Compounds for modulating the activity or expression of mtor and uses thereof

Abstract

The present invention relates to a compound for modulating the expression level and / or activity of mTOR gene and a composition comprising the same. The compound and the composition can be used for preventing, treating or alleviating mTOR-related diseases, disorders and conditions.

Description

Technical Field

[0001] This invention relates to RNA-targeted therapeutic agents for regulating the expression level and / or activity of the mTOR gene, and more specifically to compounds and compositions comprising such therapeutic agents, wherein the compounds and compositions may be used to prevent, improve or treat mTOR-related diseases, symptoms and conditions. Background Technology

[0002] The mammalian (or mechanistic) target of rapamycin (mTOR) pathway plays a crucial role in regulating a wide range of biological processes essential for cellular life, aging, and death. Given the widespread distribution of mTOR across various cell types throughout the body, the mTOR pathway controls a diverse range of anabolic and catabolic processes in different organs / tissues, including but not limited to the liver, lymphocytes, white and brown adipose tissue, skeletal muscle, and the brain. Therefore, impaired mTOR activity, and particularly its overactivation, has been associated with a broad spectrum of human diseases, including cancer, type 2 diabetes, cardiovascular pathology, neurological disorders, and aging.

[0003] mTOR is a 289 kDa protein kinase encoded by the mTOR gene (chromosome 1p36.2) in humans. MTOR is an intracellular serine / threonine kinase that plays a crucial role in mediating appropriate physiological functions within the cell. MTOR forms complexes with other proteins to mediate intracellular signal transduction; these complexes are classified as MTOR complex 1 (MTORC1) or MTOR complex 2 (MTORC2) based on the identity of their constituent proteins. MTORC1 contains RAPTOR (a protein associated with mTOR regulation) as a component and plays an important role in cell growth and proliferation by regulating ribosome biogenesis and protein expression. MTORC2 contains RICTOR (a rapamycin-insensitive chaperone protein for mTOR) as a component and plays an important role in intracellular cytoskeleton remodeling and cell migration. The mTOR-containing complexes also differ in their upstream regulators, substrate specificity, functional output, and sensitivity to rapamycin. Sensitivity to rapamycin represents another key characteristic distinguishing the mTORC1 and mTORC2 complexes. Rapamycin does not directly inhibit the catalytic (kinase) activity of mTOR; instead, it binds to the immunoaffinity protein FKBP12 (a 12 kDa FK506-binding protein), a protein that binds to the mTOR FKBP-rapamycin binding domain (FRB). Although the FRB domain is present in both the mTORC1 and mTORC2 complexes, it is only exposed in mTORC1 because Rictor prevents the FKBP12-rapamycin complex from entering the FRB domain of mTORC2. Therefore, mTORC2 is relatively resistant to the effects of rapamycin both in vitro and in vivo. Summary of the Invention

[0004] The problem the invention aims to solve

[0005] One embodiment of the present invention relates to RNA-targeted therapeutic agents for regulating the activity and / or expression level of mTOR, including, for example, RNAi agents, antisense oligonucleotides, and miRNAs.

[0006] One embodiment of the present invention relates to a compound for regulating the activity and / or expression level of mTOR, and a pharmaceutical composition, method or use comprising the compound as an active ingredient for the prevention, improvement and / or treatment of mTOR-related diseases, symptoms and conditions.

[0007] Other embodiments of the present invention relate to compositions, methods, or uses for regulating the activity and / or expression level of MTOR by using compounds for regulating the activity and / or expression level of MTOR.

[0008] Compounds used to regulate the activity and / or expression level of mTOR can be oligomeric compounds and / or RNAi agents, wherein the oligomeric compounds can be antisense oligonucleotides, and wherein the RNAi agents can include, but are not limited to, ssRNAi agents, siRNA, shRNA, and miRNA.

[0009] Solution for solving the problem

[0010] One embodiment of the present invention relates to a compound for regulating the activity and / or expression level (amount) of mTOR, and a pharmaceutical composition or method comprising said compound as an active ingredient for preventing, improving, and / or treating mTOR-related diseases, symptoms, and conditions. Furthermore, one embodiment of the present invention relates to a compound for regulating the activity and / or expression level (amount) of mTOR, and a pharmaceutical composition or method comprising said compound as an active ingredient for preventing, improving, and / or treating mTOR-mediated diseases, symptoms, and conditions.

[0011] One specific embodiment of the present invention relates to a method for preventing, improving, and / or treating mTOR-related diseases, symptoms, and conditions, the method comprising the step of administering to an individual or patient in need a compound for regulating the activity and / or expression level of mTOR. As used herein, the term "expression" refers to the process by which polynucleotides produce gene products such as RNA or polypeptides (or proteins, etc.).

[0012] More specifically, the present invention relates to a pharmaceutical composition or method for preventing, improving and / or treating diseases, symptoms and conditions caused by overactivation or overexpression of mTOR.

[0013] In this disclosure, “individual,” “patient,” or “subject” means a person or non-human animal selected for treatment or therapy, and non-human animals may include, but are not limited to, mammals such as monkeys, rats, mice, rabbits, and guinea pigs.

[0014] One specific embodiment of the present invention relates to compounds, oligomers, and / or RNAi agents for regulating the activity and / or expression level (amount) of mTOR. Embodiments provide compounds, methods, and compositions for inhibiting the expression of mTOR mRNA and protein, inhibiting the activity of mTOR protein, or reducing the levels of mRNA and protein. In a specific embodiment, the compound for regulating the activity and / or expression level (amount) of mTOR may be an inhibitor that reduces or inhibits the activity and / or expression level (amount) of mTOR.

[0015] Overactivation of the mTOR signaling pathway can occur due to mutations in the mTOR gene itself or its upstream genes, or due to disruption of homeostasis in other signaling pathways. For example, focal cortical dysplasia (FCD) is a representative disease of refractory childhood epilepsy and is classified as FMCD (focal cortical dysplasia) along with unilateral hemicratosis (HME). The genetic causes of these diseases are well known due to brain-specific somatic mutations that induce overactivation of the mTOR signaling pathway.

[0016] In particular, mutations in the mTOR gene itself (which account for approximately 60% of the various gene variations found in patients with FCD type II) can alter the structure of the mTOR protein, leading to overactivation of both mTORC1 and mTORC2. It is well known from existing literature that both the mTORC1 and mTORC2 complexes can contribute to refractory FMCD epilepsy.

[0017] The MTOR-targeting antisense oligonucleotide (ASO) of this invention reduces the expression level of MTOR by degrading the mRNA of the MTOR gene. This reduces the expression level of MTOR itself, which is a common component of both MTOR and MTORC2 complexes, thereby inducing inhibition of the activities of both MTORC1 and MTORC2 complexes, and thus can be used as a therapeutic agent for refractory FMCD epilepsy. In particular, the mutated MTOR protein may respond differently to small molecule MTOR inhibitors, but the MTOR antisense oligonucleotide of this invention overcomes this limitation.

[0018] The compounds according to the invention can be used for MTOR-related diseases, symptoms and conditions, or more specifically diseases, symptoms and conditions caused by overactivation or overexpression of MTOR, and the overactivation or overexpression of MTOR can be caused by genetic alterations of the mTOR gene or genes in the signaling pathways containing it, and such genetic alterations include germline alterations and somatic alterations.

[0019] Examples of diseases, conditions, or pathological conditions may include tumors, neurological disorders, and kidney diseases. Neurological disorders include neurodevelopmental disorders and neurodegenerative disorders. Neurodevelopmental disorders may include mTOR disease, epilepsy, and seizure-related disorders. mTOR diseases include focal cortical dysplasia (FCD) caused by somatic mutations, such as FCD type II, hemimegaencephaly (HME), tuberous sclerosis (TSC), megalencephaly (MEG), Cowden syndrome, PIK3CA-associated overgrowth spectrum disorders (PROS), Bannayan-Riley-Ruvalcaba syndrome (BRRS), Lhermitte-Duclos disease (LDD), MCAP (megalencephaly-polydactyly-polymicrogyria-Hydrocephalus), MPPH (megalencephaly-polymicrogyria-Hydrocephalus), Smith-Kingsmore syndrome (SKS), polyhydramnios, megalencephaly, and symptomatic epilepsy syndromes. Epilepsy Syndrome (PMSE), familial intellectual disability-macroscopic malformation syndrome, and Proteus syndrome. Neurodevelopmental disorders include Fragile X syndrome (FXS) and autism spectrum disorder (ASD). Specifically, neurodevelopmental disorders include cortical malformations (MCDs), examples of which include tuberous sclerosis (TSC), focal cortical dysplasia (FCD) such as type II focal cortical dysplasia (FCDII), and HME, and symptoms associated with MCD include epilepsy and seizures.

[0020] Epilepsy and seizure-related disorders include familial focal epilepsy with variable foci (FFEVF), autosomal dominant nocturnal epilepsy (ADNFLE), familial mesial temporal lobe epilepsy (FMTLE), temporal lobe epilepsy (TLE), and infantile-onset developmental and epileptic encephalopathy (DEE).

[0021] Neurodegenerative diseases include Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS).

[0022] Tumors include solid tumors and neuro-oncological tumors. Solid tumors include lung cancer, colorectal cancer, gastric cancer, renal cell carcinoma, bladder cancer, prostate cancer, and breast cancer. Neuro-oncological tumors include gangliomas, glioblastomas, dysembryoplastic neuroepithelial tumors (DNETs), and subependymal giant cell astrocytomas (SGCAs / SEGAs), among others.

[0023] Kidney diseases can include kidney transplantation, polycystic kidney disease (PKD), renal cell carcinoma, and diabetic nephropathy. Specifically, examples include autosomal dominant polycystic kidney disease (ADPKD) or autosomal recessive polycystic kidney disease (ARPKD), a hereditary disorder characterized by the formation of renal cysts and known to be caused by mutations in the PKD1 and PKD2 genes, which encode polycystic protein-1 (PC-1) and polycystic protein-2 (PC-2), respectively. Furthermore, ARPKD is known to occur due to mutations in the PKHD1 gene. Reported preclinical results have shown that mTOR inhibitors slow cyst growth and protect renal function in patients with PKD. Therefore, this compound could be used for kidney diseases associated with mTOR overactivation or overexpression, such as polycystic kidney disease or its symptoms, for example, slowing cyst growth and protecting renal function.

[0024] The compounds used in this invention to regulate the activity and / or expression level of mTOR are specifically compounds that can regulate the activity of mTOR complex 1 (mTORC1) and / or mTOR complex 2 (mTORC2). In particular, the compounds of this invention target the mTOR gene and regulate the activity and / or expression of the mTOR protein, which is shared by mTORC1 and mTORC2, thereby enabling the regulation of both mTORC1 and mTORC2. Specifically, mutations in the mTOR gene itself (which account for approximately 60% of the various gene variations found in patients with FCD type II disease) induce changes in the structure of the mTOR protein, leading to overactivation of both mTORC1 and mTORC2. Since both the mTORC1 and mTORC2 complexes can cause FMCD-resistant epilepsy, the compounds of this invention have the advantage of being able to act on all FMCD diseases caused by various gene variations.

[0025] As used in this disclosure, "target nucleic acid" and "target RNA" refer to nucleic acids for which antisense compounds are designed to exert their effects. Unless otherwise stated, "target RNA" refers to RNA transcripts and includes both precursor mRNA and mature mRNA. In this disclosure, unless otherwise stated, "RNA" refers to RNA transcripts and includes both precursor mRNA and mature mRNA.

[0026] As used in this disclosure, "target region" refers to a portion of a target nucleic acid to which oligomeric compounds are designed to hybridize. Here, "target nucleic acid" and "target RNA" are MTOR. In this disclosure, the MTOR gene can be a human MTOR gene sequence, including known reference transcripts or variants thereof, which are available in various gene databases. Specifically, the MTOR nucleic acid sequence (e.g., the human MTOR nucleic acid sequence) can be identified by NCBI (National Center for Biotechnology Information) reference sequence nucleotide ID NG_033239.1 and its genomic location is nucleotides 11,106,535 to 11,262,551 on chromosome 1 (corresponding to nucleotides 11,106,535 to 11,262,551 in NCBI reference sequence nucleotide ID NC_000001.11 or Ensembl transcript ID: ENST00000361445.9). The coordinates used in this article refer to the coordinates of the Genome Reference Consortium Human Build 38 (GRCh38), also known as Hg38 (Human Genome Build 38).

[0027] This invention relates to RNA-targeted therapeutic agents for regulating the activity and / or expression level of mTOR, and includes, for example, RNAi agents, antisense oligonucleotides, miRNAs, etc. Specifically, the compounds of this invention include, but are not limited to, antisense oligonucleotides targeting mTOR nucleic acids and RNA interference agents (RNAi agents). RNA-targeted therapeutic agents may be oligonucleotides containing 8 to 80 nucleotides, or RNAi agents having a sequence complementary to the human mTOR nucleic acid sequence.

[0028] RNAi agents are antisense agents that function partially via RISC or Ago2 to regulate target nucleic acids and / or proteins encoded by those target nucleic acids. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNAs including microRNA mimics. RNAi agents are not intended to include antisense oligonucleotides.

[0029] One embodiment of the RNAi agent can be a double-stranded RNAi agent, which can be siRNA and may contain an antisense strand complementary to the target gene and a sense strand complementary to the antisense strand, and may optionally contain one or more lipophilic portions conjugated to one or more internal sites of one strand, optionally conjugated via a linker or vector. The sense strand and antisense strand may each be 19 to 25 nucleotides in length, but are not limited thereto.

[0030] Specifically, the target nucleobase sequence of the MTOR gene (Ensembl transcript ID: ENST00000361445.9) used for complementary hybridization can be GAATGTTGACCAATGCTAT (SEQ No. 464), GGTCTGAGTTTAAGGTCTA (SEQ No. 465), or GGTCTGAGTTTAAGGTCTA (SEQ No. 465). Examples of sense and antisense sequences of siRNAs acting on these target sequence regions can be the nucleobase sequences described in SEQ Nos. 456 to 463, but are not limited thereto.

[0031] The lipophilic moiety can be an aliphatic, alicyclic, or polyalicyclic compound, specifically lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-hexadecylglycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl, or phenoxazine, or may contain functional groups selected from saturated or unsaturated C4-C30 hydrocarbon chains, hydroxyl groups, amines, carboxylic acids, sulfonates, phosphates, thiols, azides, and alkynes. More specifically, the lipophilic moiety may contain saturated or unsaturated C6-C18 hydrocarbon chains, for which detailed information can be found in WO2019217459A1, etc.

[0032] The MTOR inhibitors of the present invention may comprise a conjugation group and / or a terminal group. In specific examples, the MTOR inhibitor regulates the amount and / or activity of the target nucleic acid. The conjugation portion modifies one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In specific examples, the conjugation portion imparts novel properties to the linked oligonucleotide. As used in this disclosure, a "conjugation group" refers to an atomic group directly linked to an oligonucleotide. A conjugation group includes a conjugation portion and a conjugation linker that links the conjugation portion to the oligonucleotide.

[0033] In this disclosure, the term "inhibition of expression or activity" means a reduction or inhibition of expression or activity compared to expression or activity in an untreated sample or control sample, and it does not necessarily mean complete elimination of expression or activity overall. Specifically, the antisense oligomers or RNAi agents according to the invention are capable of reducing MTOR expression levels to below 70%, below 65%, below 60%, or below 50%.

[0034] In specific instances, oligomers and oligomeric duplexes hybridize with target nucleic acids and can produce at least one antisense activity; these oligomers and oligomeric duplexes are antisense compounds. In specific instances, an antisense compound exhibits antisense activity when it reduces or inhibits the amount or activity of the target nucleic acid by more than 25% in a standard cell assay. In specific instances, antisense compounds selectively affect one or more target nucleic acids.

[0035] In specific examples, based on the control group before treatment and the control group not treated with mTOR inhibitors (set as 0%), mTOR inhibitors can reduce the activity or expression level of mTOR RNA or mTOR protein by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95%. Optionally, based on the control group before treatment and the control group not treated with the MTOR inhibitor (set as 100%), the activity or expression level of MTOR RNA or MTOR protein after treatment with the MTOR inhibitor may be less than about 95%, less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5%.

[0036] The MTOR inhibitors of the present invention may be antisense oligonucleotides, and antisense oligonucleotides refer to oligonucleotides having a nucleic acid sequence complementary to a target nucleic acid or a region or segment thereof. In specific examples, antisense oligonucleotides are capable of specifically hybridizing to a target nucleic acid or a region or segment thereof. As used herein, "antisense oligonucleotide" means an oligonucleotide comprising an oligonucleotide portion of an antisense compound capable of hybridizing to a target nucleic acid and having at least one antisense activity. The terms "antisense oligomer," "antisense compound," "antisense oligonucleotide," or "antisense RNase H oligonucleotide" are used interchangeably and each has a base pair forming portion linked by a nucleobase bond that hybridizes the base pair portions. In these embodiments, the region of the oligonucleotide has a nucleobase sequence complementary to the target nucleobase sequence. In specific examples, a region or the entire length of the nucleobase sequence of the oligonucleotide is complementary to the target gene or target region and has at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% sequence identity. The term "antisense RNase H oligonucleotide" refers to an oligonucleotide that contains a region complementary to the target sequence and contains at least one chemically modified portion suitable for RNase H-mediated nucleic acid downsampling.

[0037] In this disclosure, compounds (e.g., oligonucleotides) used to regulate the activity and / or expression level (amount) of MTOR include pharmaceutically acceptable salts thereof, wherein “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound (e.g., an oligomeric compound or oligonucleotide), i.e., a salt that retains the desired biological activity of the parent compound without causing undesirable toxicological effects.

[0038] One embodiment relates to an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide has at least 80% sequence identity with the complementary sequence of an equal-length portion of the MTOR nucleic acid sequence, and the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide bond, and a modified nucleobase.

[0039] Another embodiment relates to an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive nucleobases from the nucleic acid sequences of SEQ ID NO: 1 to 439, and the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide bond and a modified nucleobase.

[0040] "Oligomer" refers to a compound comprising a single oligonucleotide and optionally one or more additional features (e.g., conjugation groups or terminal groups). "Oligonucleotide" refers to a polymer linking nucleosides, each nucleoside being independently modified or unmodified. Unless otherwise stated, an oligonucleotide comprises at least one subunit selected from the group consisting of: 8 to 80, 8 to 70, 8 to 60, 8 to 50, 8 to 40, 8 to 30, 8 to 25, 8 to 22, 8 to 20, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 25, 10 to 22, 10 to 20, 12 to 80, 12 to 70, 12 to 60. 12 to 50, 12 to 40, 12 to 30, 12 to 25, 12 to 22, 12 to 20, 14 to 80, 14 to 70, 14 to 60, 14 to 50, 14 to 40, 14 to 30, 14 to 25, 14 to 22, 14 to 20, 16 to 80, 16 to 70, 16 to 60, 16 to 50, 16 to 40, 16 to 30, 16 to 25, 16 to 22, and 16 to 20 subunits.

[0041] The length of oligonucleotides can be increased or decreased without eliminating activity. For example, in the literature of Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of oligonucleotides with lengths of 13 to 25 nucleotides to induce target RNA cleavage was tested in an oocyte injection model. Oligonucleotides of 25 nucleotides with 8 or 11 mismatched bases near their ends could guide specific cleavage of target RNA, although to a lesser extent than oligonucleotides without mismatches.

[0042] As used in this disclosure, in the context of oligonucleotides, "sequential" means a sequence of nucleosides, nucleobases, sugar moieties, or bonds between nucleosides that are directly adjacent to each other (inter-nucleoside bonds). For example, "sequential nucleobases" refers to nucleobases that are directly adjacent to each other in a sequence.

[0043] As an exemplary oligomeric compound of the present invention, the nucleobase sequence that binds complementary to the human MTOR sequence is shown in Tables 1 to 4 below, where the start and end points in Tables 1 to 4 indicate the base positions of the MTOR nucleic acid (Ensembl transcript ID: ENST00000361445.9) provided by Ensembl.

[0044] [Table 1]

[0045]

[0046]

[0047]

[0048] [Table 2]

[0049]

[0050]

[0051]

[0052] [Table 3]

[0053]

[0054]

[0055]

[0056] [Table 4]

[0057]

[0058]

[0059]

[0060] In a specific example, the oligomeric compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide may comprise 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases selected from the group consisting of SEQ ID NO: 1 to 439. The modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide, and modified nucleobases.

[0061] Specific oligonucleotides can bind complementary to the TR1 region, more specifically the TR6 region; TR2 region; TR3 region, more specifically the TR7 region; TR4 region; or TR5 region in the human mTOR nucleic acid sequence (e.g., the mTOR nucleic acid sequence of Ensembl transcript ID: ENST00000361445.9). Specific information about each region is provided in Tables 5 and 6 below. Target regions can specifically be nucleic acid sequences in human mTOR transcripts (e.g., the mTOR nucleic acid sequence of Ensembl transcript ID: ENST00000361445.9). Therefore, the antisense oligonucleotide can be an oligomer compound comprising 8 to 80, for example 12 to 30 or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive linked nucleosides, complementary to the MTOR gene region selected from the group consisting of SEQ ID NO: 440 to 446, and based on the control group before treatment and the untreated oligonucleotide (set as 0%), the antisense oligonucleotide can have an MTOR knockdown (KD) efficiency of more than 35% or more than 40%.

[0062] Regions can be identified as target sites that provide efficient inhibition of MTOR expression in antisense oligonucleotide screening, and such regions on MTOR mRNA can be considered as favorable target regions for antisense oligonucleotides or RNAi agents.

[0063] [Table 5]

[0064]

[0065] [Table 6]

[0066]

[0067] For example, the oligonucleotide can be an oligomer compound comprising 8 to 80, for example 12 to 30 or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive linked nucleosides, which is reverse complementary to the MTOR gene region (sense strand) selected from the group consisting of SEQ ID NO: 440 to 446.

[0068] More specifically, the nucleic acid sequence of the oligonucleotide that is reverse complementary to the MTOR gene region (sense strand) selected from the group consisting of SEQ ID NO: 440 to 446 is, for example, an oligonucleotide that is reverse complementary to the nucleic acid sequence of TR1 and contains 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive linked nucleosides in the nucleic acid sequence of SEQ ID NO: 1 to 19; more specifically, an oligonucleotide that is reverse complementary to the nucleic acid sequence of TR6 and contains 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive linked nucleosides in the nucleic acid sequence of SEQ ID NO: 10 to 15; for example, an oligonucleotide that is reverse complementary to the nucleic acid sequence of TR2 and contains SEQ ID NO: 1 to 19. Oligonucleotides comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides in the nucleic acid sequences of SEQ ID NO: 27 to 36; oligonucleotides comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides in the nucleic acid sequences of SEQ ID NO: 68 to 81 as an oligonucleotide that is reverse complementary to the nucleic acid sequence of TR3, more specifically, for example, oligonucleotides comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides in the nucleic acid sequences of SEQ ID NO: 70 to 74 as an oligonucleotide that is reverse complementary to the nucleic acid sequence of TR7; for example, oligonucleotides comprising SEQ ID NO: 70 to 74 as an oligonucleotide that is reverse complementary to the nucleic acid sequence of TR4; Oligonucleotides comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides in the nucleic acid sequences of SEQ ID NO: 396 to 403; or, for example, oligonucleotides comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides in the nucleic acid sequences of SEQ ID NO: 414 to 417 as an oligonucleotide reverse complementary to a portion of the nucleic acid sequence of TR5. Furthermore, the oligonucleotide may be an oligomeric compound comprising a modified oligonucleotide containing at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide, and a modified nucleobase.

[0069] Specifically, the nucleic acid sequence of the oligonucleotide can be an oligomer compound comprising 12, 13, 14, 15, 16, 17, 18, 20 consecutive linked nucleosides selected from the group consisting of SEQ ID Nos: 10, 11, 12, 13, 14, 28, 32, 35, 71, 396, 397, 398, 399, 400, 401, 402, 403, 414, and 416. Furthermore, the oligonucleotide can also be an oligomer compound comprising a modified oligonucleotide, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide bond, and a modified nucleobase.

[0070] The oligonucleotide can be an oligomer compound comprising 8 to 80, for example 12 to 30 or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides selected from the group consisting of SEQ ID Nos: 447 to 453. In a specific example, the oligonucleotide complementary to the TR1 region can be an oligomer compound comprising 14 to 80, for example 14 to 30 or 14 to 22, specifically 14, 15, 16, 17, 18, 19, or 20 consecutive linked nucleosides and the nucleic acid sequence of SEQ ID No: 454, and can be, for example, an oligomer compound having the nucleic acid sequences of SEQ ID Nos: 10 to 15. The oligonucleotide that binds complementary to the TR4 region can be an oligomer compound comprising 9 to 80, for example 12 to 30 or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive linked nucleosides and the nucleic acid sequence of SEQ ID NO: 455, and can be, for example, an oligomer compound having the nucleic acid sequences of SEQ ID NO: 396 to 403.

[0071] In this disclosure, "modified oligonucleotide" refers to an oligonucleotide in which at least one of the sugar moiety, nucleobase, and nucleoside bond is modified. A modified oligonucleotide may contain at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside bond, and a modified nucleobase. The term "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any modifications to the sugar moiety, nucleobase, and nucleoside bond.

[0072] Nucleic acids are molecules composed of nucleotide monomers. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0073] As used in this disclosure, "modified nucleoside" refers to a nucleoside that contains modified nucleobases and / or modified sugar moieties.

[0074] As used herein, “nucleobase” refers to an unmodified or modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, “modified nucleobase” is any nucleobase (or part thereof) other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. “5-methylcytosine” is a modified nucleobase.

[0075] Within the nucleobase sequence of an oligonucleotide, there can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified nucleobases at any position.

[0076] The modified oligonucleotide has a glycomolecular motif, wherein the glycomolecular motif may comprise: a 5'-wing region composed of 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides; a central gap region composed of 6 to 23, 6 to 22, 6 to 21, 6 to 20, 6 to 19, 6 to 18, 6 to 17, 6 to 16, 6 to 15, 6 to 14, 6 to 13, 6 to 12, 6 to 11, or 6 to 10 linked central region nucleosides; and a 3'-wing region composed of 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides. More specifically, the glycomolecular motif may comprise: a 5'-wing region composed of 1 to 6 linked 5' region nucleosides; a central gap region composed of 6 to 10 linked central region nucleosides; and a 3'-wing region composed of 1 to 6 linked 3' region nucleosides.

[0077] For example, a modified sugar moiety may comprise one or more selected from the group consisting of modified non-bicyclic sugar moieties and modified bicyclic or tricyclic sugar moieties. In a specific instance, the modified sugar moiety is a sugar substitute. Such a sugar substitute may comprise one or more substitutions corresponding to other types of modified sugar moieties.

[0078] In specific examples, the modified sugar moiety is a modified non-bicyclic sugar moiety containing a furanose ring with one or more substituents, wherein no substituent bridges the two atoms of the furanose ring to form a cyclic structure. Such non-bridging substituents can be located at any position on the furanose ring, including but not limited to substituents at the 2', 3', 4', and / or 5' positions. Examples of suitable 2'-substituents for modified non-bicyclic sugar moieties include, but are not limited to, the following: 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE”). In specific examples, the 2'-substituent is halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C.10 Alkoxy, O-C1-C 10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-ynyl, S-ynyl, N(Rm)-ynyl, O-alkylene-O-alkyl, ynyl, alkylaryl, aralkyl, O-alkylaryl, O-aralkylyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn) (where each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C). 10 Alkyl groups, -O(CH2)2ON(CH3)2 (“DMAOE”), and 2'-OCH2OCH2N(CH2)2 (“DMAEOE”), etc.

[0079] In a specific example, the modified non-bicyclic sugar moiety contains a substituent at the 3' position. Examples of suitable substituents for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy) and alkyl (e.g., methyl, ethyl). In a specific example, the modified non-bicyclic sugar moiety contains a substituent at the 4' position. Examples of suitable substituents for the 4' position of the modified non-bicyclic sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in WO 2015 / 106128 (Manoharan et al.).

[0080] Examples of suitable 5'-substituents for modified non-bicyclic sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl, 5'-methoxy, 5'-aminopropyl, or 5'-CP. One embodiment suitable for a 5'-substituent for a modified non-bicyclic sugar moieties is 5'-CP, specifically, "5'-CP" is a modified sugar moiety compound wherein two methyl groups are substituted at the 5-position of the contained 2-deoxyribose, and these methyl groups are linked together to form a cyclopropane, named "5'-CP nucleoside," the details of which are provided in WO2022 / 211095A1. Furthermore, in specific examples, the modified non-bicyclic sugar moieties include, but are not limited to, one or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties.

[0081] In a specific example, the 2'-substituted modified non-bicyclic nucleoside contains a sugar moiety with a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0082] The specific modified sugar moiety includes substituents that bridge two atoms of the furanose ring to form a second ring, thereby producing a bicyclic sugar moiety. Nucleosides containing such bicyclic sugar moieties are called bicyclic nucleosides (BNAs), locked nucleosides (LNAs), or conformationally restricted nucleotides (CRNs). Such compounds are described in U.S. Patent Publication No. 2013 / 0190383; and PCT Publication WO2013 / 036868. In these specific embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In some instances, the furanose is a ribose ring. Examples of substituents bridging 4' and 2' include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “restricted ethyl” or “cEt” when present in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', and 4'-CH(CH2OCH3)-O-2'. (“constrained MOE” or “cMOE”) and its analogues, 4'-C(CH3)(CH3)-O-2' and its analogues, 4'-CH2-N(OCH3)-2' and its analogues, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and its analogues, 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2' (where R, Ra and Rb are each independently H, a protecting group or a C1-C12 alkyl group).

[0083] The modified sugar moiety described above contains substituents that bridge two atoms of the furanose ring to form a second ring, thereby producing a bicyclic sugar moiety. Nucleosides having such bicyclic sugar moieties are called bicyclic nucleosides (BNAs) or bound nucleosides. The bicyclic sugar moiety contains a bridge between the 4' and 2' furanose ring atoms. In some of these embodiments, the furanose is a ribose ring. Examples of substituents bridging 4' and 2' include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "restricted ethyl" or "cEt" when present in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', and 4'-CH(CH2OCH3)-O-2'. (“Constrained MOE” or “cMOE”) and its analogues, 4'-C(CH3)(CH3)-O-2' and its analogues, 4'-CH2-N(OCH3)-2' and its analogues, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and its analogues, 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2' (where R, Ra and Rb are each independently H, a protecting group or C1-C 12 Alkyl groups (e.g., US 7,427,672).

[0084] In this disclosure, the general description of bicyclic nucleosides includes two isomer configurations. When a particular bicyclic nucleoside (e.g., LNA or cEt) is identified in the examples herein, it is present in the β-D configuration unless otherwise stated.

[0085] In specific examples, the modified sugar moiety is a sugar substitute. In these specific embodiments, the epoxide atoms of the sugar moiety are replaced by, for example, sulfur, carbon, or nitrogen atoms.

[0086] Many other bicyclic and tricyclic sugars and sugar substitutes that can be used for modified nucleosides are known in the art.

[0087] In specific examples, the oligonucleotide compound may contain unmodified nucleoside internucleotides (phosphodiester nucleoside internucleotides) and / or one or more modified nucleoside internucleotides. In specific embodiments, each nucleoside internucleotide may be one or more nucleoside internucleotides selected from the group consisting of phosphodiester nucleoside internucleotides (PO), thiophosphate nucleoside internucleotides (PS), and methanesulfonyl-phosphoramidate nucleoside internucleotides (MsPA). Methanesulfonyl-phosphoramidate nucleoside internucleotides (MsPA) and mesyl-phosphoramidate nucleoside internucleotides are interchangeable.

[0088] In specific examples, the internucleotide bonds of the modified oligonucleotide can be independently selected from the group consisting of phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In specific examples, the internucleotide bonds of the phosphate thioester bonds can be stereorandom phosphate thioester internucleotide bonds.

[0089] In specific examples, the modified oligonucleotides of the present invention may contain one or more internucleotide bonds selected from the group consisting of phosphodiester internucleotide bonds (PO), thiophosphate internucleotide bonds (PS), and methanesulfonylaminophosphate internucleotide bonds (MsPA), for example, they may contain phosphodiester (PO) and / or thiophosphate (PS) to have internucleotide bonds of PS, PO, or a mixture of PS and PO. In this case, the modified oligonucleotide may have an unmodified or modified sugar moiety and an unmodified or modified nucleobase, as described above. For example, when the internucleotide bonds of the modified oligonucleotide contain both PS and PO, PO may be located in the wing region and the nick region of the gapmer structure, and preferably may be present in each wing. Specifically, when the oligonucleotide compound has a notched polymer structure with a 5'-wing region, a central notched region, and a 3'-wing region, and each wing region has 1 to 6 nucleobases, examples of modified oligonucleotides containing mixed nucleoside bonds of PS and PO can be selected freely from the group consisting of, for example, SOSSS, SOOSS, SOSOS, SOOOSS, SOOOOS, SSSOSS, SSOOSSS, SSOSOS, SSOOSS, SSOOOS, and SSOOSS. In this case, 'O' represents a phosphodiester nucleoside bond (PO), and 'S' represents a phosphate thioester nucleoside bond (PS). More specifically, it may be a combination of a 5'-wing region comprising at least one of the groups consisting of SOSSS, SOOSS, SOSOS, SOOOSS, and SOOOOS, and a 3'-wing region comprising at least one of the groups consisting of SSSOSS, SSOOSSS, SSOSOS, SSOOSS, SSOOOS, and SSOOSS, specifically SOSSSSSSSSSSSSSSSSSSSSOSS, SOSSSSSSSSSSSSSSSSSOOSS, SOOSSSSSSSSSSSSSSSSSSSOOSS, SOSOSSSSSSSSSSSSSSSSSOSOS, SOOOSSSSSSSSSSSSSSSSS, SOOOSSSSSSSSSSSSSSSSS, SOOOSSSSSSSSSSSSSSSSSOOOS, or SOOOOSSSSSSSSSSSSSSOOSS, and more specifically SOSSSSSSSSSSSSSSSSSSSOOSS, SOSOSSSSSSSSSSSSSSSSSOSOS, or SOOOOSSSSSSSSSSSSOOSS.Examples of oligomeric compounds may be sequences containing 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleobases in nucleic acid sequences comprising SEQ ID NO: 1 to 439 (more specifically SEQ ID No: 1 to 19, SEQ No: 27 to 36, SEQ ID No: 68 to 81, SEQ ID No: 396 to 403, or SEQ ID No: 414 to 417), or even more specifically, sequences containing a mixture of PO and PS internucleotide bonds in nucleic acid sequences comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases in nucleic acid sequences comprising SEQ ID No: 11, 12, 13, 14, 28, 95, 102, 105, 106, 319, 396, 398, 399, 403, 409, 414, or 416. Examples of modified oligonucleotides containing PO and PS linked by mixed nucleosides when the oligomer has a notched polymer structure consisting of a 5'-wing region, a notched region, and a 3'-wing region are described in Table 12 below.

[0090] In specific examples, the modified oligonucleotide comprises or consists of a region having a fully modified glycomolecular motif, and each nucleotide within the fully modified region may comprise the same single modified sugar motif, referred to herein as a uniformly modified glycomolecular motif, or may comprise two or more different types of modified sugar motifs. Specifically, the modified oligonucleotide may comprise a modified bicyclic sugar motif, such as a sugar substituent bridging 4' and 2', a modified non-bicyclic sugar motif, such as a 2'-MOE sugar motif, or may comprise at least a modified bicyclic sugar motif and at least a modified non-bicyclic sugar motif.

[0091] In a specific instance, the modified oligonucleotide may comprise a region having a nicked polymer motif defined by two outer regions or "wings" and a central or inner region or "gap," wherein the central gap region is capable of recruiting RNase H by complementary binding to a target nucleic acid. The three regions of the nicked polymer motif (5'-wing, gap, and 3'-wing) form a continuous nucleoside sequence, wherein at least a portion of the sugar moiety of the nucleoside in each wing may differ from at least a portion of the sugar moiety of the nucleoside in the gap.

[0092] The term "notched polymer" refers to an oligonucleotide comprising an internal region containing multiple nucleosides supporting RNase H cleavage and located between an external region containing one or more nucleosides, wherein the nucleosides contained in the internal region are chemically distinct from the one or more nucleosides contained in the external region. The internal region may be referred to as the "notch," and the external region as the "wing." Here, the lengths (number of nucleosides) of the three regions in the notched polymer can be provided using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the notch] - [number of nucleosides in the 3'-wing]. For example, a 5-10-5 notched polymer contains 5 linked nucleosides in each wing and 10 linked nucleosides in the notch. In the case of chemically modified oligonucleotides in the nomenclature, such as the 5-10-5 MOE notched polymer, it consists of 5 modified nucleosides in the 5'-wing, 10 linked deoxynucleosides in the notch, and 5 linked MOE nucleosides in the 3'-wing. In specific embodiments, the modified oligonucleotides may include 5-10-5 MOE-negative polymers, 3-10-3 BNA-negative polymers, 3-10-3 cEt-negative polymers, or 3-10-3 LNA-negative polymers, etc.

[0093] The modified oligonucleotide may include a 5'-wing region with 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides; a central gap region with 6 to 23, 6 to 22, 6 to 21, 6 to 20, 6 to 19, 6 to 18, 6 to 17, 6 to 16, 6 to 15, 6 to 14, 6 to 13, 6 to 12, 6 to 11, or 6 to 10 linked central nucleosides; and a 3'-wing region with 1 to 10, 1 to 9, 1 to 8, 1 to 7, or 1 to 6 linked modified nucleosides.

[0094] In a specific example, the modified oligonucleotide may contain at least one modification selected from the group consisting of a modified sugar motif, a modified internucleotide bond, and a modified nucleobase in three regions (5'-wing, 3'-wing) of the nicked polymer motif. Specifically, one or more modified nucleobases (e.g., 5-mC (5'-methylcytosine)) may be included in the modified oligonucleotide, primarily in the nicked region but also in the wing region. Internucleotide bonds (e.g., PS and PO bonds) may each be included once or multiple times in all internucleotide bonds of the modified oligonucleotide; for example, the total bond may be included as a PS bond or as a mixture of PS and PO bonds. PO bonds may be included one or more in the total bond of the modified oligonucleotide, primarily in the wing region but also in the nicked region. The modified sugar motif may be included primarily in one or more amounts in all nucleotides contained in the oligonucleotide, and specifically, non-bicyclic sugar motifs may be included in the wing region, and bicyclic sugar motifs may be primarily included in the wing region but also in the nicked region. As specific examples, (i) the modified oligonucleotide may have the following structure: 5-mC is contained in the notch region, all bonds are PS bonds, and the non-bicyclic sugar portion is contained in the wing region; (ii) the modified oligonucleotide may have the following structure: 5-mC may be contained in the notch region, PS bonds and PO bonds are each contained in one or more amounts, and the non-bicyclic sugar portion is contained in the wing region, for example, 5-mC may be contained in the notch region, all bonds in the notch region are PS bonds, PO bonds and PS bonds are each contained in one or more amounts in the wing region, and the non-bicyclic sugar portion may be contained in the wing region; or (iii) the modified oligonucleotide may have the following structure: 5-mC is mainly contained in the notch region but also in the wing region, PS bonds are contained throughout the notch region, PS bonds, PO bonds, or a mixture of PS and PO bonds are contained in the wing region, and the bicyclic sugar portion is mainly contained in the wing region but may also be contained in the notch region. However, the modified portions included in such modified oligonucleotides, selected from the group consisting of modified sugar moieties, unmodified or modified nucleoside internucleotides, and modified nucleobases, are provided as illustrative examples only, and the invention is not limited thereto.

[0095] For example, the modified sugar moiety may comprise: a modified non-bicyclic sugar moiety selected from those comprising a 2'-MOE sugar moiety and a 2'-OMe sugar moiety; and one or more types comprising a modified bicyclic sugar moiety comprising a 2',4'-bridge selected from O-CH2- and -O-CH(CH3)-. The modified oligomer may comprise a modified non-bicyclic sugar moiety and a modified bicyclic sugar moiety, specifically comprising at least one modified nucleoside containing a modified bicyclic sugar moiety having a 2'-4' bridge and at least one modified nucleoside containing a modified non-bicyclic sugar moiety. In a specific example, the 5'-wing and / or 3'-wing may comprise at least one modified bicyclic sugar moiety and at least one modified non-bicyclic sugar moiety.

[0096] More specifically, when comprising a 5'-wing region composed of 1 to 6 linked 5'-region nucleosides; a central gap region composed of 6 to 10 linked central region nucleosides; and a 3'-wing region composed of 1 to 6 linked 3'-region nucleosides, the 5'-wing region and / or the 3'-wing region may contain at least one modified bicyclic sugar moiety. For example, at least one modified bicyclic sugar moiety may be contained in the 5'-wing region and / or the 3'-wing region, and the remaining nucleosides may contain modified non-bicyclic sugar moieties, as described in detail in patent documents such as WO2016 / 127002A1, WO2016 / 126995A1, and US2018 / 0023081A1.

[0097] In specific examples, when the 5'-wing region comprises 1 to 7 linked 5'-region nucleotides; a central gap region comprised of 6 to 10 linked central region nucleotides; and a 3'-wing region comprised of 1 to 7 linked 3'-region nucleotides, each of the 5'-wing and 3'-wing regions may independently contain one or more modified bicyclic sugar moieties. Specifically, the 5'-wing region may be selected from the group consisting of: L, LL, LDL, LLL, LLLL, LLDL, LDLL, LDDL, LLDD, LLLLL, LLLLDL, LLLLL, LDLLL, LLDDL, LDDLL, LLDLD, LLDLL, LDLLD, LLDLDL, LLLDLL, LLDDLL, LDLLLL, LDLLDL, LDLLDL, LD LDLL, LDLDDL, LDDLLL, LDDLDL, LDDDLL, LLLLLLDL, LLLDLL, LLDLLLL, LLLLLLL, LLLLDDDL, LLDDLDL, LLDDLL, LDDLLLL, LDLLLDL, LDDLL, LDDLL, LDDLL, LDDLL, LDLLLDL, LDDLL and LDDDLLL; the 3'-wing region can be optionally composed of the following groups: L, LL, LDL, LLL, LLLL, LLDL, LDLL, LDDL, LLDD, LLLL, LLLLL, LLLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LLDDL, LDD LLLLLL, LLLLLDL, LLLDLL, LLLLLLL, LLLLLLL, LLLDDL, LDLDLL, LDDDLL, LLLDLL, LDLLLL, LLLLLL, LLDDLDL, LLDDLL, LDDLLLL, LDLLLDL, LDDLLL, LDDDLLL, LLDDDDL and LLDDL; where 'D' in the moiety sequence represents the 2'-deoxyribosyl sugar moiety and 'L' represents the LNA sugar moiety.

[0098] Specifically, when the oligonucleotide compound of the present invention may contain a specific bicyclic nucleoside (e.g., LNA or cEt) as a modified sugar moiety, it may be an LNA-modified oligonucleotide or a cEt-modified oligonucleotide, and may contain one or more nucleoside bonds selected from the group consisting of thiophosphate nucleoside bonds, methanesulfonylaminophosphate nucleoside bonds and phosphodiester nucleoside bonds, specifically thiophosphate nucleoside bonds (PS bonds) and / or phosphodiester nucleoside bonds (PO bonds).

[0099] Furthermore, LNA-modified oligonucleotides or cEt-modified oligonucleotides may contain modified nucleotides and / or unmodified nucleotides. Examples of oligomers containing a specific bicyclic nucleotide (e.g., LNA or cEt) as a modified sugar moiety can be a modified sugar moiety that contains 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides within the nucleic acid sequences of SEQ ID No: 1 to 439 (particularly SEQ No: 1 to 19, SEQ No: 27 to 36, SEQ ID No: 68 to 81, SEQ ID No: 396 to 403, or SEQ ID No: 414 to 417); or more specifically, sequences containing SEQ ID No: 1 to 439. NO: A sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleobases within a nucleic acid sequence of 13, 14, 106, 409 or 416; wherein the modified sugar portion in the nucleic acid sequence may be a bicyclic sugar portion, and the bicyclic sugar portion may be present in the 5'-wing region and the 3'-wing region.

[0100] The bicyclic sugar moiety present in the 5'-wing region can be independently selected from the group consisting of: LLLLLL, LLLLL, LLLDLL, LLLDL, LLLDLLL, LLLDLL, LLDDLL, LLDDL, LDLLLL, LDLLL, LDLLDL, LDLDLL, LLDLDLD, LLDLDDL, LDLDLLL, LDLDLLD, LDLDL, LDDDLL, and LDDDL, and the bicyclic sugar moiety in the 3'-wing region can be independently selected from the group consisting of: LLLLLL, LLLDLL, LLDDLL, LDLLLL, LDLDLL, LDDDLL, LLLLL, LDLLL, LDLLL, LLL, LLL, and LL. As specific examples, examples of LNA-modified oligonucleotides are shown in Table 17, but are not limited thereto. The sequences in Table 17 are shown in the 5' to 3' orientation, and 'D' in the sugar moiety formula represents the 2'-deoxyribosyl sugar moiety, and 'L' represents the LNA sugar moiety.

[0101] In specific embodiments, the modified oligonucleotide comprises one or more conjugated moieties or conjugated groups. In specific examples, the conjugated groups modify one or more properties of the oligonucleotide molecule, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In one example, the conjugated moieties provide a fluorescent group or reporter group capable of enabling novel properties of the molecule (e.g., detection of the molecule).

[0102] The conjugated portion includes, but is not limited to, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin portions, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0103] In some embodiments, the conjugating group comprises a conjugating linker that links the conjugated portion to the remainder of the modified oligonucleotide. In some instances, the conjugating linker is a single chemical bond (i.e., the conjugated portion is linked to the remainder of the modified oligonucleotide via a single bond through the conjugating linker). In some instances, the conjugating linker comprises an oligomer of a chain structure, such as a hydrocarbon chain, or a repeating unit, such as ethylene glycol, nucleoside, or amino acid unit. In some instances, the conjugating linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In such instances, the conjugating linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In some instances, the conjugating linker comprising the above-described conjugating linker is a bifunctional linker, such as those known in the art for linking conjugating groups to oligomeric compounds (e.g., the oligonucleotides provided herein).

[0104] In some embodiments, the conjugated group or conjugated moiety may preferably be cleaved from the remainder of the modified oligonucleotide. For example, in some cases, oligomeric compounds (including antisense agents or oligomeric compounds as part of which) or modified oligonucleotides containing a particular conjugated moiety are better taken up by a particular cell type. Once the compound is taken up by the cell, it is preferred that the conjugated group be cleaved to release the unconjugated oligonucleotide. Thus, certain conjugated moieties may typically contain one or more cleavable moieties within the conjugated linker. In some instances, the cleavable moiety may be an atomic group having at least one cleavable bond. In some instances, the cleavable moiety comprises atomic groups having 1, 2, 3, 4, or more than 4 cleavable bonds. In some instances, the cleavable moiety is selectively cleaved within the cell or intracellular compartment (e.g., lysosome). In some instances, the cleavable moiety is selectively cleaved by an endogenous enzyme (e.g., a nuclease).

[0105] In specific instances, the conjugation group includes a cell-targeting conjugation portion. In some instances, each ligand of the cell-targeting portion has an affinity for at least one type of receptor on the target cell. In some instances, each ligand has an affinity for at least one type of receptor on the surface of mammalian lung cells. Each ligand of the cell-targeting portion is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative.

[0106] One embodiment of the present invention relates to a pharmaceutical composition for the prevention, improvement or treatment of diseases associated with increased activity and / or expression of mTOR, comprising an agent capable of mediating RNA interference (RNAi) against mTOR, or to a method for the prevention, improvement or treatment of diseases associated with increased activity and / or expression of mTOR, comprising administering to a subject or individual in need an agent capable of mediating RNA interference (RNAi) against mTOR.

[0107] Another embodiment of the present invention provides a composition for reducing human mTOR protein synthesis or human mTOR mRNA levels in human subjects with increased human mTOR gene expression levels. Optionally, the present invention provides a method for reducing mTOR protein synthesis or human mTOR mRNA levels in human subjects with increased mTOR gene expression levels.

[0108] In specific examples, the method according to the invention includes administering an RNAi agent to a subject and detecting or quantifying the amount of mTOR RNA or mTOR protein in the subject's cells or biological fluid. In some examples, the method includes detecting or quantifying a first amount of mTOR RNA or mTOR protein in a first biological sample obtained before administration; detecting or quantifying a second amount of mTOR RNA or mTOR protein in a second biological sample obtained after administration; and comparing the first amount with the second amount to detect or quantify a decrease in mTOR RNA or mTOR protein.

[0109] The level of MTOR nucleic acid or the inhibition of its expression can be determined by various methods known in the art. For example, the level of the target nucleic acid can be quantified by, for example, Northern blotting, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. Antisense inhibition of MTOR nucleic acid can be assessed by measuring the MTOR protein level. The MTOR protein level can be assessed or quantified by various methods well known in the art, such as immunoprecipitation, Western blotting, enzyme-linked immunosorbent assay (ELISA), quantitative protein assay, protein activity assay (e.g., caspase activity assay), immunohistochemistry, immunocytochemistry, or fluorescence activated cell sorting (FACS).

[0110] In specific instances, the subject or patient to be treated may have already received one or more therapies selected from a group consisting of drug therapy, radiation therapy, and surgical therapy prior to treatment.

[0111] In specific examples, this document describes pharmaceutical compositions comprising at least one oligomeric compound. In some examples, each of the one or more oligomeric compounds may be a modified oligonucleotide. In some examples, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some examples, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In some examples, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In some examples, the excipients may be selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0112] In specific instances, pharmaceutical compositions containing oligomeric compounds may contain any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester.

[0113] In specific instances, the pharmaceutical composition includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions.

[0114] In some instances, the pharmaceutical composition may be formulated for oral administration. In some instances, the pharmaceutical composition may be formulated for buccal administration. In some instances, the pharmaceutical composition may be formulated for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some of these instances, the pharmaceutical composition comprises a carrier and is formulated as an aqueous solution, such as water or a physiologically compatible buffer, such as phosphate-buffered saline (PBS), artificial CSF (aCSF), Hank's solution, Ringer's solution, or physiological saline buffer. In some instances, other components are included (e.g., components that aid in solubility or act as preservatives). In some instances, an injectable suspension is prepared using suitable liquid carriers and suspending agents. Some injectable pharmaceutical compositions are present in unit dosage forms, such as in ampoules or multi-dose containers. Some injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0115] The formulation and method of a pharmaceutical composition depend on several criteria, including but not limited to the route of administration, the severity of the disease, or the dosage to be administered.

[0116] In some instances, oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and formulation methods of pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, the severity of the disease, or the dose to be administered.

[0117] The RNAi formulation according to the invention can be administered orally or parenterally, and parenterally administration refers to administration by injection (e.g., bolus injection) or infusion. Parenterally administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intraventricular administration.

[0118] The effects of the invention

[0119] This invention relates to a compound for regulating the expression level and / or activity of the mTOR gene, and compositions comprising the compound, which can be used to prevent, alleviate or treat mTOR-related diseases, disorders and conditions. Attached Figure Description

[0120] Figure 1 Western blot analysis of MTOR protein, p-4EBP1, 4EBP1, and α-tubulin in neurons carrying the MTOR p.Leu2427Pro mutation is shown after treatment with modified oligonucleotides (574107, 574109, and 574007) complementary to human MTOR at specified concentrations. Cells treated with PBS and cells treated with 50 μM of untargeted oligonucleotides served as negative controls.

[0121] Figure 2 The weighted average firing rate is shown as one of the analytical parameters obtained by a multi-electrode array (MEA) system in neurons carrying the MTOR p.Leu2427Pro mutation after treatment with modified oligonucleotides (574107, 574109, and 574007) complementary to human MTOR. (***, p < 0.001; ****, p < 0.0001; two-way ANOVA with Tukey post-hoc test)

[0122] Figure 3The burst frequencies, as one of the analytical parameters obtained by a multi-electrode array (MEA) system, are shown in neurons carrying the MTOR p.Leu2427Pro mutation after treatment with modified oligonucleotides (574107, 574109, and 574007) complementary to human MTOR. (**, p < 0.01; ****, p < 0.0001; two-way ANOVA with Tukey post-hoc test)

[0123] Figure 4 The results show the results of soma size analysis in neurons carrying the MTOR p.Leu2427Pro mutation after treatment with modified oligonucleotides (574107, 574109, and 574007) complementary to the human MTOR nucleic acid sequence and subsequent immunostaining with the neuronal marker MAP2. (*, p < 0.05; ##, p < 0.01; *** or ###, p < 0.001; ####, p < 0.0001; asterisk (*) indicates comparison with the PBS-treated group, hash (#) indicates comparison with the non-targeted oligonucleotide-treated group; one-way ANOVA with Tukey post-hoc test) Detailed Implementation

[0124] The invention will be described in more detail through the following embodiments, but the scope of the invention is not intended to be limited to the following embodiments.

[0125] Example 1: Inhibition of mTOR in SNB-19 cells via 5-10-5 2'-MOE notched polymer (single dose)

[0126] Oligonucleotides modified with 5-10-5 2'-MOE nick polymers targeting human mTOR RNA were designed, and their in vitro effects on mTOR mRNA were tested. The modified oligonucleotides in the table below are 5-10-5 2'-MOE nick polymers with phosphate thioester (PS) nucleotide internucleotide bonds (PS bonds) and without modified bases. Each nick polymer is 20 nucleotides in length, with the central nick region consisting of ten (10) 2'-deoxy nucleotides, and the 3' and 5' wings each consisting of five (5) 2'-MOE nucleotides. The glycosyl inscription of the nick polymer (from 5' to 3') is eeeeeddddddddddeeeee; where 'd' represents the 2'-deoxyribosyl sugar moiety and 'e' represents the 2'-MOE sugar moiety.

[0127] SNB-19 cells cultured at a density of 7,000 cells / well were treated with 5 μM of modified oligonucleotides via free uptake. Total RNA was extracted from the cells 24 hours after treatment. The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. Human RPL 13 primer-probe set (forward primer sequence: ATTCTGTGGATCCGAGGAGG (SEQ ID NO: 467), reverse primer sequence: GCCAGTTTCAGTTCTTCAGCAGA (SEQ ID NO: 468), probe sequence: AGTACCGCTCCAAACTCATCCTCTTCC (SEQ ID NO: 469)) and human MTOR primer-probe set 1 (forward primer sequence: GCCTTCACAGATACCCAGTAT (SEQ ID NO: 470), reverse primer sequence: CACGCGAGGCAAATAGACCT (SEQ ID NO: 471), probe sequence: TGTCAAGAAGGAGAAGGAACGTACAGCG (SEQ ID NO: 472)) or human MTOR primer-probe set 3 (forward primer sequence: GAGATCCAGGCTACCTGGT (SEQ ID NO: 473), reverse primer sequence: GGTGGAGTTGACCCCATTC (SEQ ID NO: 469)) were used. NO: 474), probe sequence: ATGGACACCAACAAGGACGACCCAGA (SEQ ID NO: 475) to determine mRNA expression level.

[0128] The analysis results represent the relative expression levels of MTOR mRNA compared to untreated control cells. Each nick polymer listed in the table below targets the human MTOR transcript sequence disclosed in this paper (Ensembl transcript ID: ENST00000361445.9). Tables 7 through 10 below show the expression levels of human MTOR mRNA after treatment with oligonucleotides modified with the 5-10-5 2'-MOE nick polymer.

[0129] [Table 7]

[0130]

[0131]

[0132]

[0133] [Table 8]

[0134]

[0135]

[0136]

[0137] [Table 9]

[0138]

[0139]

[0140]

[0141] [Table 10]

[0142]

[0143]

[0144]

[0145] Example 2: Inhibition of mTOR in SNB-19 cells via 5-10-5 2'-MOE notched polymer (multiple doses)

[0146] The oligonucleotides modified with the 5-10-5 2'-MOE nick polymer prepared in Example 1 were tested in SNB-19 cells at various doses.

[0147] SNB-19 cells cultured at a density of 10,000 cells / well were treated with modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM for free uptake. Total RNA was extracted from the cells 24 hours after treatment. The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and the human mTOR primer-probe set 3 used in Example 1. The results represent the relative expression level of mTOR mRNA compared to untreated control cells.

[0148] Using Absolute IC in GraphPad Prism version 10 (GraphPad Software) 50 Formula for calculating IC 50 Values. The table below shows the expression levels of human mTOR mRNA after treatment with oligonucleotides modified with 5-10-5 2'-MOE nick polymer. The results in Table 11 show the relative mTOR mRNA levels of the modified oligonucleotides at 15 μM and the corresponding IC50 values. 50 value.

[0149] [Table 11]

[0150]

[0151] Example 3: Inhibition of mTOR in SNB-19 cells via oligonucleotides with mixed skeletal chemistry (single dose)

[0152] Based on the oligonucleotide sequences disclosed in the above experiments, additional nicked polymers were designed. The oligonucleotides were designed as 5-10-5 2'-MOE. The 5-10-5 2'-MOE nicked polymers were 20 nucleotides in length, with a central nick consisting of 10 2'-deoxyribonucleosides, flanked by wing segments each containing five (5) nucleotides in the 5' and 3' directions. Each nucleotide in the 5' and 3' wing segments was 2'-MOE modified. The internucleotide bonds throughout each nicked polymer were phosphodiester or thiophosphate bonds. The internucleotide bonds of each oligonucleotide are indicated in the backbone column, where 'o' represents a phosphodiester bond and 's' represents a thiophosphate bond. All cytosine residues in each nicked polymer were 5-methylcytosine. Each nicked polymer listed in the table below targets the human MTOR transcript sequence disclosed herein (Ensembl transcript ID: ENST00000361445.9).

[0153] In Table 12 below, SEQ ID NO corresponds to the nucleic acid sequences listed in Tables 1 to 4, provided that in the corresponding nucleic acid sequences in Tables 1 to 4, the cytosine (C) residue is replaced by 5-methylcytosine, and the internucleotide bond contains a PO bond instead of a PS bond.

[0154] [Table 12]

[0155]

[0156]

[0157]

[0158]

[0159] SNB-19 cells cultured at a density of 7,000 cells / well were treated with 5 μM of modified oligonucleotides via free uptake. Total RNA was extracted from the cells 24 hours after treatment. The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was measured by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and human mTOR primer-probe set 3 described in Example 1. The results represent the relative expression level of human mTOR mRNA compared to untreated control cells.

[0160] [Table 13]

[0161]

[0162] Example 4: Inhibition of mTOR in A-431 cells by a single dose of a 5-10-5 MOE notched polymer with mixed skeletal chemistry.

[0163] A-431 cells cultured at a density of 7,000 cells / well were treated with 5 μM modified oligonucleotides via free uptake. Total RNA was extracted from the cells 24 hours after treatment. The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA expression level was determined using the human RPL 13 primer-probe set and human mTOR primer-probe set 3 described in Example 1. The results represent the relative expression level of human mTOR mRNA compared to untreated control cells.

[0164] [Table 14]

[0165]

[0166] Example 5: Inhibition of mTOR in SNB-19 cells via a 5-10-5 MOE notched polymer with mixed skeletal chemistry (multiple doses)

[0167] Oligonucleotides modified with the 5-10-5 2'-MOE nick polymer having the hybrid backbone disclosed in the above experiments were tested in SNB-19 cells at various doses. SNB-19 cells cultured at a density of 10,000 cells / well were treated with the modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM via free uptake. Total RNA was extracted from the cells 24 hours after treatment.

[0168] The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and human mTOR primer-probe set 3 described in Example 1 above.

[0169] The results represent the relative mTOR mRNA levels compared to untreated control cells. The absolute IC50 levels were determined using GraphPadPrism version 10 (GraphPad Software). 50 Formula for calculating IC 50 The results in Table 15 show the relative mTOR mRNA levels of the modified oligonucleotides at 15 μM and the corresponding IC50 values.50 value.

[0170] [Table 15]

[0171]

[0172]

[0173] Example 6: Inhibition of mTOR in A-431 cells via a 5-10-5 2'-MOE notched polymer with mixed skeletal chemistry (multiple doses)

[0174] Oligonucleotides modified with the 5-10-5 2'-MOE nick polymer having the hybrid backbone disclosed in the above experiments were tested in A-431 cells at various concentrations. A-431 cells cultured at a density of 10,000 cells / well were treated with modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM via free uptake. Total RNA was extracted from the cells 24 hours after treatment.

[0175] The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and human mTOR primer-probe set 3 described in Example 1 above.

[0176] The results in Table 16 show the relative mTOR mRNA levels at 15 μM and the corresponding IC50 values ​​compared to untreated control cells. 50 Value. Using the absolute IC from GraphPad Prism version 10 (GraphPad Software). 50 Formula for calculating IC 50 value.

[0177] [Table 16]

[0178]

[0179]

[0180] Example 7: Inhibition of mTOR in SNB-19 cells via LNA oligonucleotides (single dose)

[0181] LNA-modified oligonucleotides targeting human mTOR RNA were designed, and their in vitro effects on mTOR mRNA were tested. The modified oligonucleotides in Table 17 below contain phosphate-thioester (PS) nucleoside bonds (PS bonds) and do not contain modified bases. The sequences in Table 17 are shown in 5' to 3' orientations, with 'D' indicating the 2'-deoxyribosyl sugar moiety and 'L' indicating the LNA sugar moiety.

[0182] [Table 17]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188] SNB-19 cells cultured at a density of 7,000 cells / well were treated with 5 μM of modified oligonucleotides via free uptake. Total RNA was extracted from the cells 24 hours after treatment. The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and the human mTOR primer-probe set 3 used in Example 1.

[0189] The analysis results represent the relative expression levels of MTOR mRNA compared to untreated control cells. The table below lists the nick polymers that target the human MTOR transcript disclosed in this paper (Ensembl transcript ID: ENST00000361445.9). Table 18 below shows the expression levels of human MTOR mRNA after treatment with LNA-modified oligonucleotides.

[0190] [Table 18]

[0191]

[0192]

[0193] Example 8: Inhibition of mTOR in SH-SY5Y cells by LNA oligonucleotides (single dose)

[0194] SH-SY5Y cells cultured at a density of 40,000 cells / well were transfected with 5 μM modified oligonucleotides using electroporation. Total RNA was extracted from the cells 24 hours after treatment.

[0195] The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and the human mTOR primer-probe set 3 used in Example 1 above.

[0196] The analysis results represent the relative expression levels of MTOR mRNA compared to untreated control cells. The nick polymers listed in the table below target the human MTOR transcripts disclosed in this paper (Ensembl transcript ID: ENST00000361445.9). Table 19 below shows the expression levels of human MTOR mRNA after treatment with LNA-modified oligonucleotides.

[0197] [Table 19]

[0198]

[0199]

[0200] Example 9: Inhibition of mTOR in SNB-19 cells via LNA oligonucleotides (multiple doses)

[0201] The LNA-modified oligonucleotides prepared in Example 7 were tested in SNB-19 cells at various concentrations. SNB-19 cells cultured at a density of 10,000 cells / well were treated with freely available uptake of the modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM. Total RNA was extracted from the cells 24 hours after treatment. The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. mRNA levels were determined using the human RPL 13 primer-probe set (forward primer sequence: ATTCTGTGGATCCGAGGAGG, reverse primer sequence: GCCAGTTTCAGTTCTTCAGCAGA, probe sequence: AGTACCGCTCCAAACTCATCCTCTTCC) and human MTOR primer-probe set 3 (forward primer sequence: GAGATCCAGGCTACCTGGT, reverse primer sequence: GGTGGAGTTGACCCCATTC, probe sequence: ATGGACACCAACAAGGACGACCCAGA) used in Example 1 above.

[0202] The results in Table 20 show the relative mTOR mRNA levels of the modified oligonucleotides compared to untreated control cells at 15 μM and the corresponding IC50 values. 50Value. Using the absolute IC in GraphPad Prism version 10 (GraphPad Software). 50 Formula for calculating IC 50 value.

[0203] [Table 20]

[0204]

[0205] Example 10: Inhibition of intracellular mTOR by siRNA and C16-siRNA (multiple doses)

[0206] It is well known that lipophilic moieties improve the intracellular uptake of oligonucleotides and siRNAs and their delivery to various organs, including the central nervous system (CNS). SNB-19 cells and SK-N-AS cells were treated with siRNAs targeting human mTOR RNA (with C16 (palmitic acid) conjugated to the sense strand of each siRNA), and the expression level of mTOR mRNA was measured.

[0207] In Table 21 below, the sense strands of double-stranded RNAs D-598701, D-598702, D-598703, and D-598704 do not contain C16 conjugates, while the sense strands of D-598705, D-598706, D-598707, and D-598708 do contain C16 conjugates. The target nucleotide sequences (Ensembl transcript ID No. ENST00000361445.9) of the human MTOR mRNAs complementary to each siRNA are shown in the target sequence column of Table 14 below, with the start and end points indicating the nucleotide positions within the human MTOR transcript sequence (Ensembl transcript ID No. ENST00000361445.9) provided by Ensembl.

[0208] [Table 21]

[0209]

[0210] SNB-19 and SK-N-AS cells cultured at densities of 8,000 cells / well and 20,000 cells / well, respectively, were treated with Lipofectamine. TM RNAiMAX transfection reagent (Thermo Fisher Scientific) was used for transfection with unmodified siRNA and C16-conjugated siRNA at concentrations of 0.3, 3, and 30 nM. Total RNA was extracted from the cells 24 hours after treatment.

[0211] The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA expression level was determined using the human RPL 13 primer-probe set and the human mTOR primer-probe set 3 used in Example 1 above.

[0212] [Table 22]

[0213]

[0214] The experimental results showed the relative expression levels of MTOR mRNA compared to untreated control cells. As shown in Table 22, MTOR mRNA levels decreased in a dose-dependent manner in cells treated with modified siRNA.

[0215] Example 11: Tolerability of modified oligonucleotides complementary to human mTOR in mice at a dose of 600 μg

[0216] The modified oligonucleotides used in this experiment had the mixed backbone prepared in Example 3, wherein the cytosine residues were modified to 5-mC and were 5-10-5 2'-MOE nick polymers. The nick polymers were 20 nucleotides in length, with the central nick region consisting of ten (10) 2'-deoxy nucleotides and the 3' and 5' wings each consisting of five (5) 2'-MOE nucleotides. Tolerance to the oligonucleotides was assessed by administration to mice.

[0217] Specifically, wild-type C57 / Bl6 mice were each administered a single dose of 600 μg of the oligonucleotides listed in the table below via intraventricular administration. Each treatment group consisted of three mice. Mice administered DPBS served as negative controls. Three hours after administration, mice were assessed according to seven criteria: (1) whether the mouse was bright, alert, and responsive; (2) whether the mouse stood or arched its back without stimulation; (3) whether the mouse exhibited any movement without stimulation; (4) whether the mouse exhibited forward movement when lifted; (5) whether the mouse exhibited any movement when lifted; (6) whether the mouse responded to tail pinching; and (7) whether the mouse exhibited regular breathing. For each criterion, a sub-score of 0 was assigned if the mouse exhibited normal behavior for that criterion, and a sub-score of 1 otherwise. The sub-scores of all seven criteria for each mouse were then summed to obtain a Functional Observation Combination (FOB) score, and the FOB scores were averaged within each treatment group. The results are shown in Table 23 below. “nd” indicates that no measurement was obtained due to the death of the subject receiving the treatment.

[0218] [Table 23]

[0219]

[0220] Brain tissue collected at autopsy 8 weeks after intraventricular ventricle (ICV) administration was used to determine the mRNA levels of Iba1 (a microglia marker) and Gfap (an astrocyte marker) in the cerebellum. Since both Iba1 and Gfap are CNS inflammatory markers, elevated levels of either marker indicated low tolerance to oligonucleotides in mice. The mRNA expression levels of Iba1 and Gfap genes relative to the housekeeping gene Hprt were determined by quantitative real-time PCR. mRNA levels were measured using mouse Hprt primers (forward primer sequence: TCAGTCAAACGGGGGACATAAA (SEQ ID NO: 476); reverse primer sequence: GGGGCTGTACTGCTTAACCAG (SEQ ID NO: 477)), Gfap primers (forward primer sequence: AACCTGGCTGCGTATAGA (SEQ ID NO: 478); reverse primer sequence: CGAACTTCCTCCTCATAGAT (SEQ ID NO: 479)), and Iba1 primers (forward primer sequence: ATCAACAAGCAATTCCTC (SEQ ID NO: 480); reverse primer sequence: ATATCTCCATTTCCATTCAG (SEQ ID NO: 481)). "nd" indicates that no measurement was obtained because the subject died before the measurement.

[0221] [Table 24]

[0222]

[0223] Example 12: Tolerability of modified oligonucleotides complementary to human mTOR in rats at a dose of 3 mg

[0224] Tolerance to the modified oligonucleotides described above was assessed by testing in rats. Each Sprague-Dawley rat received a single intrathecal injection of 3 mg of the oligonucleotides listed in the table below. Each treatment group consisted of three rats, and the group receiving PBS served as a negative control. Gait and alertness were assessed in each rat at 3 hours and 8 weeks post-administration.

[0225] For gait assessment, each animal was scored according to the following criteria: ataxia or excessive swaying gait -2 points; dragging limbs or limb abduction -1 point; normal gait with all four limbs supporting the body -0 points; tiptoeing -1 point; hunched back walking -2 points. For alertness assessment, each animal was scored according to the following criteria: anesthesia or coma -1 point; significantly reduced alertness (only slight head or body movements) -2 points; reduced alertness (with periods of stillness and slight exploratory walking) -3 points; normal state (with alert and exploratory walking behavior) -4 points; increased alertness (with excitement, tension, sudden sprinting or stiffness) -5 points; and significantly increased alertness (with high alertness and excitement and running around) -6 points. The scores for gait and alertness assessments for each rat were summed and averaged within each treatment group. The results are shown in Table 25.

[0226] [Table 25]

[0227]

[0228] Brain tissue collected at necropsy 8 weeks after intrathecal (IT) administration was used to determine the mRNA levels of Iba1 (a microglia marker) and Gfap (an astrocyte marker) in the cerebral cortex and cerebellum. Since both Iba1 and Gfap are CNS inflammatory markers, elevated levels of either marker indicated low tolerance to oligonucleotides in rats. The mRNA expression levels of Iba1 and Gfap genes relative to the housekeeping gene Gapdh were determined by quantitative real-time PCR. mRNA levels were measured using the rat Gapdh primer-probe set (forward primer sequence: TGCTCCTCCCTGTTCTAGAGACA (SEQ No. 482), reverse primer sequence: CACCGACCTTCACCATCTTGT (SEQ No. 483), probe sequence: CCGCATCTTCTTGTGCAGTGCCAG (SEQ No. 484)), the Gfap primer-probe set (Thermo Fisher, Assay ID Rn01253033_m1), and the rat Iba1 primer-probe set (forward primer sequence: AGGAGAAAAACAAAGAACACCAGAA (SEQ No. 485), reverse primer sequence: CAATTAGGGCAACTCAGAAATAGCT (SEQ No. 486), probe sequence: CCAACTGGTCCCCCAGCCAAGA (SEQ No. 487)). The results are shown in Table 26 below.

[0229] [Table 26]

[0230]

[0231] Example 13: Inhibition of mTOR in SH-SY5Y cells by a 5-10-5 MOE notched polymer with mixed skeletal chemistry (multiple doses):

[0232] The modified oligonucleotides used in this example were tested in SH-SY5Y human cells at various concentrations. Cells were seeded at a density of 3,700 cells per well and transfected by electroporation with modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM. Total RNA was extracted from the cells 24 hours after treatment.

[0233] The mRNA expression level of the mTOR gene relative to RPL 13 (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human RPL 13 primer-probe set and the human mTOR primer-probe set 3 used in Example 1.

[0234] The results in Table 27 show the relative mTOR mRNA levels at 15 μM and the corresponding IC50 levels compared to untreated control cells. 50 Value. Using Prism10 software, "Absolute IC" 50 Formula for calculating IC 50 .

[0235] [Table 27]

[0236]

[0237] Example 14: Inhibition of mTOR in human neurons via a 5-10-5 MOE notched polymer with mixed skeletal chemistry (multiple doses)

[0238] The effects of selected modified oligonucleotides complementary to human mTOR on mTOR mRNA levels in human neurons via free uptake were tested in vitro. Human embryonic stem cell (ESC)-derived neurons were seeded at a density of 30,000 cells per well. Cultured human neurons were treated for 3 days with modified oligonucleotides at concentrations of 0.39, 0.78, 1.56, 3.12, 6.25, 12.5, 25, and 50 μM. After 3 days, the culture medium was replaced with a medium without the modified oligonucleotides, and total RNA was extracted from the cells after 6 days.

[0239] The mRNA expression level of the MTOR gene relative to HPRT (one of the housekeeping genes) was determined by quantitative real-time PCR. The mRNA level was determined using the human HPRT primer-probe set and human MTOR primer-probe set 1 used in Example 1 above.

[0240] The results in Table 28 show the relative mTOR mRNA levels at 15 μM and the corresponding IC50 levels compared to untreated control cells. 50 Value. Using Prism10 software, "Absolute IC" 50 Formula for calculating IC 50 .

[0241] [Table 28]

[0242]

[0243] Example 15: Inhibition of mTOR expression and activity in human neurons carrying mTOR mutations via modified oligonucleotides complementary to human mTOR

[0244] To determine whether modified oligonucleotides complementary to human mTOR inhibit mTOR expression and activity in an overactivated mTOR signaling pathway, human embryonic stem cell (ESC)-derived neurons carrying the mTOR p.Leu2427Pro mutation found in patients with FCD type II were used. Human ESCs carrying the mTOR p.Leu2427Pro (c.7280T>C) mutation underwent genome editing using CRISPR / Cas9 technology to differentiate into neurons and were seeded at a density of 400,000 cells / well. Cultured human neurons were treated for 3 days with modified oligonucleotides (compounds ID574120, 574007, 574107, and 574109 in Table 30 below) at concentrations of 5 μM, 10 μM, and 50 μM. After 3 days, the culture medium was replaced with a medium without oligonucleotides, and proteins were extracted from the cells 21 days after the medium replacement. The non-targeting oligonucleotide compound ID 574120 listed in Table 29 was used as a negative control.

[0245] [Table 29]

[0246]

[0247] like Figure 1As shown, the expression level of MTOR protein (Cell Signaling Technology, catalog number 2983S) relative to the housekeeping protein α-tubulin (Cell Signaling Technology, catalog number 3873S) was analyzed by Western blotting to assess MTOR expression. The expression level of p-4EBP1 protein (Cell Signaling Technology, catalog number 2855S) relative to total 4EBP1 protein (Cell Signaling Technology, catalog number 9644S) was also analyzed by Western blotting as an indicator of MTOR signaling pathway activity.

[0248] The results in Tables 30 and 31 show the relative levels of MTOR and p-4EBP1 proteins compared to untreated control cells. As shown in the tables below, MTOR and p-4EBP1 protein levels decreased in a dose-dependent manner in cells treated with modified oligonucleotides. “N / A” indicates that the corresponding condition was not evaluated.

[0249] [Table 30]

[0250]

[0251] [Table 31]

[0252]

[0253] Example 16: Evaluation of the potency of 5-10-5 2'-MOE notched polymer in human FCD type II neurosphere

[0254] The modified oligonucleotides used in this study were the 5-10-5 2'-MOE-gap polymers prepared in Example 1, which had PS nucleoside internucleotide bonds and unmodified nucleobases, wherein the cytosine residues were further modified to 5-methylcytosine. The length of the gap polymer was 20 nucleosides, wherein the central gap region consisted of ten (10) 2'-deoxy nucleosides, and the 3' and 5' wings each consisted of five (5) 2'-MOE nucleosides.

[0255] Neuronal spheroids were differentiated from stem cells carrying the MTOR mutation (c.7280T>C) associated with FCD type II and normal stem cells over a total of 42 days. Embryoid bodies (EBs) were treated with 10 μM SB431542 and 5 μM dorsomorphin for 4 days, followed by 8 days of induction to differentiate into early neuroectoderm and subsequently into neural rosettes (NRs). Only neural rosettes were selected and differentiated into three-dimensional neural precursor cells (NPCs) after 9 days. The NPCs were then cultured in a differentiation medium capable of inducing maturation into neurons, resulting in neuronal spheroids after 21 days.

[0256] Total RNA was extracted from differentiated wild-type and MTOR mutant neurospheres after 10 days of treatment with the modified oligonucleotides described above at concentrations of 2 μM and 5 μM, respectively, via free uptake. The mRNA expression level of the MTOR gene relative to the housekeeping gene RPL 13 was quantified by quantitative real-time PCR (qRT-PCR) using the TaqMan method. Quantification was performed using the human RPL 13 primer-probe set and the human MTOR primer-probe set described in Example 1 (Thermo Fisher Scientific, catalog number 4331182, detection ID: Hs00234508_m1). The relative MTOR mRNA expression level was analyzed by comparison with a PBS-treated group of wild-type neurospheres that had not been treated with the modified oligonucleotides. The relative MTOR mRNA expression levels resulting from this analysis are shown in Table 32 below. In Table 32, "nd" indicates no inhibition level was determined, and "WT" neurons represent wild-type neurons.

[0257] [Table 32]

[0258]

[0259] Example 17: The efficacy of modified oligonucleotides complementary to human mTOR against abnormal neuronal firing in human neurons carrying mTOR mutations.

[0260] Similar to epilepsy observed in patients with mTOR diseases such as FCD type II and TSC, human neurons with overactivated mTOR signaling pathways exhibit abnormally elevated firing rates. Therefore, using human embryonic stem cell-derived neurons carrying the mTORp.Leu2427Pro mutation as used in Example [X] above, the weighted average firing rate (WMFR) and burst frequency were analyzed using a multi-electrode array (MEA) system to confirm the efficacy of modified oligonucleotides complementary to human mTOR.

[0261] On day 3 of differentiation from human embryonic stem cells into neurons, 100,000 human neurons and 16,700 rat cortical astrocytes were co-cultured in each well of a CytoView MEA 48-well plate (M768-tMEA-48W; AxionBiosystems), with the medium changed every 3–4 days. On day 27 of differentiation, neurons were treated for 3 days with modified oligonucleotides (compounds IDs 574120, 574007, 574107, and 574109 in Table 30) at a concentration of 50 μM, after which the medium was changed to a medium without the modified oligonucleotides. Cells treated with PBS and those treated with untargeted oligonucleotides (compound ID 574120) served as negative controls. From day 13 to day 48 of neuronal differentiation, WMFR and burst frequency were recorded and analyzed every 3–4 days using the MEA system.

[0262] like Figure 2 and Figure 3 As shown, after treatment with modified oligonucleotides complementary to human MTOR (compounds ID 574007, 574107, and 574109), the WMFR and burst frequency (which increased relative to normal neurons on day 27 of differentiation) of MTOR p.Leu2427Pro mutant neurons decreased to levels comparable to those of normal neurons by day 48 of differentiation.

[0263] Example 18: Efficacy of modified oligonucleotides complementary to human mTOR against hypertrophic morphology in human neurons carrying mTOR mutations

[0264] It is well known that in brain tissue of patients with FMCD (focal cortical dysplasia) (e.g., in FCD type II, HME, and TSC) caused by overactivation of the mTOR signaling pathway, mutated neurons exhibit increased neuronal size relative to normal neurons. To determine whether modified oligonucleotides complementary to human mTOR are effective against this hypertrophic morphology, neurons derived from human embryonic stem cells (ESCs) carrying the mTOR p.Leu2427Pro mutation found in patients with FCD type II were used.

[0265] Human embryonic stem cells carrying the MTOR p.Leu2427Pro (c.7280T>C) mutation introduced using CRISPR / Cas9 technology were differentiated into neurons and seeded at a density of 140,000 cells / well. The cultured human neurons were treated for 4 days with modified oligonucleotides (compound IDs 574120, 574007, 574107, and 574109 in Table 30) at a concentration of 50 μM. Cells treated with PBS and those treated with untargeted oligonucleotides (NT ASO; compound ID 574120) served as negative controls.

[0266] Four days later, the culture medium was replaced with one that did not contain modified oligonucleotides. Ten days thereafter, the cells were immunostained with the neuronal marker MAP2 (Sigma, M1406) to analyze cell body size. For each test group, the cell body size of 51 to 81 neurons was measured.

[0267] like Figure 4 As shown, the results indicate that after treatment with modified oligonucleotides (compounds ID574007, 574107 and 574109) complementary to human MTOR, the increased hypertrophic morphology relative to normal neurons was restored to normal levels.

[0268] Example 19: Inhibition of mTOR in the non-human primate cell line CO31 by a 5-10-5 MOE notched polymer with mixed skeletal chemistry (multiple doses)

[0269] The modified oligonucleotides described above are complementary to the mTOR gene sequence in cynomolgus monkeys. The modified oligonucleotides were tested in CO31 cynomolgus monkey fibroblasts at various concentrations. Cells were seeded at a density of 12,000 cells / well and transfected by electroporation with modified oligonucleotides at concentrations of 0.02, 0.06, 0.19, 0.56, 1.67, 5, and 15 μM. Total RNA was extracted from the cells 24 hours after treatment.

[0270] The mRNA expression level of the MTOR gene relative to the housekeeping gene RPL 13 was determined by quantitative real-time PCR (qRT-PCR). The mRNA level was determined using the RPL 13 primer-probe set and the MTOR primer-probe set 3 used in Example 1 above.

[0271] The results in Table 33 show the relative mTOR mRNA levels at 15 μM and the corresponding IC50 levels compared to untreated control cells. 50 Value. Using the absolute IC from GraphPad Prism version 10 (GraphPad Software). 50Formula for calculating IC 50 value.

[0272] [Table 33]

[0273]

[0274] Example 20: Efficacy of modified oligonucleotides complementary to human mTOR in non-human primates

[0275] The potency of the modified oligonucleotides described above in non-human primates (NHPs) was further evaluated. For each compound, two cynomolgus monkeys received an intrathecal bolus injection of 40 mg of the corresponding compound on days 1 and 29 of the study. Two weeks after administration on day 29, the relative mTOR mRNA expression levels in the cerebral cortex and spinal cord regions were analyzed.

[0276] The mRNA expression level of the mTOR gene relative to the housekeeping gene UBC was determined by quantitative real-time PCR (qRT-PCR). mRNA levels were measured using a non-human primate UBC primer-probe set (Thermo Fisher, detection ID: Mf02798368_m1) and a non-human primate MTOR primer-probe set (Thermo Fisher, detection ID: Mf01042402_m1). Brain tissue from untreated monkeys served as a control; the relative mTOR mRNA expression levels are shown in Table 34 below. As shown in the table, compared to the control, the modified oligonucleotides reduced the mTOR mRNA levels in the cerebral cortex and spinal cord regions.

[0277] [Table 34]

[0278]

Claims

1. An oligomeric compound for regulating the activity and / or expression level of mTOR, comprising a modified oligonucleotide containing 8 to 80 linked nucleosides, wherein the modified oligonucleotide is complementary to the mTOR nucleic acid sequence, wherein the nucleic acid sequence of the modified oligonucleotide has at least 80% sequence identity with a complementary sequence of a target region within the mTOR transcript, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide bond, and a modified nucleobase.

2. The oligomer compound of claim 1, wherein the target region comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 440 to 446.

3. The oligomer compound according to claim 2, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleobases from the nucleic acid sequences of SEQ ID NO: 1 to 19, SEQ ID NO: 27 to 36, SEQ ID NO: 68 to 81, SEQ ID NO: 396 to 403 or SEQ ID NO: 414 to 417, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide, and a modified nucleobase.

4. The oligomeric compound according to claim 1, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleobases from the nucleic acid sequences of SEQ ID NO: 447 to 453, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide, and a modified nucleobase.

5. The oligomeric compound according to claim 1, wherein the nucleic acid sequence of the modified oligonucleotide comprises an oligonucleotide consisting of 14 to 80, for example 14 to 30 or 14 to 22, specifically 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive linked nucleosides, the oligonucleotide comprising the nucleic acid sequence of SEQ ID NO: 454, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified internucleotide bond and a modified nucleobase.

6. The oligomeric compound of claim 1, wherein the nucleic acid sequence of the modified oligonucleotide comprises an oligonucleotide consisting of 9 to 80, for example 12 to 30 or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive linked nucleosides, the oligonucleotide comprising the nucleic acid sequence of SEQ ID NO: 455, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety, a modified nucleoside internucleotide bond and a modified nucleobase.

7. The oligomeric compound according to claim 2, wherein the nucleic acid sequence of the modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive nucleobases selected from the group consisting of SEQ ID NO: 10, 11, 12, 13, 14, 28, 32, 35, 71, 396, 397, 398, 399, 400, 401, 402, 403, 414 and 416.

8. The oligomeric compound according to claim 2, wherein the nucleic acid sequence of the modified oligonucleotide is SEQ ID NO: 10, 11, 12, 13 or 14.

9. The oligomeric compound according to any one of claims 1 to 8, wherein the modified oligonucleotide comprises: The 5'-wing region consists of 1 to 7 linked 5'-region nucleotides; A central gap region consisting of 6 to 10 connected central nucleotides; and The 3'-wing region consists of 1 to 7 linked 3'-region nucleosides.

10. The oligomeric compound according to any one of claims 1 to 9, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified sugar moiety.

11. The oligomeric compound according to any one of claims 1 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified bicyclic sugar moiety having a 2'-4' bridge and at least one modified nucleoside containing a modified non-bicyclic sugar moiety.

12. The oligomeric compound according to any one of claims 1 to 11, wherein the modified sugar moiety comprises at least one selected from the group consisting of: Modified non-bicyclic sugar moieties comprising 2'-MOE and 2'-OMe sugar moieties; and It contains a modified bicyclic sugar moiety with 2',4'-bridges selected from -O-CH2- and -O-CH(CH3)-.

13. The oligomer of claim 11, wherein the modified oligonucleotide comprises a 5'-wing region, a central notch region and a 3'-wing region, wherein at least one nucleoside selected from the group consisting of the 5'-wing and the 3'-wing comprises a modified bicyclic sugar moiety and an unmodified bicyclic sugar moiety, and wherein the modified bicyclic sugar moiety is a modified bicyclic sugar moiety having a 2'-4' bridge.

14. The oligomeric compound according to any one of claims 1 to 13, wherein the modified oligonucleotide comprises at least one modified nucleoside internucleotide bond.

15. The oligomeric compound according to any one of claims 1 to 14, wherein the modified oligonucleotide comprises at least one nucleoside bond selected from the group consisting of thiophosphate nucleoside bonds, methanesulfonylaminophosphate nucleoside bonds, and phosphodiester nucleoside bonds.

16. The oligomeric compound according to any one of claims 1 to 15, wherein the modified oligonucleotide comprises a modified bicyclic sugar moiety containing a 2',4'-bridge and a 2'-MOE sugar moiety in the nucleic acid sequence of SEQ ID NO: 13, 14, 106, 409 or 416, and at least one modified nucleoside internucleotide bond comprises a phosphate thioester nucleoside internucleotide bond.

17. The oligomeric compound according to any one of claims 1 to 15, wherein the modified oligonucleotide contains at least one 2'-MOE sugar moiety in the nucleic acid sequence of SEQ ID NO: 11, 12, 13, 14, 28, 95, 102, 105, 106, 319, 396, 398, 399, 403, 409, 414 or 416, and contains at least one nucleotide inter-linked bond selected from the group consisting of thiophosphate nucleotide inter-linked bonds and phosphodiester nucleotide inter-linked bonds.

18. The oligomeric compound according to any one of claims 1 to 17, wherein the modified oligonucleotide comprises a modified nucleobase.

19. The oligomer compound according to claim 18, wherein the modified nucleobase is 5-methylcytosine.

20. The oligomer of claim 13, wherein each nucleoside in the central nick region is a 2'-β-D-deoxynucleoside.

21. The oligomeric compound according to any one of claims 1 to 20, further comprising a conjugating group.

22. A composition for reducing or inhibiting the activity or expression level of mTOR, comprising an oligomeric compound according to any one of claims 1 to 21.

23. A pharmaceutical composition for the prevention, improvement or treatment of MTOR-related diseases or conditions, comprising an oligomeric compound according to any one of claims 1 to 22.

24. The pharmaceutical composition of claim 23, wherein the composition further comprises a pharmaceutically acceptable carrier or diluent.

25. The pharmaceutical composition of claim 24, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

26. The pharmaceutical composition according to any one of claims 23 to 25, wherein the MTOR-related disease or condition is cancer, kidney disease, neurodevelopmental disorder, or neurodegenerative disease.

27. The pharmaceutical composition of claim 26, wherein the disease or condition is focal cortical dysplasia (FCD), hemimegaly (HME), tuberous sclerosis (TSC), megalencephaly (MEG), Cowden syndrome, PIK3CA-associated overgrowth spectrum disorder (PROS), Bannayan-Riley-Ruvalcaba syndrome (BRRS), Lhermitte-Duclos disease (LDD), MCAP (megalencephaly-polydactyly-polymicrogyri-hydrocephalus), MPPH (Macrocerebral malformation-polymicrogyria-hydrocephalus), Smith-Kingsmore syndrome (SKS), polyhydramnios, macrocephaly and symptomatic epilepsy syndrome (PMSE), familial intellectual disability-macrocephaly syndrome, Proteus syndrome, Fragile X syndrome (FXS), autism spectrum disorder (ASD), familial focal epilepsy with variable lesions (FFEVF), autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE), familial medial temporal lobe epilepsy (FMTLE), temporal lobe epilepsy (T... Developmental epileptic encephalopathy (DEE) with onset in infancy, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), lung cancer, colorectal cancer, gastric cancer, renal cell carcinoma, bladder cancer, prostate cancer, breast cancer, gangliomas, glioblastoma, dysembryonic neuroepithelial tumors (DNET), subependymal giant cell astrocytomas (SGCAs / SEGAs), polycystic kidney disease (PKD), or seizures or epilepsy associated with these diseases or conditions.

Images