes. We extracted cells with unique on-target or off-target module scores by applying thresholds of >0.1 on-target score and <0 off-target score, and vice versa. This yielded 578 on-target cells, 638 off-target cells, and 2271 undefined cells. We then used the Seurat FindMarkers® function to perform differential expression analysis between on-target and off-target cells. The list was manually compiled and primary transcription factors and receptors / ligands were selected to obtain the candidate gene list for potential mesoderm specialization shown in Table 1.

[0437] Table 1:

[0438] Example 2: Inactivation of MESP1 and MESP2 genes through hPSC gene editing To generate E1C3 human embryonic stem cells (hESCs) with loss of function of MESP1 and MESP2, guide RNAs (gRNAs) targeting the coding regions of the genes were designed. The gRNAs were synthesized by IDT and their efficiency in E1C3 hESCs was screened using the Neon transfection system, an electroporation protocol recommended by Thermo Fischer Scientific. Briefly, the gRNAs and corresponding proteins were diluted to 75 μM and 10 µg / µl, respectively, in IDTE buffer. To form the RNP (ribonucleoprotein) complex, 1 µl of gRNA and 1 µl of the corresponding protein were mixed in a sterile Eppendorf tube and incubated at room temperature (RT) for 20 minutes, and stored on ice if not immediately transfected. For transfection, the cultured hESCs were harvested, washed, and 300,000 hESCs were resuspended in 9 μl of buffer R along with 2 μl of the formed ribonucleoprotein complex and 10 μl of the Neon transfection kit. hESCs were then electroporated using the Neon transfection system and program P13 (1100V and two pulses with a pulse width of 20ms). After electroporation, the electroporated cells were left in the electroporation needle at room temperature for 10 minutes. Subsequently, the electroporated cells were transferred to 12-well culture dishes and incubated with culture medium supplemented with additional reagents (3 mL NutriStem medium + 6 µL ROCK inhibitor Y2763 + 5 µL iMatrix 511). Two hours after transfection, the culture medium was replaced with the same composition. Forty-eight hours after transfection, cells were harvested and gRNA cleavage efficiency was analyzed using the IDAA method (insertion / deletion detection based on amplicon analysis) (Yang et al., 2015, PMID:25753669). Effectively cleaved gRNA.MESP1.1 and gRNA.MESP2.3 were selected for further single and double gene knockout assays. The batch-sorted cells were expanded, and on day 4, single cells were sorted into 96-well plates using a Sony Sorter SH800. Surviving clones were collected and analyzed using IDAA and Sanger sequencing to confirm out-of-frame mutations in MESP1 and MESP2, resulting in loss of function.

[0439] The MESP1 and MESP2 alleles were inactivated by introducing a frameshift in human pluripotent stem cell lines (hPSCs) using gene editing (insertion or deletion). Sequence alignments of the WT MESP1 and MESP2 alleles with the inactivated alleles in two MESP1 / MESP2 knockout clones (EST008.B1 and EST008.B2) are shown below: Clone name: EST008.B1 MESP1 (Wild type) WT_MESP1: GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCATGAGTCTGGGGACGAGACGAGGGAGCGGCC(SEQ ID NO: 1) (Allele 1) MESP1 (-2bp): GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCAT--GTCTGGGGACGAGACGAGGGAGCGGCC(SEQ ID NO: 2) (Allele 2) MESP1 (-13bp) GGGCTGTCGGCTGGGGTGCTGCCCCATG-------------GTCTGGGGACGAGACGAGGGAGCGGCC(SEQ ID NO: 3) MESP2 (Wild type) WT_MESP2: CCCGGCCTCTCCTCCGA-TTCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 4) (Allele 1) MESP2 (+1bp) CCCGGCCTCTCCTCC---TTCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 5) (Allele 2) MESP2 (-2bp) CCCGGCCTCCTCCTCCGAATGCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 6) Clone name: EST008.B2 (Wild type) WT_MESP1 GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCATGAGTCTGGGGACGAGACGAGGGAGCGGCC (SEQ ID NO: 1) (Allele 1) MESP1 (-2bp) GGGCTCGGCACGGGGCTGTCGGCAGGTGTGCTGCCCCAT--GTCTGGGGACGAGACGAGGGAGCGGCC(SEQ ID NO: 2) (Allele 2) MESP1 (-13bp) GGGCTGTCGGCTGGGGTGCTGCCCCATG-------------GTCTGGGGACGAGACGAGGGAGCGGCC(SEQ ID NO: 3) MESP2 (Wild type) WT_MESP2: CCCGGCCTCTCCTCCGA-TTCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 4) (Allele 1) MESP2 (+1bp) CCCGGCCTCCTCCTCCGAATGCGTCGGGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 5) (Allele 2) MESP2 (-5bp) CCCGGCTCCCTCCTCC------GTCGTGTTCGTGCCCCTGCGACGGCGC (SEQ ID NO: 7) Example 3: Inactivation of MESP1 and MESP2 genes via hPSC gene editing using MAD7 To generate E1C3 human embryonic stem cells (hESCs) with loss of function of MESP1, MESP2, and TBXT, gRNAs targeting the coding regions of these genes were designed. The gRNAs were synthesized by IDT® and screened for their efficiency in E1C3 hESCs using the Neon Transfection® electroporation system recommended by the manufacturer, Thermo Fischer Scientific. Briefly, the gRNA and nuclease protein (MAD7) were diluted to 75 μM and 10 µg / µl, respectively, in IDTE buffer. To form the RNP (ribonucleoprotein) complex, 1 µl of gRNA and 1 µl of MAD7 were mixed in a sterile Eppendorf® tube and incubated at room temperature (RT) for 20 minutes. For electroporation, the cultured hESCs were harvested, washed with R buffer (Neon Transfection® kit), and 300,000 hESCs were resuspended with 2 µl of the formed RNP complex in 11 µl of R buffer (Neon Transfection® kit). After 20 minutes of incubation, hESCs were electroporated using the NeonTransfection® system with the following procedure: P13 (two pulses of 1100V with a pulse width of 20ms). Subsequently, the electroporated cells were transferred to 24-well plates and incubated with culture medium supplemented with (600 µl StemFit medium + 0.8 µL ROCK inhibitor Y27632 + 1.9 µL iMatrix 511). Forty-eight hours after electroporation, cells were harvested, and gRNA cleavage efficiency was analyzed by NGS sequencing (Genewiz from Azenta Life Sciences). Effectively cleaving gRNAs MESP1.1, MESP2.1, TBXT-7, and TBXT-10 were selected for further generation of KO cell lines. Electroporated cells were expanded, and on day 7, single cells were sorted into 96-well plates using a Sony Sorter SH800. Surviving clones were collected and analyzed by NGS sequencing to confirm frameshift mutations in MESP1 and / or MESP2 or TBXT, resulting in loss of function.

[0440] The MESP1, MESP2, and TBXT alleles were inactivated by introducing frameshifts in human pluripotent stem cell lines (hPSCs) through gene editing (insertion or deletion).

[0441] MESP1 knockout clones (clone 1 and clone 2) are shown below:

[0442] MESP1 knockout clone 1: (Wild type) WT_MESP1: CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACCGCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGACAGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTGGCCCGCGGGCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCGTGCGCATGC (SEQ ID NO: 9) (Allele 1) MESP1 (-2bp) CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACCGCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGACAGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTGGCC—CGGGCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCGTGCGCATGC (SEQ ID NO:10) (Allele 2) MESP1 (-4 bp) CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACCGCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGACAGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTGGCCC----GCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCGTGCGCATGC (SEQ ID NO: 11) MESP1 knockout clone 2 (Wild type) WT_MESP1: CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACCGCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGACAGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCTGGCCCGCGGGCGCCACGGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCGTGCGCATGC (SEQ ID NO: 9) (Allele 1 and Allele 2) MESP1 (-16 bp): CGCGGGGCAGTCGTCGGGGCACAGCGGGCAGCCCCGAGGGGACCCCGCGTCACCGCGCTGCCGGCACCGGCGCTGGAGACTCTCCTCGCTGAGGCCTAGCACGGCCGACAGGTGGCCGATATAGCGGATAGCCAGGCGCAGCGTCTCGATCTTGGTCAGGCTCT----------------GGACGGCGGTAGAAAGCGGCGCAGCTCGTGCAGGGCGCGGGCCAGCGTGCGCATGC(SEQ ID NO: 12) MESP2 knockout clone 1

[0443] (Wild type) WT_MESP2: CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTCCGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAGCCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAGCGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAACTGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCCCTCCTTGGCGCCGGCCGGCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACCTATCGGCCGTGCTG (SEQ ID NO:14) (Allele 1 and Allele 2) MESP2 (-10bp) CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTCCGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAGCCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAGCGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAACTGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCCCTCCTT----------GGCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACCTATCGGCCGTGCTG(SEQ ID NO:15) MESP2 knockout clone 2 (Wild type) WT MESP2: CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTCCGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAGCCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAGCGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAACTGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCCCTCCTTGGCGCCGGCCGGCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACCTATCGGCCGTGCTG (SEQ ID NO: 14) (Allele 1) MESP2 (-23 bp) CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTCCGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAGCCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAGCGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAACTGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCT-----------------------GCCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACCTATCGGCCGTGCTG(SEQ ID NO:16) (Allele 2) MESP2 (-16bp) CCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTCCGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAGCCTCCGAGCTGCAGCTCCCGAGCCGCAGAGGCAGCCGCGACGACGCCCAGACGAGCGCGCACCGGACCAGCGGGCGGACAGCGGCAGAGCGCCAGCGAGCGGGAGAAACTGCGCATGCGCACGCTGGCCCGCGCCCTGCACGAGTTGCGCCGCTTTCTGCCTCCCT----------------CCAGAGCCTGACCAAGATCGAGACGCTGCGCCTGGCCATCCGCTACATCGGCCACCTATCGGCCGTGCTG(SEQ ID NO:17) TBXT knockout clones (clone TBXT_7_36 KO and clone TBXT_10_22 KO) are shown below: Clone TBXT_7_36 KO

[0444] (Wild type) WT_TBXT AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTCAGCACCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQID NO: 20) (Allele 1) TBXT (-5bp): AAGGAGTACATGGCGTTGGGGTCCAGGCCAG-----TTCACCTTCAGCACCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQID NO: 21) (Allele 2) TBXT (-4bp): AAGGAGTACATGGCGTTGGGGTCCAGGCCAG----GTTCACCTTCAGCACCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQID NO: 22) Cloning TBXT_10_22 KO (Wild type) WT_TBXT: AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTCAGCACCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQID NO: 20) (Allele 1) TBXT (+1 bp, 3 bp substitution): AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTCCT T CAGCGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC(SEQ ID NO: 23) (Allele 2) TBXT (-5 bp): AAGGAGTACATGGCGTTGGGGTCCAGGCCAGACACGTTCACCTTC-----CGGAAACATCCTCCTGGAAAACACGGGGCGGGCGCAGGAGGACCCCGACACTGACCAGGTAGGCCGGAGGCAGAAGCTGGGCACAGAGGC (SEQID NO: 24) Example 4: Differentiation of hPSCs into DE (i) Culture of hPSCs (hPSCs) hPSCs were cultured in tissue culture containers coated with a suitable matrix (e.g., tissue culture flasks, cell stacks) and in a medium designed to maintain and expand hPSCs. More specifically, the tissue culture containers were coated with 0.25 µg / cm² of iMatrix-511MG (Nippi, product number 892-005). Coating was performed either by directly incorporating iMatrix-511MG into the hPSC medium before cell seeding or by pre-coating the tissue culture containers with iMatrix-511MG diluted in PBS+ / + (Gibco, product number 14040-174) at 37°C for 1 hour. For pre-coating, the iMatrix-511MG solution was aspirated immediately before adding hPSCs to the tissue culture containers.

[0445] hPSCs were cultured in NutriStem hPSCs XF medium (Sartorius, product number 05-100-1A). Single-cell suspensions of hPSCs were prepared in NutriStem hPSCs XF medium containing 10 µM Y-27632 dihydrochloride (Tocris Bioscience, product number TB1254-GMP). hPSCs were seeded at a concentration of 12,000–25,000 viable cells / cm² into tissue culture containers coated with iMatrix-511MG. The medium was replenished daily with NutriStem hPSCs XF medium without Y-27632 dihydrochloride, and hPSCs were cultured at 37°C and 5% CO₂ for 3–4 days before passage.

[0446] The following steps were performed to passage hPSCs: Aspirate the culture medium from the tissue culture vessel and add PBS- / - (Gibco, product number 14190-169) to the vessel, briefly vortexing to cover the cells. After removing the PBS- / -, add TrypLE Select enzyme (Gibco, product number 12563-011) to the cells. Incubate the tissue culture vessel at 37°C for 5–10 minutes until the hPSCs are completely dissociated from the vessel and form a single-cell suspension. Add NutriStem hPSCs XF medium to neutralize the TrypLE Select enzyme, and transfer the cell suspension to a centrifuge tube. Precipitate the hPSCs at 300xG for 5 minutes and then aspirate the medium. Resuspend the hPSCs in NutriStem hPSCs XF medium containing 10 µM Y-27632, and determine the concentration of the hPSC suspension using an automated cell counter.

[0447] (ii) Aggregate formation of hPSCs in suspension culture For aggregate formation, hPSCs are dissociated into single-cell suspensions as described in section (i) above, with the only difference being the use of Accutase cell desorption solution (STEMCELL Technologies, product number 7920) instead of TrypLESelect enzyme.

[0448] In NutriStem hPSCs XF medium containing 10 µM Y-27632 dihydrochloride and 100 ng / ml bFGF (Peprotech, product number 100-18B), at a concentration of 0.5–1.5 x 10⁻⁶. 6 Prepare hPSC single-cell suspensions at 1 live cells / ml. Inoculate the hPSC suspensions into appropriate suspension culture vessels. Suspension culture vessels include conical shake flasks (Corning), disposable rotary flask systems (Corning), ABLE Biott 3D magnetic stirring and disposable bioreactor systems (ABLEBiott / Reprocell), and Eppendorf DASGIP or DASBOX parallel bioreactor systems (Eppendorf).

[0449] For the ABLE Biott system, 30 or 100 ml bioreactors containing hPSC suspension were placed on a magnetically stirred plate at 37°C, 5% CO2, and 60 RPM and incubated for 72 hours, with the medium changed daily. During medium changes, hPSC aggregates were allowed to settle in the bioreactor by gravity, and the medium was removed and replenished with NutriStem hPSCs XF medium containing 10 µM Y-27632 dihydrochloride and 100 ng / ml bFGF. In some cases, the medium was transferred to StemFit Basic 03 (Ajinomoto, product number 34770) containing 5 µM Y-27632 dihydrochloride and 100 ng / ml bFGF. In short, hPSCs were seeded in NutriStem hPSC Xf medium containing 10 µM Y-27632 dihydrochloride and 100 ng / ml bFGF. After the first 24 hours, half of the medium was replaced with StemFit Basic 03 containing 5 µM Y-27632 dihydrochloride and 100 ng / ml bFGF, and the entire medium was replaced after 48 hours with StemFit Basic 03 containing 5 µM Y-27632 dihydrochloride and 100 ng / ml bFGF. After 72 hours of suspension culture, the size and number of hPSC aggregates were determined using an automated islet cell counter (BIOREP, product number ICC-04).

[0450] (iii) hPSC aggregates differentiate into DE hPSC aggregates were transferred to 6-well ultralow adsorption plates (Corning, product number 3471) or placed in an ABLE Biott 3D magnetically stirred and disposable bioreactor system for DE differentiation. hPSC aggregates were washed once in RPMI 1640 medium, and then the medium was replaced with RPMI 1640 medium supplemented with 2–8 µM CHIR 99021 (TocrisBioscience, product number TB4423-GMP) or 1 µM CP21R7. Six-well ultralow adsorption plates containing 5 ml of medium were placed on a Celltron shaker (INFORS HT) set to 120 RPM. The ABLE Biott bioreactor was placed on a magnetically stirred plate set to 60 RPM in a standard incubator at 37°C and 5% CO2. After 24 hours, the aggregates were allowed to settle by gravity and washed once in RPMI 1640 medium. The culture medium was replaced with RPMI 1640 medium containing 100 ng / ml activator A (Peprotech, product number 120-14E). The medium was replaced again after 48 hours, but not after 72 hours, and DE differentiation was completed after 96 hours. A schematic diagram of hPSC differentiation into DE is shown below. Figure 2 In A.

[0451] Example 5: DE differentiates into pancreatic endocrine cells Further differentiation of DE into pancreatic endocrine cells (including β cells) was carried out in a 30 ml ABLE Biott bioreactor rotating at 60 RPM in a 37°C, 5% CO2 standard incubator. DE aggregates were differentiated into pancreatic endoderm by washing them in RPMI 1640 medium, followed by replacement with RPMI 1640 medium containing 12% knockout serum substitute (GIBCO, product number 10828-028), 1:1000 (v / v) Revitacell (GIBCO, product number A4238401), 12.5 nM LDN193189 (Tocris, product number 6053), and 3 µm AGN 193109 (Tocris, product number 5758) for 48 hours (medium changed daily). The aggregates were washed as described above and further differentiated for 48 hours in RPMI 1640 medium containing 12% knockout serum substitute, 1:1000 (v / v) Revitacell, 64 ng / ml bFGF (Peprotech, product number 100-18B), 12.5 nMLDN 193189, 1 µM AM 580 (Tocris, product number 0760), and 10 µM SP 600125 (Tocris, product number 1496), with the medium changed daily. The aggregates were then washed as described above and further differentiated for another seven days in RPMI 1640 medium containing 12% knockout serum substitute, 1:1000 (v / v) Revitacell, 64 ng / ml bFGF, 0.05 µM AM580, and 10 µM SP 600125. Cells were washed in MCDB131 medium (Gibco, product number 10372019) and then supplemented with MCDB131 medium containing 0.05% human serum albumin (Origin, product number ART-3003), 25.5 mM glucose (Sigma-Aldrich, product number G8769), 14.64 mM NaHCO3 (Gibco, product number 25080094), 1:200 (v / v) ITS-X (Gibco, product number 51500056), 1:100 Glutamax (Gibco, product number 35050038), 0.25 µM ascorbic acid (JT Baker, product number 0937-07), and 10 µM ZnSO4 (Merck, product number 1088811000) to further differentiate pancreatic endoderm into pancreatic endocrine cells. Medium was replenished every 48 hours.The following compounds were included during the first four days of differentiation: 2 µM XX (Tocris, product number 4489), 1 µM T3 (Tocris, product number 6666), 5 µM Y-27632 dihydrochloride (Tocris, product number 1254), 100 nM LDN 193189, 60 ng / ml cytosine (R&D Systems, product number 261-CE-250), 10 µg / ml heparin (Akron Biotech, product number AK9987-1000), 3.3 nM astrococcus (Tocris, product number 1258), 10 µM trichomoniasis (Tocris, product number 1099), 5 µM TCS JNK 6o (Tocris, product number 3222), and 3.5 µM linivani (Tocris, product number 7743). The following compounds were differentiated over the next three days: 1 µM XX, 1 µM T3, 5 µM Y-27632 dihydrochloride, 100 nM LDN 193189, 10 µg / ml heparin, 3.3 nM astrococcus and 3.5 µM linivani.

[0452] Example 6: Single-cell dissociation for flow cytometry and single-cell RNA sequencing Approximately 1–5 ml of cell aggregates (undifferentiated hPSCs, DE, pancreatic endoderm, and pancreatic endocrine cells) were sampled from the differentiated cells and transferred to 15 ml centrifuge tubes. The aggregates were pelleted and the supernatant was removed. The aggregates were washed in 10 ml of PBS- / - and then incubated with 2 ml of TrypLE Select enzyme at 37°C with horizontal vortexing for 5–7 minutes. The aggregates were dissociated into single cells by careful up-and-down pipetting several times, and the enzymatic reaction was then terminated by adding 10 ml of RPMI 1640 containing 0.5% knockout serum substitute. The cells were filtered through a 40 µm cell filter (Corning, product number CLS431750). Cell number and viability were determined using an automated cell counter (Chemometec, NC-202). The single-cell suspension was then processed for flow cytometry analysis or single-cell RNA sequencing.

[0453] Example 7: Sample preparation and analysis for flow cytometry 2.5 x 10⁶ live single-cell pellets were collected (400xG, 5 min) and then washed once with PBS- / -. Cells were resuspended in PBS- / - at 1 x 10⁶ live cells / ml and 1 µl / ml of live / dead fixative near-infrared solution (Thermofisher, L10119) was added. Cells were incubated at room temperature for 15 min in the dark. Cell pellets were collected (400xG, 5 min), the supernatant was removed, and the cells were resuspended in 1 ml of 4% formaldehyde. Cells were incubated at 4°C for 20 min in the dark. 12 ml of PBS- / - containing 1% bovine serum albumin (BSA) was added, and cells were collected (800xG, 3 min) and then resuspended in PBS- / - containing 1% BSA. After fixation, cells were stored at 4°C until further processing. Cell pellet was collected (800xG, 3 min) and subsequently resuspended in PBS- / - containing 0.2% Triton X-100 and 2% BSA, and incubated at room temperature for 30 min. Cell pellet was collected again (800xG, 3 min), the supernatant was removed, and the first / directly conjugated antibody solution was added to the cells. Incubation was performed overnight at 4°C / 30 min at room temperature. After incubation, cells were washed in PBS- / - containing 1% BSA. For first / second antibody staining, cells were incubated with the second antibody in PBS- / - containing 0.2% Triton X-100 and 2% BSA at room temperature for 30 min, followed by washing as described above. Cells were then filtered through a 40 µm screen and the sample was processed on a standard flow cytometry apparatus.

[0454] Example 8: Single-cell RNA sequencing Single-cell RNA sequencing was performed on formaldehyde-fixed single cells. In short, single cells were fixed according to the manufacturer's protocol (10x Genomics, CG000478). The fixed cells were then processed using the 10x Genomics (CG000527) Chromium-Fixed RNA Profiling Kit.

Claims

1. A method for inhibiting the formation of a mesodermal cell population during the in vitro differentiation of human pluripotent stem cells into a defined endoderm, the method comprising inactivating or reducing the expression of one or more genes in the human pluripotent stem cells, wherein the one or more genes are required for the formation of the mesodermal cell population.

2. The method according to claim 1, wherein the one or more genes required for the formation of the mesodermal cell population are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

3. The method according to any one of the preceding claims, wherein the one or more genes required for the formation of the mesodermal cell population include MESP1 and / or MESP2 or TBXT.

4. The method according to any one of the preceding claims, wherein the reduction in the expression of the one or more genes is achieved by reducing the amount of RNA transcripts (mRNA) of the one or more genes, reducing the amount of proteins encoded by the one or more genes, and / or reducing the amount of activity of the one or more genes.

5. The method according to any one of the preceding claims, wherein the inactivation of the one or more genes is performed or achieved by using a genetic engineering technique selected from MAD7 nuclease, CRISPR nuclease, base editing, leader editing, zinc finger nuclease, transcription activator-like effector nuclease, or homologous recombination to knock out or knock down the gene in the human pluripotent stem cells.

6. The method according to any one of the preceding claims, wherein the in vitro differentiation of the human pluripotent stem cells into a defined endoderm comprises the step of culturing the human pluripotent stem cells in a cell culture medium containing a WNT signaling activator.

7. The method of claim 6, wherein the WNT signal transduction activator is CHIR, CP21R7, WNT3a, or BIO.

8. The method according to claim 6 or 7, wherein the concentration of the WNT signal transduction activator in the culture medium is 1-8 µM.

9. The method according to any one of the preceding claims, comprising an intermediate step of differentiating the human pluripotent stem cells into progenitor cells.

10. The method according to any one of claims 1 to 8, further comprising differentiating the shaped endoderm into pancreatic endocrine cells or insulin-producing cells.

11. A genetically engineered cell, wherein the cell is genetically modified to prevent the formation of mesodermal cells during the differentiation of human pluripotent stem cells into well-defined endoderm, pancreatic endoderm, or pancreatic endocrine cells, wherein the genetically engineered cell contains inactivated or reduced expression of the MESP1 and / or MESP2 or TBXT genes.

12. An in vitro cell population of genetically engineered cells or shaped endoderm derived from human pluripotent stem cells according to claim 11, wherein one or more genes required for the formation of the mesodermal cell population in the human pluripotent stem cells have been inactivated, wherein the one or more genes are selected from MESP1, MESP2, TBX6, HES7, CDX1, CDX2, CDX4, TBXT, HOXA1, HOXB1, HOXB3, HOXB4, MSX1, MSX2, MSGN1, ETV1, EVX1, HAND1, HAND2, SOX7, FOXF1, FOXC1, FOXC2, RSPO3, ARL4D, APLNR, NEDD9, NTS, or LEF1.

13. The cell population of claim 12, wherein the population comprises less than 1% or 2% mesodermal cells and / or less than 0.05% residual human pluripotent stem cells.

14. The cell population according to claims 12 to 13, further differentiated or intended to be further differentiated into pancreatic endocrine cells or insulin-producing cells, which are used as a medicament for treating diabetes by administration, transplantation or implantation of the pancreatic endocrine cells or insulin-producing cells or tissues or organs derived from the pancreatic endocrine cells or insulin-producing cells into a subject.

15. A cell composition comprising an in vitro cell population and a cell culture medium according to any one of claims 12-14.

Images