single-stranded end-retaining adaptors

Abstract

Provided herein are compositions, kits, systems, and methods employing single-stranded end-retaining adapters. Such single-stranded adapters are ligated to DNA duplex molecules while preserving the original 5' or 3' single-stranded overhang (e.g., present in cell-free DNA) by ligating such adapters to the 3' end of the DNA duplex molecule using a single-strand ligase with step 3 ligase activity but not step 2 adenylyltransfer activity, and ligating such adapters to the 5' end of the DNA duplex molecule using a ligase (e.g., a circularizer), thereby forming a loop-like structure on one or each end of the DNA duplex molecule. In further embodiments, when the single-stranded adapter has a cleavable moiety, the loop-like structure is cleaved (e.g., by an endonuclease), thereby generating a two-part adapter on one or both ends of the DNA duplex molecule that preserves the original 5' or 3' single-stranded overhang, as well as any methylation present.

Description

[0001] This application claims priority to U.S. Provisional Application Serial No. 63 / 556,538, filed on February 22, 2024, which is incorporated herein by reference in its entirety. Technical Field

[0002] This document provides compositions, kits, systems, and methods for employing single-stranded end-preserving adaptors. Such single-stranded adaptors are ligated to DNA duplex molecules while preserving the original 5' or 3' single-stranded overhangs (e.g., present in cell-free DNA) by: ligating such adaptors to the 3' end of the DNA duplex molecule using a single-stranded ligase having the ligase activity of step 3 but not the adenosine transfer activity of step 2; and ligating such adaptors to the 5' end of the DNA duplex molecule using a ligase (e.g., a circligase), thereby forming a loop-like structure at one or each end of the DNA duplex molecule. In another embodiment, when the single-stranded adaptor has a cleavable portion, the loop-like structure is cleaved (e.g., by an endonuclease), thereby generating two-part adaptors at one or both ends of the DNA duplex molecule, which retain the initial 5' or 3' single-stranded overhangs (or blunt ends). Background Technology

[0003] NGS (Next-Generation Sequencing) library preparation workflow typically consists of end repair and A-tail addition steps (ER / AT) of fragmented DNA. During end repair (ER), 3'-single-stranded overhangs are filled in, and 3'-overhangs (i.e., 5'-single-stranded overhangs) are removed to form blunt-ended DNA duplexes. This is typically catalyzed by T4 DNA polymerase, which has both 5'-3' polymerase and 3'-5' exonuclease activities. During A-tail addition (AT), Taq DNA polymerase or Klenow polymerase adds a non-template A to the 3' end of the DNA duplex to facilitate subsequent ligation with the T-dangling sequencing adaptor. Because of the biochemical substrate requirements of T4 DNA ligase—which specify the ligation between two DNA duplex fragments—the ER / AT step must be performed before the ligation step.

[0004] There are foreseeable concerns related to the routine ER / AT process and its underlying chemistry. First, the raw DNA sample undergoes “writing” (3’-filling single-stranded overhangs) and “erasing” (3’-removal of overhangs) prior to amplification. The “writing” activity during ER / AT increases the likelihood of introducing replication errors, which may subsequently be amplified and perceived as real mutations associated with the starting sample. For example, polymerase-related “writing” activity may produce numerous sequencing artifacts due to its use in fragmentation (1). On the other hand, “erasing” simply reduces the sample input, resulting in partial loss of sequence information and potentially negatively impacting the sensitivity of assays for detecting genomic alterations.

[0005] Secondly, it has been found that “writing” may not be limited to the ends. In fact, recent reports indicate that significant DNA strand resynthesis may occur during the ER / AT step, typically starting from sites deep within the DNA double helix (2). It has been reported that “7–17% and 32–57% of internal double-stranded base pairs, respectively, from cell-free DNA and formalin-fixed tumor biopsy samples, can be resynthesized in vitro, potentially introducing pseudomutations” (2). Furthermore, for genomic assays aimed at mapping epigenetic modifications of bases, synthesis and resynthesis during ER / AT introduce confounding factors because newly synthesized fragments lack biologically relevant epigenetic markers (3). Therefore, resynthesis during ER / AT may dilute biological epigenetic signals and lead to an underestimation of modification levels (3).

[0006] Third, because the single-stranded overhangs of the starting DNA are disrupted after ER / AT, it is often difficult to infer the original ends from sequencing data, especially for the 3'-ends. Therefore, the uncertainty of the 3'-end position can complicate the signals inferred from fragmentomics studies (4). As another example, using a duplex sequencing library preparation method (5), where two strands derived from the same DNA duplex can be paired after analysis, strand pairing can only reveal the blunt-end conformation after ER / AT. While this may not be crucial for DNA ends generated in vitro, it has been found that single-stranded overhangs at the ends of cell-free plasma DNA (referred to as "serrated ends") can contain meaningful biological signals that differ between fetal / maternal and normal / cancer origins (3). In their study (3), Jiang, P. et al. used a modified base 5-methyl-dCTP instead of dCTP in ER / AT, allowing the synthesized fragments to be distinguished from native DNA based on their epigenetic patterns, which then allowed for profiling of the 3'-single-stranded overhangs.

[0007] Library preparation workflows exist that do not use conventional ER / AT chemistry and offer the benefit of minimal “write” or “erase” activity. For example, large genomic DNAs can be simultaneously cleaved and labeled with adaptors using transposase-based methods (6), but this is generally unsuitable for already fragmented DNAs, such as cell-free DNA derived from plasma or DNA extracted from FFPE tissue. Other methods utilizing direct single-stranded ligation (7) or degenerate single-stranded mediated splinting ligation (8) have been reported. However, these methods typically begin with a thermal denaturation step, during which DNA duplexes and associated end information are lost. Additionally, hybridization based on the complementarity between single-stranded DNAs in complex genomic libraries can be challenging. Harkins et al. reported a library preparation method that uses a Y-adaptor pool with predefined degenerate ends of up to 6 nucleotides to perform profiling of the native ends of the library DNA (9). However, the limited possibilities, depending on the design of the adaptor pool, can introduce bias into the analysis. Summary of the Invention

[0008] This document provides compositions, kits, systems, and methods for employing single-stranded end-preserving adaptors. Such single-stranded adaptors are ligated to DNA duplex molecules while preserving the original 5' or 3' single-stranded overhangs (e.g., present in cell-free DNA) by: ligating such adaptors to the 3' end of the DNA duplex molecule using a single-stranded ligase having the activity of step 3 but not the adenosine transfer activity of step 2; and ligating such adaptors to the 5' end of the DNA duplex molecule using a ligase (e.g., a cyclase), thereby forming a loop-like structure at one or each end of the DNA duplex molecule. In another embodiment, when the single-stranded adaptor has a cleavable portion, the loop-like structure is cleaved (e.g., by an endonuclease), thereby generating a two-part adaptor at one or both ends of the DNA duplex molecule, which retains the initial 5' or 3' single-stranded overhang (or blunt end), because this method does not require any end repair or A-tail addition. Unlike conventional end repair / A-tail addition used in library preparation, this method does not alter the DNA template prior to the adaptor ligation step and is particularly suitable for high-quality sequencing library preparation, including genomic and epigenomic sequencing library preparation and fragmentomics analysis.

[0009] In some embodiments, this document provides methods for ligating an adaptor to a DNA duplex molecule (e.g., retaining both a 5' or 3' single-stranded overhang and any present DNA modifications, such as methylation), methods comprising: a) generating a sample comprising: a DNA duplex molecule, a first single-stranded adaptor, and a single-stranded ligase, wherein the single-stranded ligase has the ligase activity of step 3 but not the adenosine transfer activity of step 2, wherein the DNA duplex molecule comprises: i) a first duplex terminus comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide (e.g., G, C, or T) or at least two nucleotides in length (e.g., 2-15 nucleotides in length); and ii) a second duplex terminus comprising a 3' end and a 5' end, the second duplex terminus optionally having a 3' or 5' single-stranded overhang (e.g., a single non-adenine nucleotide (e.g., ... The first single-stranded adapter comprises a first nucleic acid sequence and a 3' end blocking group attached to the 3' end of the first nucleic acid sequence, wherein the 5' end of the first nucleic acid sequence is adenylated, and wherein the first nucleic acid sequence comprises a 5' region, a 3' region, and optionally a cleavable region between the 5' and 3' regions; b) incubating the sample at a certain temperature such that the single-stranded ligase ligates the 5' end of the first single-stranded adapter to the 3' end of the first double-stranded molecule; c) optionally contacting the sample with a deblocking agent that removes or modifies the 3' end blocking group such that the 3' end of the first single-stranded adapter contains a 3' end available for ligation; and d) optionally contacting the sample with a ligase that ligates the 3' end of the first single-stranded adapter to the 5' end of the first double-stranded molecule, thereby generating a first loop-like structure at the first double-stranded end of the DNA double-stranded molecule. In some embodiments, any or all of these protrusions contain at least one methylated cytosine. In a particular embodiment, the first ring structure is methylated at each (or nearly each) cytosine present in the first ring structure.

[0010] In another embodiment, these methods further include: e) contacting the sample with one or more enzymes to cleave the cleavable region of the first nucleic acid sequence, thereby generating a first two-part adapter at the end of the first double-stranded DNA molecule that retains a 3' or 5' single-stranded overhang at the end of the first double-stranded DNA molecule, wherein the first two-part adapter comprises: i) a 5' region of the first nucleic acid sequence attached to the 3' end of the first double-stranded DNA molecule, and ii) a 3' region of the first nucleic acid sequence attached to the 5' end of the first double-stranded DNA molecule. In other embodiments, the sample in a) further comprises a second single-stranded adapter identical to the first single-stranded adapter (e.g., identical in terms of the elements present), wherein the second single-stranded adapter comprises a second nucleic acid sequence and optionally a 3' blocking group attached to the 3' end of the second nucleic acid sequence, wherein the 5' end of the second nucleic acid sequence is adenylated, and wherein the second nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, and wherein: i) during step b), the single-stranded ligase ligates the 5' end of the second single-stranded adapter to the 3' end of the second duplex; ii) optionally during step c), the deblocking agent removes or modifies the 3' end blocking group such that the 3' end of the second single-stranded adapter contains a 3' end available for ligation; and iii) optionally during step d), the ligase ligates the free 3' end of the second single-stranded adapter to the 5' end of the second duplex of the DNA duplex molecule, thereby generating a second loop-like structure at the second duplex end of the DNA duplex molecule. In some embodiments, the first and / or second nucleic acid sequence is methylated at each (or nearly each) cytosine present in the first and / or second nucleic acid sequence. In some embodiments, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC).

[0011] In another embodiment, during step e), the one or more enzymes cleave the cleavable region of the second nucleic acid sequence to generate a second two-part adapter at the end of the second double helix, wherein the second two-part adapter comprises: i) a 5' region of the second nucleic acid sequence attached to the 3' end of the second double helix of the DNA double helix molecule, and ii) a 3' region of the second nucleic acid sequence attached to the 5' end of the second double helix of the DNA double helix molecule.

[0012] In some embodiments, this document provides methods for ligating an adaptor to a DNA duplex molecule while retaining the 5' or 3' single-stranded overhang of the DNA duplex molecule (and any DNA modifications present on the overhang, including methylation), these methods comprising: a) generating a sample comprising: a plurality of DNA duplex molecules (e.g., cell-free DNA duplex molecules), a plurality of single-stranded adaptors, and a single-stranded ligase, wherein the single-stranded ligase has step 3 ligase activity but not step 2 adenosine transfer activity, wherein each of these DNA duplex molecules comprises: i) a first duplex end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second duplex end comprising a 3' end and a 5' end, the second duplex end optionally having a 3' or 5' single-stranded overhang or a blunt end, wherein these Each single-stranded adapter in the single-stranded adapter comprises a nucleic acid sequence and optionally a 3' blocking group attached to the 3' end of the nucleic acid sequence, wherein the 3' blocking group is optionally a modified non-canonical nucleotide or phosphate group, wherein the 5' end of the nucleic acid sequence is adenylated, and wherein the nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions; b) incubating the sample at a certain temperature such that the single-stranded ligase ligates the 5' ends of these single-stranded adapters to the 3' ends of the first and second duplex ends; c) optionally contacting the sample with a deblocking agent, if present, which removes the 3' blocking group from these single-stranded adapters; and d) contacting the sample with a ligase that ligates the 3' ends of these single-stranded adapters to the 5' ends of the first and second duplex ends, thereby generating a first loop-like structure at the first duplex end of the plurality of DNA duplex molecules and a second loop-like structure at the second duplex end of the plurality of DNA duplex molecules. In some embodiments, any or all of these protrusions contain at least one methylated cytosine (e.g., one, two, three, four, five or more cytosines).

[0013] In another embodiment, these methods further include: e) contacting the sample with one or more enzymes to cleave cleavable regions of the nucleic acid sequences, thereby generating two-part adaptors at the first and second duplex ends of the plurality of duplex DNA molecules, wherein each of the two-part adaptors comprises: i) a 5' region of the nucleic acid sequences attached to the 3' end of the first duplex end of the plurality of DNA duplex molecules, and ii) a 3' region of the nucleic acid sequences attached to the 5' end of the first duplex end of the plurality of DNA duplex molecules. In another embodiment, the plurality of DNA duplex molecules are contacted with bisulfite (or a similar reagent or enzyme with the same function) to convert unmethylated (non-methylated) cytosine to uracil, which is then sequenced as thymine. In another embodiment, such DNA duplexes are used to generate a sequencing library, which is then sequenced to generate multiple sequence reads (e.g., which can determine the positions of initially methylated and unmethylated cytosine). In another embodiment, the plurality of DNA duplex molecules are contacted with chemicals or enzymes (e.g., in the TAPS method or in natural or engineered cytosine deaminases; see, for example, Liu et al., Nature Biotechnology, Vol. 37, pp. 424–429 (2019), which is incorporated herein by reference) to convert only methylated cytosine (not unmethylated cytosine) and sequence it as thymine.

[0014] In some embodiments, this document provides methods for ligating an adaptor to a DNA duplex molecule, the methods comprising: a) generating a sample comprising: a DNA duplex molecule, a first single-stranded adaptor, and a single-stranded ligase, wherein the single-stranded ligase has the ligase activity of step 3 but not the adenosine transfer activity of step 2, wherein the DNA duplex molecule comprises: i) a first duplex end comprising a 3' end and a 5' end, and ii) a second duplex end comprising a 3' end, wherein the first single-stranded adaptor comprises a first nucleic acid sequence and a 3' end blocking group attached to the 3' end of the first nucleic acid sequence, wherein the 5' end of the first nucleic acid sequence is adenosine-modified, and wherein the first nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions; and b) incubating the sample at a certain temperature such that the single-stranded ligase ligates the 5' end of the first single-stranded adaptor to the 3' end of the first duplex end. In another embodiment, the methods further include: c) contacting the sample with a deblocking agent (if desired), the deblocking agent removing or modifying the 3' end blocking group such that the 3' end of the first single-stranded adapter includes a 3' end available for ligation; d) contacting the sample with a ligase, the ligase attaching the 3' end of the first single-stranded adapter to the 5' end of the first double-stranded end, thereby generating a first loop-like structure at the first double-stranded end of the DNA double-stranded molecule; and e) contacting the sample with one or more enzymes such that a cleavable region of the first nucleic acid sequence is cleaved, thereby generating a first two-part adapter at the first double-stranded end, wherein the first two-part adapter includes: i) a 5' region of the first nucleic acid sequence attached to the 3' end of the first double-stranded end of the DNA double-stranded molecule, and ii) a 3' region of the first nucleic acid sequence attached to the 5' end of the first double-stranded end of the DNA double-stranded molecule.

[0015] In another embodiment, this document provides methods for ligating an adaptor to a DNA duplex molecule while retaining a 5' or 3' single-stranded overhang, these methods comprising: a) generating a sample comprising: a DNA duplex molecule, first and second single-stranded adaptors, and a single-stranded ligase, wherein the single-stranded ligase has the ligase activity of step 3 but not the adenosine transfer activity of step 2, wherein the DNA duplex molecule comprises: i) a first duplex terminus comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang... ii) a single-stranded overhang is a single non-adenine nucleotide or at least two nucleotides in length; and ii) a second double-stranded end comprising a 3' end and a 5' end, the second double-stranded end optionally having a 3' or 5' single-stranded overhang, wherein the first and second single-stranded adapters each comprise a first nucleic acid sequence and a 3' end blocking group connected to the 3' end of the first nucleic acid sequence, wherein the 5' end of the first nucleic acid sequence is adenylated, and wherein the first nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions. ; and b) incubating the sample at a certain temperature, such that the single-stranded ligase: i) ligates the 5' end of the first single-stranded linker to the 3' end of the first duplex, and ii) ligates the 5' end of the second single-stranded linker to the 3' end of the second duplex; c) contacts the sample with a deblocking agent that removes or modifies the 3' end blocking group, such that the 3' ends of the first and second single-stranded linkers contain 3' ends available for ligation; d) incubating the sample at a certain temperature, such that the DNA duplex denatures into the first and second target DNA segments. e) contacting the sample with a cyclase to connect the ends of the first and second target-adaptor constructs, thereby generating a first target-adaptor loop structure and a second target-adaptor loop structure; and f) optionally contacting the sample with one or more enzymes to cleave the cleavable regions of the first nucleic acid sequences of the first and second adaptors, thereby: i) generating a first two-part adaptor at the end of the first duplex retaining a 3' or 5' single-stranded overhang at the end of the first duplex; and ii) generating a second two-part adaptor at the end of the second duplex.

[0016] In some embodiments, this document provides compositions comprising: a) a plurality of single-stranded adapters, wherein each of these single-stranded adapters comprises a nucleic acid sequence and optionally a 3'-terminal blocking group attached to the 3' end of the nucleic acid sequence, wherein the 3'-terminal blocking group is optionally a modified non-canonical nucleotide or phosphate group, wherein the 5' end of the nucleic acid sequence is adenylated, and wherein the nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions; and b) a single-stranded ligase, wherein the single-stranded ligase has step 3 ligase activity but not step 2 adenylate transfer activity. In some embodiments, the nucleic acid sequence is methylated at each (or nearly each) cytosine present in the nucleic acid sequence. In some embodiments, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC).

[0017] In some embodiments, compositions, kits, and systems are provided herein comprising: a) a plurality of single-stranded adaptors (or a single single-stranded adaptor), wherein each of these single-stranded adaptors (or the adaptor) comprises a single-stranded nucleic acid sequence, the single-stranded nucleic acid sequence being DNA except for a uracil base, wherein the single-stranded nucleic acid sequence comprises: i) optionally comprising a first sequencing primer binding site of SEQ ID NO:56; ii) optionally comprising a second sequencing primer binding site of SEQ ID NO:57; iii) an adenylated 5' end; and iv) a 3' end comprising a phosphate group; and wherein the uracil base is between the first and second sequencing primer binding sites, and optionally wherein the nucleic acid sequence is methylated at each or nearly each cytosine present in the nucleic acid sequence.

[0018] In certain embodiments, the plurality of single-stranded adapters comprises at least 50 single-stranded adapters, and each of these nucleic acid sequences further comprises a different barcode sequence, wherein the length of the barcode sequence is optionally 2-12 or 13-18 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18) nucleotides. In other embodiments, these compositions, kits, and systems further comprise: b) a single-stranded ligase, wherein the single-stranded ligase has step 3 ligase activity but not step 2 adenosyltransfer activity. In some embodiments, the single-stranded nucleic acid sequence further comprises: i) optionally a first flow cell binding sequence of SEQ ID NO: 59, and ii) optionally a second flow cell binding sequence of SEQ ID NO: 60. In other embodiments, the single-stranded nucleic acid sequence further comprises: i) optionally a first index sequence of SEQ ID NO: 62, and ii) optionally a second index sequence of SEQ ID NO: 63. In another embodiment, the single-stranded sequence comprises sequences selected from the following: SEQ ID NO: 54, 55, 58 and 61.

[0019] In another embodiment, the composition further comprises a deblocking agent. In another embodiment, the composition further comprises a ligase selected from the group consisting of: cyclases, RtcB ligases and homologous RtcB ligases from *Escherichia coli*, thermostable RtcB such as RtcB from *Thermus thermophilus* (27) or from *Pyrococcus horikoshii* (28,30), cyclase I, cyclase II, TS2126 RNA ligase and MthDNA ligase, T4 RNA ligase 1 and T4 RNA ligase 2. In other embodiments, the composition further comprises one or more enzymes capable of cleaving cleavable regions of a nucleic acid sequence. In another embodiment, the composition further comprises a plurality of DNA double-stranded molecules, wherein each of these DNA double-stranded molecules comprises: i) a first double-stranded end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang or a blunt end; and ii) a second double-stranded end comprising a 3' end and a 5' end, optionally having a 3' or 5' single-stranded overhang or a blunt end. In another embodiment, each of these DNA double-stranded molecules comprises a loop-like structure at both the first and second double-stranded ends, wherein the loop-like structure is composed of a nucleic acid sequence.

[0020] In another embodiment, this document provides a composition comprising: a plurality of DNA double-stranded molecules, which are fragmented genomic DNA double-stranded molecules and / or cell-free DNA double-stranded molecules, wherein each of these DNA double-stranded molecules comprises: i) a first double-stranded end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second double-stranded end comprising a 3' end and a 5' end, the second double-stranded end optionally having a 3' or 5' single-stranded overhang or a blunt end, and wherein neither the first double-stranded end nor the second double-stranded end is open-ended. The DNA double-stranded molecules are altered by adding or deleting nucleotides, and include either of the following: i) each of these DNA double-stranded molecules contains a loop-like structure at both the first and second double-stranded ends, wherein the loop-like structure consists of a nucleic acid sequence comprising a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions; or ii) each of these DNA double-stranded molecules contains a first two-part adaptor at the first double-stranded end, wherein each first two-part adaptor comprises: A) a 5' region of the nucleic acid sequence attached to the 3' end of the first double-stranded end of the DNA double-stranded molecule, and B) a 3' region of the first nucleic acid sequence attached to the 5' end of the first double-stranded end of the DNA double-stranded molecule. In some embodiments, any or all of these overhangs contain at least one methylated cytosine (e.g., all present cytosine is methylated).

[0021] In some embodiments, wherein, for part ii), each of these DNA duplex molecules further comprises a second two-part adaptor at the second duplex end, wherein each second two-part adaptor comprises: A) a 5' region of the second nucleic acid sequence attached to the 3' end of the second duplex end of the DNA duplex molecule, and B) a 3' region of the second nucleic acid sequence attached to the 5' end of the second duplex end of the DNA duplex molecule. In a particular embodiment, a sequencing library is generated from at least some DNA duplex molecules, and optionally the sequencing library is sequenced to generate multiple sequence reads. In another embodiment, the fragmented genomic or cell-free DNA duplexes are derived from a human or mammalian species, optionally from a bodily fluid sample, which is optionally plasma, blood, urine, or semen. In some embodiments, the first and / or second nucleic acid sequences are methylated at each (or nearly each) cytosine present in the first and / or second nucleic acid sequences. In some implementations, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC).

[0022] In some embodiments, kits and compositions are provided herein comprising: a) a plurality of single-stranded adapters, wherein each of these single-stranded adapters comprises a nucleic acid sequence and optionally a 3' end blocking group attached to the 3' end of the nucleic acid sequence, wherein the 3' end blocking group is optionally a modified non-canonical nucleotide or phosphate group, wherein the 5' end of the nucleic acid sequence is adenylated, and wherein the nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions; and b) a single-stranded ligase, wherein the single-stranded ligase has step 3 ligase activity but not step 2 adenosyltransfer activity. In some embodiments, the nucleic acid sequence is methylated at each (or nearly each) cytosine present in the nucleic acid sequence. In some embodiments, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC).

[0023] In some embodiments, the kit and system further comprise a deblocking agent. In other embodiments, the kit and system further comprise a ligase selected from the following: cyclase, RtcB ligase or related homologous RtcB from *E. coli*, thermostable RtcB, cyclase I, cyclase II, TS2126 RNA ligase and Mth DNA ligase, T4 RNA ligase 1 and T4 RNA ligase 2. In further embodiments, the kit and system further comprise one or more enzymes capable of cleaving cleavable regions of nucleic acid sequences. In another embodiment, the kit and system further comprise a plurality of DNA double-stranded molecules, wherein each of these DNA double-stranded molecules comprises: i) a first double-stranded end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second double-stranded end comprising a 3' end and a 5' end, the second double-stranded end optionally having a 3' or 5' single-stranded overhang or a blunt end. In another embodiment, each of these DNA double-stranded molecules comprises a loop-like structure at both the first and second double-stranded ends, wherein the loop-like structure is composed of a nucleic acid sequence. In some embodiments, the kit and system further comprise one or more containers for collectively or separately containing the listed components, optionally wherein the components are present within the containers. In another embodiment, the one or more containers are selected from cardboard boxes, plastic bags or plastic cartons, glass vials, and plastic vials. In some embodiments, any or all of these protrusions contain at least one methylated cytosine (e.g., 1, 2, 3 or more).

[0024] In some embodiments, compositions, kits, and systems are provided herein comprising: a plurality of single-stranded adapters, each of which comprises a nucleic acid sequence, wherein the 5' end of the nucleic acid sequence is adenylated, wherein the nucleic acid sequence comprises: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, wherein the 5' and 3' regions of the first nucleic acid sequence each comprise barcode sequences having a predefined relationship with each other, and wherein at least one of the following conditions exists: i) the barcode in the 5' region is not complementary to the barcode in the 3' region, and / or ii) the barcode in the 5' region has a different length than the barcode in the 3' region. In another embodiment, the predefined association of the barcodes is based on a lookup table (e.g., Tables 5-8). In another embodiment, the barcode in the 5' region is identical to the barcode in the 3' region (Table 8). In other embodiments, a 3' blocking group is attached to the 3' end of the nucleic acid sequence, wherein the 3' blocking group is optionally a modified non-canonical nucleotide or phosphate group. In some embodiments, the nucleic acid sequence is methylated at every (or nearly every) cytosine present in the nucleic acid sequence. In some embodiments, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC).

[0025] In certain embodiments, this document provides compositions comprising: a sequencing library containing a plurality of DNA duplex molecules, each end of which is attached with a Y-shaped adaptor, wherein each Y-shaped adaptor comprises a 5' arm and a 3' arm, wherein the 5' arm has a first barcode and the 3' arm has a second barcode, and wherein at least one of the following conditions exists: i) the first barcode and the second barcode are not complementary, and / or ii) the first barcode has a different length than the second barcode. In some embodiments, the first and second barcodes have the same sequence. In some embodiments, the Y-shaped adaptor is methylated at each or nearly each cytosine present in the nucleic acid sequence. In some embodiments, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC).

[0026] In some embodiments, the length of the 3' or 5' single-stranded overhang is exactly or at least 3 nucleotides, and optionally, the length of the 3' or 5' single-stranded overhang is exactly or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 20 nucleotides. In another embodiment, the 5' and 3' regions of the first two-part adaptor are substantially or completely non-hybridized to each other. In another embodiment, the first two-part adaptor forms a general V-configuration (i.e., a Y-shaped adaptor minus the annealed lower stem portion) after ligation and cleavage. In other embodiments, the 5' and 3' regions of the second two-part adaptor are substantially or completely non-hybridized to each other. In another embodiment, the second two-part adaptor forms a general V-configuration (i.e., a Y-shaped adaptor minus the annealed lower stem portion) after ligation and cleavage.

[0027] In certain embodiments, the cleavable region comprises: A) a modified non-canonical base; B) a nucleic acid backbone linker (phosphothiophosphate or phosphodiester bond); or C) an endonuclease recognition site, wherein the endonuclease recognition site is formed at the junction of the 5' and 3' regions or consists of a sequence between the 5' and 3' regions; or D) one or more RNA bases, wherein optionally, the remainder of the first and second nucleic acid sequences consists of DNA; or E) a sequence that, upon addition of a secondary oligonucleotide, forms an endonuclease recognition sequence. In other embodiments, no end repair and / or A-tail addition is performed on the DNA duplex molecule.

[0028] In other embodiments, the incubation temperature is sufficient to cause the ends of the first and / or second double strands to separate instantaneously. In a particular embodiment, the incubation temperature is between 70 and 80 degrees Celsius, or about 75 degrees Celsius.

[0029] In another embodiment, the single-stranded ligase is a thermostable lysine mutant ssDNA / RNA ligase, which is a mutant form of the precursor thermostable ssDNA / RNA ligase, wherein the precursor thermostable ssDNA / RNA ligase has a motif I EKx(D / N / H)G, and wherein the thermostable lysine mutant replaces K in motif I with any other amino acid, or is selected from alanine (A), serine (S), cysteine ​​(C), valine (V), threonine (T), and glycine (G). In some embodiments, the thermostable lysine-mutant ssDNA / RNA ligase comprises a motif sequence selected from the group consisting of: EGx(D / N / H)G (SEQ ID NO:34), EPx(D / N / H)G (SEQ ID NO:35), EAx(D / N / H)G (SEQ ID NO:36), EVx(D / N / H)G (SEQ ID NO:37), ELx(D / N / H)G (SEQ ID NO:38), E Ix(D / N / H)G (SEQ ID NO:39), EMx(D / N / H)G (SEQ ID NO:40), ECx(D / N / H)G (SEQ ID NO:41), EFx(D / N / H)G (SEQ ID NO:42), EYx(D / N / H)G (SEQ ID NO:43), EWx(D / N / H)G (SEQ ID NO:44), EHx(D / N / H)G (SEQ ID NO:45), EYx(D / N / H)G (SEQ ID NO:46), EWx(D / N / H)G (SEQ ID NO:47), EHx(D / N / H)G (SEQ ID NO:38), EGx(D / N / H)G (SEQ ID NO:39), EGx(D / N / H)G (SEQ ID NO:40), EGx(D / N / H)G (SEQ ID NO:41), EGx(D / N / H)G (SEQ ID NO:42), EYx(D / N / H)G (SEQ ID NO:43), EWx(D / N / H)G (SEQ ID NO:44), EHx(D / N / H)G (SEQ ID NO:45), EGx(D / N / H)G (SEQ ID NO:46), EGx(D / N / H)G (SEQ ID NO:47), EGx(D / N / H)G (SEQ ID NO:48), SEQ ID NO:45), ERx(D / N / H)G (SEQ ID NO:46), EQx(D / N / H)G (SEQ ID NO:47), ENx(D / N / H)G (SEQ ID NO:48), EEx(D / N / H)G (SEQ ID NO:49), EDx(D / N / H)G (SEQ ID NO:50), ESx(D / N / H)G (SEQ ID NO:51), ETx(D / N / H)G (SEQ ID NO:52), and Ex(D / N / H)G (SEQ ID NO:53, with a point deletion of lysine); where x is any amino acid. In a particular embodiment, x is an amino acid having a smaller or less dense side chain compared to the other amino acids. In some embodiments, the single-stranded ligase has 94% or 95% or 96% or 97% or 98% or 99% or 100% identical amino acid sequence to any one of SEQ ID NO:1-21. In some embodiments, the single-stranded ligase is a naturally occurring enzyme or a mutant thereof. In a particular embodiment, the single-stranded ligase is any one of those described in U.S. Patent Publication 20190062827, which is incorporated herein by reference in its entirety.In another implementation, the single-stranded ligase is a naturally occurring enzyme or a mutant thereof.

[0030] In another embodiment, the DNA double-stranded molecule is cell-free DNA (cfDNA) from the subject, wherein the first and second double-stranded ends of the DNA double-stranded molecule are not altered by the addition or deletion of nucleotides. In another embodiment, the subject is a human, and optionally the cell-free DNA double-stranded molecule is extracted from a bodily fluid, which is optionally plasma, urine, blood, or CSF fluid.

[0031] In a particular embodiment, the first double-stranded end of the DNA double-stranded molecule has a 3' single-stranded overhang. In other embodiments, the first double-stranded end of the DNA double-stranded molecule has a 5' single-stranded overhang. In yet another embodiment, the second double-stranded end of the DNA double-stranded molecule has a 3' single-stranded overhang. In some embodiments, the second double-stranded end of the DNA double-stranded molecule has a 5' single-stranded overhang. In yet another embodiment, the first and / or second single-stranded adapter includes a 3' end blocking group, and step c) is performed therein. In yet another embodiment, the first and / or second single-stranded adapter does not have a 3' blocking group, and step c) is not performed.

[0032] In another embodiment, the 5' and 3' regions of the second nucleic acid sequence each contain at least one element selected from: a flow cell ligation sequence, a unique barcode sequence, a non-unique barcode sequence, a sample identification index sequence, a read 1 primer binding sequence, a read 2 primer binding sequence, and a universal PCR amplification primer binding sequence. In a specific embodiment, the 5' and 3' regions of the first nucleic acid sequence each (or at least one of them) contain at least one element selected from: a flow cell ligation sequence, a unique barcode sequence, a non-unique barcode sequence, a sample identification index sequence, a read 1 primer binding sequence, a read 2 primer binding sequence, and a universal PCR amplification primer binding sequence. In other embodiments, the 5' and 3' regions of the first nucleic acid sequence each contain a unique barcode sequence, and optionally, these barcode sequences have a predefined relationship with each other, which is optionally based on a predefined association, which may be a lookup table (e.g., Tables 5-8) or other methods for associating barcodes, and optionally, these barcode sequences are not complementary to each other, and optionally, these barcode sequences are identical to each other, and optionally, these barcodes have different lengths.

[0033] In other embodiments, these methods further include contacting a sample with primers that hybridize with at least a portion of the 3' and 5' regions of the first nucleic acid sequence of the first two-part adapter, and performing PCR amplification to generate an amplicon. In other embodiments, these methods further include contacting a sample with primers that hybridize with at least a portion of the 3' and 5' regions of the first and second nucleic acid sequences of the first and second two-part adapters, and performing PCR amplification to generate an amplicon. In other embodiments, the amplicon contains a barcode, and the method further includes sequencing the amplicon to generate reads, grouping the read bases at least partially according to the barcode, and optionally identifying the original top and bottom strands of the DNA duplex molecule. In some embodiments, these methods further include determining the original first and second ends of the DNA duplex molecule by calculation.

[0034] In a particular embodiment, the 3'-terminal blocking group is selected from nucleotides having a 3'-phosphate group and nucleotide reversible terminators. In another embodiment, the deblocking agent is selected from: enzymes with phosphatase activity, optionally selected from: T4 polynucleotide kinase, calf intestinal alkaline phosphatase (CIP), shrimp alkaline phosphatase (SAP); and chemical or physical agents for deblocking nucleotide reversible terminators, optionally buffered sodium nitrate or UV light. In another embodiment, the ligase is selected from: cyclase I, cyclase II, Mth DNA ligase, RtcB ligase from Escherichia coli, thermostable RtcB, Taq DNA ligase, T4 RNA ligase 1, T4 RNA ligase 2. In another embodiment, one or more enzymes are selected from: endonuclease, endonuclease V, endonuclease VIII, endonuclease and uracil DNA glycosylase, thermostable oxoguanine glycosylase (OGG), and iodine.

[0035] In a particular embodiment, the incubation temperature is sufficient to cause the ends of the first and / or second double strands to separate instantaneously. In other embodiments, the incubation temperature is between 70 and 80 degrees Celsius (e.g., 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80), or about 75 degrees Celsius.

[0036] In some implementations, the 5' and 3' regions of the first nucleic acid sequence each contain a barcode sequence, so that reads with the same barcode sequence can be grouped together for error correction during analysis.

[0037] In some embodiments, the 5' and 3' regions of the first nucleic acid sequence each contain barcode sequences with a predefined relationship, and optionally, these barcode sequences are not complementary to each other, and optionally, these barcode sequences are identical to each other, and optionally, these barcodes have different lengths. For example, they may be complementary to each other. Alternatively, they may not be complementary and may be selected from a list of dual-barcode pairs. During analysis, reads with barcodes satisfying the predefined relationship can be paired to recover the original double strand. In some embodiments, the paired double strands can be used for error correction. In some embodiments, the original ends can be inferred from the paired double strands.

[0038] In a particular embodiment, the 3'-modified non-canonical nucleotide of the single-stranded adapter is selected from: nucleotides having a 3'-phosphate group, or nucleotide reversible terminators, such as nucleotide reversible terminators having a 3'-O-blocking group. For example, 3'-O-allyl (Ruparel H et al. (2005) Design and synthesis of a 3'-O-allylphotocleavable fluorescent nucleotide as a reversible terminator for DNA sequencing by synthesis. Proc Natl AcadSci USA, 102:5932–5937.). Another example is 3'-ONH2 (Chen F et al. (2009) Reconstructed evolutionary adaptive pathsgivepolymerases accepting reversible terminators for sequencing and SNP detection, PNAS, 107: 1948-1953). Or reversible nucleotide terminators that do not contain a 3'-blocking group, such as "virtual terminators," and can be deblocked by UV (citation: Wu W. et al., Termination of DNA synthesis by N6-alkylated, not 3-O-alkylated, photocleavable 2-deoxyadenosinetriphosphates. Nucleic Acids Res. 2007;35:6339–6349).

[0039] In another embodiment, the deblocking agent is selected from enzymes with phosphatase activity, such as T4 polynucleotide kinase, calf intestinal alkaline phosphatase (CIP), and shrimp alkaline phosphatase (SAP). For nucleotide reversible terminators, chemical reagents or UV light are used to remove the blocking group. For example, buffered sodium nitrite (pH 5.5) used to convert 3'-ONH2 to 3'-OH, as described in the aforementioned references.

[0040] In some implementations, the 5' and 3' regions of the first nucleic acid sequence each contain a barcode sequence, so that reads with the same barcode sequence can be grouped together for error correction during analysis.

[0041] In some embodiments, the 5' and 3' regions of the first nucleic acid sequence each contain barcode sequences with a predefined relationship, and optionally, these barcode sequences are not complementary to each other, and optionally, these barcode sequences are identical to each other, and optionally, these barcodes have different lengths. For example, they may be complementary to each other. Alternatively, they may not be complementary and may be selected from a list of unique double barcode pairs (e.g., as shown in Tables 5-8). During analysis, reads with barcodes satisfying the predefined relationship can be paired to recover the original double strand (e.g., so that the original top and bottom strands can be identified). In some embodiments, the paired double strands can be used for error correction. In some embodiments, the original ends can be inferred from the paired double strands.

[0042] In some embodiments, the 5' and 3' regions of the first nucleic acid sequence each contain barcode sequences with a predefined relationship, and optionally, these barcode sequences are not complementary to each other, and optionally, these barcodes have different lengths. For example, they may be complementary to each other. Alternatively, they may not be complementary and may be selected from a list of unique double-barcode pairs (e.g., a lookup table, such as Tables 5-8). During analysis, reads with barcodes satisfying the predefined relationship can be paired to recover the original double strand, and optionally, these barcode sequences are not complementary to each other, and optionally, these barcodes have different lengths. In some embodiments, the paired double strands can be used for error correction. In some embodiments, the original ends can be inferred from the paired double strands.

[0043] In some embodiments, the kit and system further include one or more containers for containing the listed components, either together or separately, optionally wherein the components are present in the containers individually or in a mixture. In other embodiments, the one or more containers are selected from cardboard boxes, plastic bags or boxes, glass vials, and plastic vials. Attached Figure Description

[0044] Figure 1 Example reaction temperatures for DISTAL ligation. (A) Effect of reaction temperature on example DISTAL ligation on 320 bp double-stranded DNA. For the DISTAL ligation series, lanes 1-7 show the ligation of single-stranded adaptors to approximately 300 bp of DNA double strands at different temperatures. Lane 8 is double-stranded DNA only. Lane 9 is the same reaction catalyzed by thermostable 5' App DNA / RNA ligase (NEB) at 65 °C for 6 h. Reaction samples were run on a high-sensitivity D1000 screentape (Agilent) and analyzed using Tapestation software. (B) Effect of reaction temperature on DISTAL ligation on 180 bp double-stranded DNA. (C) Product distribution of reaction series in A and B. Molar concentration readings were obtained from Tapestation analysis software.

[0045] Figure 2 An exemplary DISTAL-seq workflow and results are shown. (A) Schematic diagram of the exemplary DISTAL-seq workflow. (B) Tapestrytations of a DISTAL-seq library using cleaved E. coli genomic DNA. The distinct bands around 150 bp are adaptor dimers. This is likely due to residual unligated adaptors that have undergone deblocking, circularization, cleavage, and amplification. (C) Sequence-specific bias in DISTAL ligation and cyclase II-mediated ligation. (D) Coverage distribution of DISTAL-seq. (E) Mutation signature of DISTAL-seq.

[0046] Figure 3 An exemplary DUET-seq workflow and validation results for samples with known ends are shown. (A) Schematic diagram of exemplary DUET-seq adaptor preparation and read structure. The unique molecular identifier (UMI) has 8 degenerate bases and 3 at either end. 8 =6561 possible barcodes, totaling 6561 x 6561 = 4 x 10 7Possible combinations. Degenerate bases use B (B=G / C / T) to avoid cleavage by USER enzymes (uracil DNA glycosylase and Endo VIII) within the UMI. After sequencing of paired ends, the first 8 bases of read 1 are UMI, and the first 13 bases of read 2 are UMI, with 5 constant bases. (B)(C) Tapestation traces of DUET-seq libraries using a mixture of pre-digested λ DNA. Lane B1: No ExoI / ExoIII treatment; Lane C1: ExoI / ExoIII treatment. (C) Single-stranded end length after end recovery. After double-stranded recovery, the end length is calculated as the 3'-end coordinate mapped to the forward strand minus the 5'-end coordinate mapped to the reverse strand, or the 5'-end coordinate mapped to the forward strand minus the 3'-end coordinate mapped to the reverse strand. Positive values ​​for single-chain end length indicate a 5'-single-chain protrusion, while negative values ​​indicate a 3'-single-chain protrusion. Zero values ​​indicate a flat end.

[0047] Figure 4 End profile analysis of cleaved genomic DNA and cell-free plasma DNA. (A) End length distribution of fragmented gDNA, including sonicated genomic DNA, enzymatically cleaved genomic DNA, and cell-free plasma DNA. (B) Insert distribution of an exemplary DUET-seq library of cell-free DNA. Data obtained from Picard Tools' CollectInsertSizeMetrics.

[0048] Figure 5 Exemplary DISTAL ligations using 5'-single-stranded or 3'-single-stranded DNA, and a comparison with blunt-ended DNA. Lane 1, blunt-ended DNA; Lane 2, exemplary DISTAL ligation using blunt-ended DNA; Lane 3, 5'-single-stranded DNA; Lane 4, exemplary DISTAL ligation using 5'-single-stranded DNA; Lane 5, 3'-single-stranded DNA; Lane 6, DISTAL ligation using 3'-single-stranded DNA.

[0049] Figure 6 An example of insert size distribution from an E. coli DISTAL-seq library. This figure was generated using CollectInsertSizeMetrics in Picardtools.

[0050] Figure 7 GC bias in an exemplary E. coli DISTAL-seq library. This figure was generated using CollectGcBiasMetrics in Picard tools.

[0051] Figure 8 Distribution of mutant AFs in Escherichia coli DISTAL-seq.

[0052] Figure 9 Insert size distribution of gDNA DUET-seq libraries after sonication.

[0053] Figure 10 Insert size distribution of DUET-seq libraries after enzymatic fragmentation.

[0054] Figure 11 A illustrates an exemplary single-chain linker having a 3'-blocking group, which can be, for example, 3'-phosphate, 3'-dideoxy C, 3'-biotin, 3'-spacer, etc. Other examples of 3'-blocking agents are available from IDT in its catalog "Modifications / GetAllMods#3'". Figure 11 B illustrates an exemplary single-stranded connective with an embedded cleavable site. The cleavable base can be, for example, an inner uracil (e.g., cleaved by UDG and EndoVIII), an inner 5'-hydroxymethyluracil, an inner inosine (e.g., cleaved by Endo V), and an inner 8-oxoguanine (cleaved by OGG and EndoVIII). The cleavable backbone link can be a phosphodiester bond (e.g., cleaved by an endonuclease), or, for example, a phosphate-thioester DNA bond, which can be cleaved, for example, by iodine (I2) (Qiang Huang et al., Origin of iodine preferential attack at sulfur in phosphorothioate and subsequent PO or P-Sbond dissociation, PNAS, Vol. 119, 2022, incorporated herein by reference). Figure 11 C illustrates an exemplary single-stranded adapter that can be cleaved by annealing a secondary oligonucleotide to form a double-stranded region, followed by cleavage of that double-stranded region. This can be achieved, for example, by embedding several RNA bases and cleaving them with RNase H, or by embedding a restriction enzyme site that is cleaved by a restriction enzyme. Figure 11 D illustrates an exemplary single-stranded joiner in which more than one cleavage site is embedded within the joiner. Cleavage can be performed sequentially, for example. This cleavage is also an alternative way to declose the 3'-end. Figure 11 E shows two exemplary single-stranded linkers made of DNA and RNA, which may or may not have a 3'-blocking group (top) or (bottom). Figure 11F illustrates an exemplary single-stranded linker with a 3' blocking group, which can be deblocked by phosphatases such as T4 PNK, shrimp alkaline phosphatase, etc. Another type of 3' blocking that can be used is a nucleotide reversible terminator, in which the blocking group is removed by a chemical agent.

[0055] Figure 12 A illustrates an exemplary single-stranded linker employing elements, such as those usable with the ILLUMINA sequencer, including: read 2 primer sequence, sample index 2, P7 sequence, P5 sequence, sample index 1, and read 1 primer sequence. Figure 12 B illustrates an exemplary single-stranded linker employing, for example, elements that can be used with the ILLUMINA sequencer, including: a second UMI (barcode) sequence, a read 2 primer sequence, a sample index 2, a P7 sequence, a P5 sequence, a sample index 1, a read 1 primer sequence, and a first UMI (barcode) sequence.

[0056] Figure 13 RtcB ligase from *E. coli* ligates single-stranded RNA with a 3'-phosphate or 2',3'-cyclic phosphate to another RNA with a 5'-hydroxyl terminus (25). RtcB is also known to ligate the 3'-phosphate end of single-stranded DNA to the 5'-hydroxyl end (26). Figure 13 A illustrates the use of RtcB to substantially circularize the single-stranded adaptor sequence in this paper. For example, after ligation with a hyperligase, E. coli RtcB can be used to directly ligate the 3'-phosphate end of the adaptor to the proximal 5' end of the double strand, as follows: Figure 13 As shown in A, it is not necessary to close the connector. Figure 13 In step B, because E. coli RtcB catalyzes ligation at 37°C, higher ligase ligation and RtcB ligation can occur in separate steps. For example... Figure 13 As shown in B, by using thermostable RtcB, advanced ligases and RtcB can be combined in a single reaction. Thermostable RtcB has been reported in the literature (27)(28), both of which are incorporated herein by reference, particularly the thermostable RtcB reported therein.

[0057] Figure 14AAn exemplary schematic diagram of duplex recovery using predefined associated 5' and 3' barcodes is shown (see Lookup Table 5-8). The duplex DNA fragment is shown with one end having a protrusion of approximately 9 nucleotides and a second end having a protrusion of approximately 6 nucleotides. The ends of the duplex DNA fragment are joined to single-stranded connectives with 5' and 3' barcodes, forming a dumbbell-shaped DNA molecule with its protrusions preserved. The two loops of this dumbbell-shaped DNA molecule are then cut. PCR amplification is then performed, such as using universal primers. These amplicons are then sequenced to generate sequence reads. As shown, the duplex is recovered using read pairs with appropriate associations. Note that the recovered duplex is not necessarily blunt-ended. End coordinates can be used to recover the ends present in the starting material. Figure 14B It shows the relationship with Figure 14A The same example image, but without the barcode and with a 3' protruding end. Figure 14C A similar exemplary diagram is shown without a barcode and a 5' protruding end.

[0058] Figure 15 A and 15B show exemplary embodiments in which the barcodes in the two connectors of the side-connected template sequence have different lengths.

[0059] Figure 16 A illustrates how the methods and compositions of this paper preserve methylation at the 3' and 5' protrusions of the target DNA, since, for example, the target DNA does not require end repair or A-tail addition. Figure 16 B illustrates an exemplary workflow using a fully methylated nucleic acid sequence that forms the adaptor in this article.

[0060] Figure 17 The workflow is illustrated, in which, after ligation as described herein, the double strands are no longer maintained; instead, the DNA sample is denatured and each single-stranded DNA is individually circularized.

[0061] Figure 18 A shows a similar Figure 2 The workflow differs in that, once the dumbbell-shaped structure is formed, primers designed to anneal with the adaptor sequence are added to initiate rolling circle amplification (RCA), thereby generating multiple copies of tandem single-stranded DNA with a double-stranded DNA template. Figure 18 In step B, after the first and second adaptors are ligated to the double-stranded DNA molecule, the double-stranded DNA is denatured and deblocked / ligated, causing each strand to form a single-stranded loop with the adaptor sequence embedded inside. Primers designed to anneal to the adaptor sequence are added to initiate rolling circle amplification (RCA), thereby generating multiple copies of tandem single-stranded DNA with a strand-specific DNA template.

[0062] Figure 19A shows an exemplary single-stranded adaptor nucleic acid sequence (SEQ ID NO: 54) consisting of DNA bases (e.g., 4 canonical bases) excluding one uracil base. The read 2 primer binding site (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; SEQ ID NO: 56) and the read 1 sequencing primer binding site (ACACTCTTTCCCTACACGACGCTCTTCCGATCT; SEQ ID NO: 57) are used in certain Illumina sequencing instruments and are labeled. The 5' end is adenylated, and the 3' end has a phosphate group. Figure 19 B shows the same Figure 19 A identical sequence, but also includes a 5-base random barcode at each end to form SEQ ID NO:55. Figure 19 C shows the same Figure 19 A identical sequence (SEQ ID NO:54), but further illustrated schematically with barcode 1 at one end and barcode 2 at the other end. In the connector pool, barcodes 1 and 2 can be (for example) any barcode pair from Table 8, which can form 96 pairs. Figure 19 D shows a similar Figure 19 An exemplary single-stranded adapter of A (SEQ ID NO:58) also includes a flow cell binding P7 sequence (ATCTCGTATGCCGTCTTCTGCTTG, SEQ ID NO:59) and a P5 flow cell binding sequence (AATGATACGGCGACCACCGAGATCTACAC, SEQ ID NO:60), which can be used, for example, when these sequences are not added using PCR. Figure 19 E shows the same Figure 19 The sequence is similar to D (SEQ ID NO:61), but further supplemented with the index sequences i7 (CTGATCGT, SEQ ID NO:62) and i5 (ATATGCGC, SEQ ID NO:63).

[0063] definition When a single-stranded DNA / RNA ligase is able to ligate between the 5'-adenosyl terminus and the 3'-hydroxy terminus of a single-stranded DNA / RNA, but cannot transfer AMP to the 5'-phosphate-capped DNA or RNA strand to form a 5'-App-DNA / RNA intermediate, the single-stranded DNA / RNA ligase is considered to have "step 3 ligase activity" but not "step 2 adenosyl transfer activity." All known DNA and RNA ligases catalyze a common pathway involving three nucleotide transfer reactions (Lehman et al., Science, 1974; Lindahl et al., Annu Rev Biochem, 1992). In the case of ATP-dependent DNA or RNA ligases, the first step (step 1) involves the ligase attacking the α-phosphate of ATP, which leads to the release of pyrophosphate and the formation of the ligase-AMP intermediate. AMP is covalently linked to the amino group of a lysine residue within a conserved sequence motif. In the second step (step 2), the AMP nucleotide is transferred to the 5'-phosphate-capped DNA or RNA strand to form the 5'-App-DNA / RNA intermediate. In the third and final step (step 3), the 3'-OH chain attacks the 5'-App-DNA / RNA end, linking two polynucleotides and releasing AMP.

[0064] "End repair" refers to filling in the 3'-single-stranded protrusions and / or removing the 5'-single-stranded protrusions of the original DNA analyte duplex using polymerase. In some embodiments, the method described herein does not employ any type of end repair. Detailed Implementation

[0065] This document provides compositions, kits, systems, and methods for employing single-stranded end-preserving adaptors. Such single-stranded adaptors are ligated to DNA duplex molecules while preserving the original 5' or 3' single-stranded overhangs (e.g., present in cell-free DNA) by: ligating such adaptors to the 3' end of the DNA duplex molecule using a single-stranded ligase having step 3 ligase activity but not step 2 adenosyltransferase activity; and ligating such adaptors to the 5' end of the DNA duplex molecule using a ligase (e.g., a cyclase), thereby forming a loop-like structure at one or each end of the DNA duplex molecule. In another embodiment, when the single-stranded adaptor has a cleavable portion, the loop-like structure is cleaved (e.g., by an endonuclease), thereby generating a two-part adaptor at one or both ends of the DNA duplex molecule, which retains the initial 5' or 3' single-stranded overhang (or blunt end), because this method does not require any end repair or A-tail addition. Such methods are particularly useful in sequencing library preparation and fragmentomics analysis, as well as in the presence of any methylation.

[0066] Current end-repair / A-tail addition (ER / AT) chemistry during NGS library preparation leads to “writing” and “erasing” activities on the starting material, introducing various artifacts and impacts on sequencing and data interpretation. Furthermore, conventional ER / AT eliminates native DNA ends, which can be of significant informational value for some sample types when generated through biological processes. In some implementations, this paper provides a sequencing library preparation workflow employing ligation (e.g., prior to the amplification step). In some implementations, an important step is the preservation of double-stranded single-stranded DNA tail ligation (DISTAL ligation) scheme (e.g., as...). Figure 2 As shown in the diagram, ligation between the duplex and the single-stranded adaptor occurs at elevated temperatures and is catalyzed by a thermostable single-stranded DNA ligase (e.g., a thermostable lysine mutant, as shown in Tables 1 and 2 below). Work performed during the development of the embodiments described herein demonstrated that the DISTAL ligation implementation enables novel sequencing library preparation workflows where end repair or A-tail addition is not required. Additionally, in some embodiments, the originally paired DNA strands within the same duplex, along with the native DNA ends accompanying that pairing, can be recovered using a barcoded adaptor (DUET-seq). In some embodiments, DUET-seq is applied to biological samples, such as those containing fragmented human genomic DNA and / or cell-free plasma DNA.

[0067] In certain embodiments, the single-stranded linker herein comprises a 5' region and a 3' region, wherein the 5' region contains a first barcode sequence and the 3' region contains a second barcode sequence. In some embodiments, the first and second barcode sequences are complementary and can hybridize with each other. In other embodiments, the first and second barcodes are not complementary and do not hybridize with each other.

[0068] This embodiment, in which the first and second barcode sequences do not hybridize with each other, differs from the normal approach in the art, where the barcode sequences reside in the "stem" of a Y-shaped connective, requiring the first and second barcodes to always be complementary (due to hybridization restrictions). Therefore, in the normal approach, the connective with barcode A is attached to one end of the duplex, and the connective with barcode B is attached to the other end, such that read pairs from one strand have barcode "AB," and read pairs from the other strand have barcode "BA." During analysis, read pairs sharing the same genomic coordinates at start and end positions, as well as the AB / BA barcode, are considered duplexes.

[0069] In the embodiments described herein, the 5' and 3' barcodes are not complementary to each other, as shown in Table 5 below: where AB, CD, EF, and GH each represent a 5' and a 3' barcode and do not hybridize with each other. Single-stranded connectives with unique combinations of AB, CD, EF, and GH can be synthesized individually and used as mixtures. For example, during ligation, a first single-stranded connective with barcodes A and B is connected to the end of a first double-stranded structure, and a second single-stranded connective with barcodes C and D is connected to the end of a second double-stranded structure. Read pairs from one strand have barcode DA, and read pairs from the other strand have barcode BC. During analysis, read pairs that overlap at their start and end positions and have a corresponding association as defined in the lookup table (e.g., as long as they pair up in this table, in this example DA / BC, and therefore have a predetermined relationship that can be looked up) are considered double-stranded structures. The ends of the double-stranded structures can then be inferred from the genomic start and end positions of the two strands at either end.

[0070] Table 5

[0071] Figure 14A An exemplary diagram is provided, which illustrates the use of barcodes that can be looked up in a lookup table such as Table 5 above (for both the bottom and top chains). Figure 14A This indicates that the double-stranded DNA fragment has a 9-nucleotide overhang at one end and a 6-nucleotide overhang at the other end. The ends of the double-stranded DNA fragment are joined with single-stranded connectives with 5' and 3' barcodes, forming a dumbbell-shaped DNA molecule with its overhangs preserved. The two loops of this dumbbell-shaped DNA molecule are then cleaved. PCR amplification is then performed, such as using universal primers. These amplicons are then sequenced to generate sequence reads. As shown, the double-stranded DNA is recovered using read pairs with appropriate associations. Note that the recovered double-stranded DNA is not necessarily blunt-ended. After mapping the reads to a reference genome, end coordinates can be used to recover the ends present in the starting material.

[0072] As mentioned above, the barcodes in this paper do not need to be complementary, which, for example, expands the design space to 16 possible combinations of 1-mers as shown in Table 6 below, compared to only 4 possible combinations if complementarity is required.

[0073] Table 6: Design Table for 1-polymer double-stranded barcodes

[0074] The possible lookup table for a monoclonal barcode is: Table 6.1

[0075] Another possible lookup table for monoclonal barcodes is: Table 6.2

[0076] As another example, barcodes of equal or unequal length can be used as double-chain barcodes.

[0077] Table 7: Barcodes of different lengths

[0078] As another example, barcodes with the same sequence can be used as double-chain barcodes. This design has the added advantage of not even requiring a lookup table.

[0079] Table 8. Exemplary design of 96 doubly linked barcodes with the same sequence

[0080] In some implementations, the two barcodes used herein (for a given template) do not have the same length (and may or may not be complementary, and may be the same sequence). Such implementations are illustrated in the examples. Figure 15 Figure A shows that the double-stranded barcodes are not complementary and have different lengths. Therefore, the combination of barcode designs of different lengths further expands the design space that can be used in the methods and compositions described herein. It should be noted that an exemplary advantage of this significantly expanded barcode design space is the reduced requirement for barcode length to achieve the same level of adaptor pool complexity. This can reduce the length of the adaptor oligonucleotide, thereby reducing synthesis costs. In other embodiments, such as... Figure 15 As shown in B, the associated barcodes may contain additional degenerate bases of equal or unequal length.

[0081] In some embodiments, the barcodes (e.g., non-complementary barcodes; identical sequences) may have a length of 1, 2, 3, 4, 5, 6, 7, or more nucleotides. In a particular embodiment, the non-complementary barcodes have 1, 2, 3, or more mismatches. In a particular embodiment, the barcodes (e.g., barcodes only) form pairs with the largest mismatch (Hamming distance). In other embodiments, the barcodes are identical. In yet another embodiment, the chain combinations of the two barcodes have a length difference, such as 1, 2, 3, 4, or more differences. In a particular embodiment, one of the two barcodes in the combination is absent (zero nucleotides). In others, the barcodes have certain constant and / or degenerate bases.

[0082] In some embodiments, the thermostable lysine mutants used in the methods, kits, systems and compositions described herein, together with the single-stranded linker, are provided in SEQ ID Nos: 1-21 in Tables 1 and 2 below, or in their N- or C-terminal truncated forms.

[0083] Table 1 Thermostable lysine mutant ssDNA / RNA ligase

[0084] Table 2

[0085] In some embodiments, a sequence search (e.g., using BLAST or PSI-BLAST) is performed using the sequences in Table 1 or above to find other thermostable ssDNA / RNA ligases from other species (e.g., by finding those with 30%…50%…60% or higher homology). For a particular candidate homolog identified, the next step is to determine the growth temperature of its source species. Typically, useful single-stranded ligase candidates will come from species with a growth temperature range above about 65°C. Next, multiple sequence alignment can be performed, and the conserved catalytic motif EKxxG (where x is any amino acid; as shown in Tables 1 and 2 above) can be located. Next, within the catalytic motif, K is mutated to any other amino acid (e.g., to prepare the ligase mutant of step 3). In some embodiments, it is preferred to mutate the lysine (K) in this motif I to another amino acid. The ssDNA and ssRNA activities (and thermostability) of such candidate enzymes (e.g., mutant enzymes) can then be screened, for example, using the same procedure as in Example 1 below (e.g., replacing step 3 of Example 1 with a candidate mutant and measuring the performance).

[0086] In some embodiments, the single-stranded adaptors disclosed herein are used for library preparation (“library preparation”) and / or then for sequencing methods, such as ligating the adaptors to library fragments for subsequent sequencing. For example, in some embodiments, the disclosures provided herein can be used in second-generation (also known as next-generation or Next-Gen), third-generation (also known as Next-Next-Gen), or fourth-generation (also known as N3-Gen) sequencing technologies, including but not limited to pyrosequencing, ligation-while-sequencing, single-molecule sequencing, sequencing-while-synthesis (SBS), sequencing-while-binding, semiconductor sequencing, massively parallel cloning, massively parallel single-molecule SBS, massively parallel single-molecule real-time, massively parallel single-molecule real-time nanopore technology, etc. Morozova and Marra in Genomics A review of some of these techniques is provided in , 92: 255 (2008), which is incorporated into this paper in its entirety by reference.

[0087] Any number of DNA sequencing technologies are suitable, including fluorescence-based sequencing methods (see, for example, Birren et al., Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, NY; which is incorporated herein by reference in its entirety). In some embodiments, this disclosure can be used for automated sequencing technologies understood in the art. In some embodiments, this technology can be used for parallel sequencing of partitioned amplicon (PCT Publication No.: WO2006084132, which is incorporated herein by reference in its entirety). In some embodiments, this technology can be used for DNA sequencing via parallel oligonucleotide extensions (see, for example, U.S. Patent Nos. 5,750,341 and 6,306,597, both of which are incorporated herein by reference in their entirety). Other examples of sequencing technologies using this technique include Church polony (Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure et al., 2005 Science 309, 1728-1732; US Patent Nos. 6,432,360, 6,485,944, and 6,511,803; all of which are incorporated herein by reference in their entirety), 454-picotiter pyrosequencing (Margulies et al., 2005 Nature 437; 376-380; US 20050130173; all of which are incorporated herein by reference in their entirety), and Solexa single-base addition (Bennett et al., 2005, Pharmacogenomics, 6, U.S. Patent Nos. 6,787,308 and 6,833,246 (all incorporated herein by reference in their entirety), Lynx massively parallel characterization technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Patent Nos. 5,695,934 and 5,714,330 (all incorporated herein by reference in their entirety), and Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957 (all incorporated herein by reference in their entirety)).In some embodiments, the library preparation and sequencing technologies are as described in any of the following U.S. patents, each of which is incorporated herein by reference: 9,752,188; 10,570,451; 11,479,807; 8,383,345; 10,876,172; 9,598,731; 9,902,992; 10,801,063; 11,091,797; 8,532,930; 9,639,657; and 10,011,870.

[0088] In some embodiments, the 3' end of the single-stranded adapter here has a 3' end blocking group, such as a phosphate group or a modified non-canonical nucleotide, to prevent the attachment between the 5'-adenosylated end of the adapter and the 3' end. If the blocking group is, for example, a nucleotide with a 3'-phosphate, this blocking group can be removed by T4 polynucleotide kinase, calf intestinal alkaline phosphatase (CIP), or shrimp alkaline phosphatase (SAP). In some embodiments, when using CIP or SAP, a round of T4 PNK can be used to rephosphorylate the 5' end of the proximal chain.

[0089] Another type of base blocking and deblocking can utilize reversible terminator technology, which is widely used in the sequencing industry.

[0090] In some embodiments, the single-stranded linker herein contains a non-canonical base, such as inosine, uracil, 5-formylcytosine, 5-carboxycytosine, or 8-oxoguanine, in the cleavable region. In some embodiments, where inosine is present in the cleavable region, strand cleavage is performed using endonuclease V or a similar enzyme. In some embodiments, where uracil, 5-formylcytosine, or 5-carboxycytosine is present in the cleavable region, strand cleavage is performed using a combination of uracil DNA glycosylase (UDG) and endonuclease VIII (or a similar enzyme). In a particular embodiment, where 8-oxoguanine is present in the cleavable region, cleavage is performed using either thermostable OGG (oxoguanine glycosylase) or strand cleavage. In a particular embodiment, the cleavable backbone linker can be, for example, phosphate-thioate DNA cleaved by iodine (I2) (Qiang Huang et al., Origin of iodine preferential attack at sulfur in phosphorothioate and subsequent PO or PS bond dissociation, PNAS, Vol. 119, 2022).

[0091] In certain implementations, the cleavable region is cleaved using an endonuclease. For example, secondary oligonucleotides (such as...) Figure 11The single-stranded adapter (shown in C) is added to the sample and hybridized with the single-stranded adapter, generating a cleavage site in the cleavable region (e.g., a site that can be cleaved by a restriction endonuclease). In some embodiments, although the majority of the single-stranded adapter is composed of DNA, the cleavage region contains one or more RNA bases, thereby allowing cleavage by RNase H, RNase H2, or a site-specific endonuclease.

[0092] In some embodiments, these methods and compositions preserve the methylation of the 3' and 5' overhangs of the target DNA; for example, the target DNA does not require end repair or A-tail addition. Conventional library preparation uses end repair and A-tail addition (ER / AT) steps as part of its workflow. Figure 16 As shown in A, the enzymatic reaction in ER / AT “writes” the starting DNA template by filling in the 3' indentation or “erases” it by removing the 3' protrusion, thus losing information about potential methylation at the protrusion. The DNA fragment filled during this step does not contain biologically relevant base modifications such as 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC), etc. Therefore, they introduce a dilution effect into CpG sites near the ends of the template DNA. Such artifacts are widespread in routine whole-genome methylation sequencing results (see, for example, Jiang et al., Genome Res. Aug 2020; 30(8): 1144–1153, which is incorporated herein by reference, in particular). Figure 1 Since the methods and compositions described herein do not require ER / AT, no "writing" is involved during the library preparation process. Therefore, no artificial DNA fragments are introduced during the library preparation workflow, and high-fidelity methylome data can be obtained (e.g., via bisulfite and similar methods). In other words, since most methods rely on the bisulfite conversion of DNA to detect unmethylated cytosine (a process that converts unmethylated cytosine to uracil during library preparation), the converted bases (after PCR) are identified as thymine in the sequencing data, and read counts are used to determine the methylated cytosine percentage. Therefore, the methods and compositions described herein allow for more realistic and higher-fidelity methylation detection (e.g., implying more accurate cancer detection).

[0093] In some embodiments, the first and / or second nucleic acid sequences (e.g., the nucleic acid sequences constituting the adaptor) are methylated at each (or nearly each) cytosine present. In some embodiments, the methylation is 5-methylcytosine (5mC) and / or 5-hydroxymethylcytosine (5hmC). For example, such methylation can be introduced during the synthesis of the nucleic acid sequence. During bisulfite conversion (e.g., as part of the bisulfite sequencing method described herein), 5'-methylcytosine (or 5hmC) will not be converted during the conversion step, and the unmodified cytosine will be converted to uracil. The conversion can be chemically based (such as bisulfite conversion) or enzyme-based (such as EM-seq). The methylation of the nucleic acid sequences described herein prevents any elements present in the adaptor (such as flow cell binding sequences and universal primer binding sites) from altering their sequence during bisulfite conversion (or other conversions). In this respect, the adaptor sequence can still bind to the universal primer used and can still bind to the flow cell sequence (e.g., as in an Illumina sequencer). An exemplary workflow for using such methylated nucleic acid sequences is shown in Figure 16 B in.

[0094] In some implementations, rolling circle amplification is performed instead of PCR amplification, such as Figure 18 As shown in A and 18B. In Figure 18 In step A, after the first and second adaptors are ligated to the double-stranded DNA molecule and a dumbbell loop structure is formed, primers designed to anneal with the adaptor sequence are added to initiate rolling circle amplification (RCA), thereby generating multiple copies of tandem single-stranded DNA with the double-stranded DNA template. Figure 18 In step B, after the first and second adaptors are ligated to the double-stranded DNA molecule, the double-stranded DNA is denatured and deblocked / ligated, causing each strand to form a single-stranded loop with the adaptor sequence embedded inside. Primers designed to anneal to the adaptor sequence are added to initiate rolling circle amplification (RCA), thereby generating multiple copies of tandem single-stranded DNA with a strand-specific DNA template.

[0095] experiment Example 1 Single-stranded end-retaining linkers for library preparation In this embodiment, a library preparation method (DISTAL-seq) is described based on a ligation scheme known as "dual-strand-preserving single-stranded tail ligation" (DISTAL ligation). In some embodiments of DISTAL ligation, 5'-adenosylated single-stranded adaptor DNA is ligated to the 3' end of duplex DNA at elevated temperatures (e.g., 75°C) using a step 3 ligase mutant (an advanced ligase in this embodiment), wherein the DNA duplex is still preserved (see [link to DISTAL ligation]). Figure 1and 2 A). Following DISTAL ligation, more efficient intramolecular ligation is readily feasible because the 3' end of the adaptor is brought near the 5' end of the double-stranded DNA. The resulting "dumbbell"-shaped DNA can then be processed for PCR enrichment. Figure 2 A). A unique feature of the DISTAL-seq implementation is that the ligation of the 5' and 3' ends of the library's duplex DNA occurs in single-stranded form, thus eliminating the need for conventional ER / AT.

[0096] Based on the DISTAL-seq implementation, DUET-seq (double-stranded end recovery sequencing) is developed by incorporating a strand-specific unique molecular identifier (UMI, also known as a barcode, which can be unique or non-unique) into a single-stranded linker, so that a portion of the resulting read can pair with its original double-stranded form. Figure 3 A). As a result of strand pairing, native DNA ends were also recovered. To verify this, certain implementations of DUET-seq were shown to recover known DNA ends from restriction enzyme-digested DNA pools without strand exchange. The end profiles of sonicated genomic DNA and enzymatically fragmented DNA were then compared using the DUET-seq implementations, revealing that while the ends of sonicated DNA may have 5'-single-stranded overhangs or 3'-single-stranded overhangs with equal probability and tend to be shorter, the ends from enzymatically fragmented DNA were predominantly 3'-single-stranded overhangs and had a wider length distribution. Finally, the DUET-seq implementations were applied to cell-free plasma DNA samples whose ends were generated and modified from the in vivo environment. Interestingly, 3'-single-stranded overhangs were predominantly observed in cell-free plasma DNA.

[0097] In summary, these embodiments demonstrate the principles and utility of certain implementations of DISTAL ligation, and the library preparation workflows that follow (implementations of DISTAL-seq and DUET-seq). These methods provide a favorable alternative to conventional ER / AT-based NGS preparation methods.

[0098] Methods and Materials Preparation of single-strand linkers In this embodiment, two types of single-stranded adapters were prepared and used: one for the standard DISTAL-seq workflow and one for double-stranded end-recovery sequencing (DUET-seq), as listed in Table 3. All oligonucleotides were ordered from Integrated DNA Technologies (IDT). All oligonucleotides were purified using the Monarch DNA Purification Kit (NEB). For Ampure purification, Ampure XP beads were purchased from Beckman-Coulter.

[0099] Table 3. Single-stranded linker oligonucleotides and PCR primers used in this example.

[0100] 1. Base modification list: / ideoxyU / : internal dU; / idoxylI / : internal dI; / 3Phos / : 3'-phosphate; B=C / G / A; N=A / C / G / T 2. Underlined sites indicate Nb.BbVCI recognition sites.

[0101] To prepare the DISTAL-seq adaptor, ILMNAda2 (Table 3) was resuspended in water to 20 μM. 5'-phosphorylation was performed by mixing 26 μL of ILMNAda2, 3 μL of 10x T4 ligase buffer (NEB), and 1 μL of T4 polynucleotide kinase (without 3' phosphatase) (NEB). The reaction was incubated at 37°C for 1 hour and purified by column chromatography with a 30 μL elution volume. 5'-Adenosylation was performed using the 5'-adenosylation kit (NEB) by mixing 6 μL of phosphorylated ILMNAda2, 2 μL of 10x adenosylation buffer, 2 μL of 1 mM ATP, and 2 μL of Mth RNA ligase in a 20 μL reaction volume. The reaction was incubated at 65°C for 1 hour and then heat-inactivated at 85°C for 5 minutes. The reaction was then purified by column chromatography with a 10 μL elution volume in low TE buffer.

[0102] For the exemplary DUET-seq adapter, dupada_3 (Table 3) was first resuspended in water to 20 μM. 3' extension was performed by mixing 26 μL of dupada_3, 5 μL of 10x reaction buffer, 1 μL of dA / U / C / GTP mixture (10 mM each), and 1 μL of Taq-Klenow (catalog number TT-100, MCLAB) in a total volume of 50 μL. The extension reaction was programmed to first heat to 95 °C for 1 min, then to 68 °C for 10 min. The reaction was purified by column chromatography with a 26 μL elution volume. Since the extension incorporates a single dU into the newly synthesized 3' end, the dU site was subsequently cleaved using USER reagent (NEB) (uracil DNA glycosylase and Endo VIII) to generate a 3'-phosphate terminus. This was accomplished by mixing 26 μL of extended dupada_3, 3 μL of 10x T4 ligase buffer (NEB), 1 μL of T4 polynucleotide kinase (without 3' phosphatase) (NEB), and 0.5 μL of USER reagent (uracil DNA glycosylase and Endo VIII). The reaction was incubated at 37 °C for 40 min, and the column was purified with a 25 μL elution volume. 5'-Adenosylation was performed similarly to the above using a 5'-adenosylation kit (NEB) by mixing 6 μL of 5'- and 3'-phosphorylated dupada_3, 2 μL of 10x adenosylation buffer, 2 μL of 1 mM ATP, and 2 μL of Mth RNA ligase in a 20 μL reaction volume. The reaction was incubated at 65 °C for 1 h, heat-inactivated at 85 °C for 5 min, and then purified with a 10 μL elution volume in low TE buffer.

[0103] DISTAL ligation and DNA substrate preparation The purified advanced ligase was obtained from RGENE Inc. (10). The cloning and purification of the advanced ligase have been described in (10, which is incorporated herein by reference).

[0104] A typical 50 μL advanced ligase ligation consists of the following: 5 μL 10x advanced ligase reaction buffer (700 mM Tris, pH 7.5), 5 μL MnCl2 (100 mM), 5 μL adenylate adaptor (10 μM), 15 μL 40% (w / v) PEG8000, 1.5 μL 5M NaCl, 2.5 μL purified advanced ligase, and 15 μL input sample solution containing double-stranded DNA. The reaction is incubated in a PCR instrument at 75°C (with the heating cap on) for 6 hours. Figure 1The reaction series was incubated at various temperatures in separate runs (without gradient options). The reactions were then purified twice using 1x bead purification and run on Tapestation using a high-sensitivity D1000 screentape (Agilent). For reactions using the thermostable App DNA ligase (catalog number M0319, NEB), the reactions were set up according to the manufacturer's recommendations and incubated at 65°C for 6 hours.

[0105] for Figure 1 The DNA duplex substrate used was used, and primers were designed based on the pBR322 sequence (Table 3). pBR322_4280F and pBR322_4360R were used to generate ~180bp amplicons, and pBR322_4280F and pBR322_85R were used to generate ~320bp amplicons. PCR was performed using Taq2x premixed buffer (catalog number M0270, NEB) and following the manufacturer's recommended protocol. To generate duplex DNA with well-defined 3' and 5' single-stranded overhangs, λ_4500F_3'res / λ_4800R_3'res and λ_4500F_5'res / λ_4800R_5'res were used as primers, and λ DNA was used as a template for PCR. The purified PCR products were then digested with Nb.BbVCI (NEB) at 37°C for 2 hours. The purified, digested DNA with well-defined 3' and 5' single-stranded overhangs was then used for DISTAL ligation. Blunt-end duplex DNA was generated using λ_4500F / λ_4800R as PCR primers, purified, and used for DISTAL ligation.

[0106] DISTAL-seq and DUET-seq library preparation Genomic DNA from *E. coli* strain O157 EDL933 was ordered from Sigma (catalog number IRMM449). Human genomic DNA extracted from blood (erythrocyte sedimentation rate, serotonin layer) was purchased from Sigma (catalog number 11691112001, Roche). Human cell-free plasma DNA was purchased from PlasmaLab International (Everett, WA). Fragmentation was performed using a Covaris M220 or NEBNext dsDNA fragmentation enzyme (NEB catalog number M0348) according to the manufacturer's instructions. For sonicated genomic DNA, an additional round of end-modification was performed by treatment with T4 polynucleotide kinase (PNK) in T4 ligase buffer, followed by purification via bead purification.

[0107] In this embodiment, exemplary DISTAL-seq and DUET-seq started with direct ligation of 50 ng fragmented DNA using advanced ligase. Briefly, the 50 μL reaction consisted of: 5 μL 10x reaction buffer, 5 μL MnCl2, 2.5 μL advanced ligase, 15 μL 40% (w / v) PEG8000, 5 μL adaptor, 1.5 μL 5M NaCl, and 15 μL DNA solution. The reaction was incubated at 75°C for 6 hours and purified by two rounds of 1x Ampure bead purification, with an elution volume of 26 μL (in water). The 3' end of the adaptor was deblocked using 26 μL of DNA from the previous step, 3 μL 10x T4 ligase buffer, and 1 μL T4 PNK. The reaction was incubated at 37°C for 40 min, followed by another 1x bead purification of the reaction mixture, with an elution volume of 10 μL. Circulation was performed using 10 μL of DNA solution from the previous step, 1 μL of 10x cyclase reaction buffer, 0.5 μL of cyclase II, and 0.5 μL of MnCl2 (Biosearch Technologies, catalog number CL9021). The reaction was incubated at 60 °C for 1 hour, followed by a second 1x Ampure purification with an elution volume of 18 μL. Dumbbell-shaped DNA was then digested using 18 μL of DNA solution from the previous step, 2 μL of 10x rCutSmart, and 0.2 μL of endonuclease. For standard DISTAL-seq where the internal dU is embedded within the adaptor, USER reagents (uracil DNA glycosylase and Endo VIII) were used; for DUET-seq where the internal dI is embedded within the adaptor, endonuclease V (catalog number M0305, NEB) was used. The digestion reaction was incubated at 37 °C for 15 min, followed by heat inactivation at 65 °C for 20 min. For PCR enrichment, 25 μL of Kapa HiFiHotStart ReadyMix (KR0370, Roche Sequencing) and 5 μL of UDI primer mixture (part number 10005922, IDT) were added to the digestion reaction mixture. PCR conditions followed the manufacturer's protocol. For E. coli libraries, 12 cycles were performed; for DUET-seq, 16 cycles were performed. After PCR, purification was performed using 0.9x beads.

[0108] Sequencing and data analysis All libraries were quantified by qPCR (KR0405, Roche Sequencing) and merged based on library concentration and planned read allocation. Sequencing was performed on an Illumina NextSeq 500 for 2 x 151 cycles using a high-output kit, following the manufacturer's protocol.

[0109] Table 4 lists the parameters of the programs and commands used to process read segment data.

[0110] Table 4. Calculation programs and commands used for analysis

[0111] In short, firstly by using Trimmomatic (11) Trim the joiner sequence and polyG sequence from the read segment. Then, by using... bwa (12) Align the reads with the reference genome and use... samtools (13) File processing. Comparison and statistics are performed by... Picard Generated using tools(14). By using... fgbio (15) Perform UMI-aware read processing. Use PERL to write a regular script for pairing double-stranded body chains and end recovery.

[0112] result Biochemical characteristics of DISTAL connection In this embodiment, DISTAL ligation was catalyzed by a mutant thermostable single-stranded ligase (referred to as “advanced ligase”), derived from *Butyrica butyrate*, a hyperthermophilic archaea that grows optimally between 95°C and 106°C (16). A lysine-to-alanine mutation was introduced at the catalytic site, enabling the mutant ligase to perform ligation between the 5'-adenosylated end and the 3'-hydroxyl end of single-stranded DNA / RNA only at elevated temperatures (up to 95°C) (10). In (17), a ligase derived from *Methanobacterium thermoautotrophum* was reported... Methanobacterium thermoautotrophicum Another mutant ligase (thermally stable Mth App ligase, NEB catalog number 0319) with an optimal reaction temperature of 65°C was also tested in this embodiment.

[0113] Although the 3'-hydroxy terminus is typically provided by single-stranded DNA, the hypothesis tested here is whether duplex DNA can facilitate ligation at the 3'-terminus catalyzed by single-stranded DNA ligases, where the duplex at the end transiently dissociates into a single-stranded conformation due to thermodynamics ("DNA respiration" (18)). Ideally, the duplex is preserved both before and after ligation (hence the name), which has the advantage of preserving strand pairing signals for subsequent end repair (see DUET-seq below).

[0114] To test the effect of reaction temperature, a DISTAL-linked reaction was set up and incubated for 6 hours at various temperatures. Figure 1 ).like Figure 1As shown in A, both single-sided and double-sided ligation products can be easily observed above the initiating double-stranded DNA substrate (approximately 320 bp) (lane 8). Figure 1 A). This first observation demonstrates that ligation with higher ligases is clearly feasible at elevated temperatures. The intensity of the bilateral ligation product band peaks at 75°C and begins to decrease at higher or lower temperatures. When the reaction temperature drops below 70°C, the ligation reaction becomes inefficient, resulting in almost no observable bilateral ligation product. Figure 1 A). Repeat similar experimental setups for double-stranded DNA of different sizes (~180 bp). Figure 1 B indicates that, overall, smaller-sized double-stranded DNA also exhibits the same trend. Testing with advanced ligases in the 180 bp range is important because for some types of DNA, such as cell-free plasma DNA, most fragments likely fall within this size range.

[0115] For comparison, the ligation of double-stranded DNA to single-stranded DNA was tested using the thermostable Mth App ligase (NEB) at 65°C for 6 hours. However, almost no ligation products were observed (lane 9, Figure 1 A). This observation is consistent with the low ligation efficiency observed below 70°C for higher ligases (A). Figure 1 Together with A and B, this further supports the importance of reaction temperature.

[0116] Quantitative conversion efficiency of advanced ligase ligation, measured by the percentage of conversion from substrate to one-sided or two-sided ligation products, such as... Figure 1 As shown in Figure C, at 75°C, over 80% of double-stranded DNA can be ligated at one or both ends, with 30-40% being bilateral and 40-50% being unilateral. Figure 1 C). Because only bilateral products will be efficiently amplified during PCR (DISTAL-seq, Figure 2 A) This indicates that, for the conditions in this embodiment, the upper limit for converting double-stranded DNA fragments into sequenceable DNA templates is approximately 30% to 40%. Time-sequential experiments show that the ligation products accumulate over time, but appear to reach a stable level after 6-8 hours (data not shown).

[0117] Figure 1A key characteristic of intermediate and higher-order ligase ligation is that ligation can only occur between the 5'-adenosyl terminus of the single-stranded adaptor DNA and the 3'-hydroxy terminus of the double-stranded DNA. The 3'-terminus of the single-stranded adaptor DNA is modified (by 3'-phosphate in this example), preventing self-circularization or cross-tandem coupling of the adaptor. No ATP is added during the ligation reaction, thus preventing the generation of additional 5'-adenosyl terms, which also excludes the possibility of ligation between the input DNA itself, whether single-stranded or double-stranded. This unidirectional characteristic of higher-order ligase ligation improves efficiency and prevents sequencing artifacts caused by chimera formation.

[0118] To investigate the potential impact of end conformation on higher-order ligase ligation, double-stranded DNA with either a 5'-single-stranded overhang or a 3'-single-stranded overhang was prepared by digesting blunt-ended PCR DNA with a nicking enzyme (Nb.BbVCI). Nicking enzyme recognition sites were introduced from the primers used in PCR (Table 3). After digestion, the 5'-single-stranded overhangs had 9-10 nt single-stranded portions on either side of the double-stranded DNA, while the 3'-single-stranded overhangs had 11-12 nt single-stranded portions on either side. The digested DNA was then used as a substrate for higher-order ligase ligation and compared with blunt-ended DNA, as shown in Table 3. Figure 5 As shown in the figure, the results indicate that advanced ligase ligation did not exhibit bias towards the tested ends. This conclusion supports the view that advanced ligase ligation can be used to ligate adaptors to the 3' ends of complex libraries with heterogeneous DNA end conformations.

[0119] DISTAL ligation enables sequencing library preparation (DISTAL-seq). Figure 2 A demonstrates a DISTAL-seq workflow for preparing sequencing libraries based on DISTAL ligation, which can be divided into four stages: (1) advanced ligase ligation, in which a 5'-adenosylated single-stranded adaptor is ligated to the 3' end of the double-stranded library DNA; (2) 3' end deblocking of the adaptor, during which the phosphate group at the 3' end of the adaptor is removed by the phosphatase activity of T4 PNK. Other DNA phosphatases can also be used for this purpose (data not shown); (3) Circular ligation between the proximal 5' end and the 3' end by the single-stranded DNA / RNA ligase cyclase II. Similar to advanced ligase ligation, this ligation step occurs at an elevated temperature (60°C). The difference is that for advanced ligase ligation, this ligation is intramolecular rather than intermolecular; (4) Cutting the adaptor at a pre-designed site by an endonuclease, followed by PCR enrichment (…). Figure 2 A).

[0120] As proof of the principle experiment, the DISTAL-seq workflow was used ( Figure 2 A library was prepared from 50 ng of reference material *E. coli* O157 (EDL933) gDNA and sequenced. Approximately 4.8 million paired-end reads were obtained (2.4 million in each direction) and aligned with the reference genome. The average coverage was approximately 85x, and the median coverage was approximately 95x. Figure 2 C). The segment mapping is of high quality, with a low error rate (PF_HQ_ERROR_RATE=0.0064, PF_INDEL_RATE=0.00010) and a low chimerism rate (PCT_CHIMERAS=0.003). All metrics are derived from Picard Tools. CollectAlignmentMetrics Report). Figure 6 The distribution of insert size is shown, consistent with the expected 300 bp size range during sonication. Moderate GC bias was observed in both high and low GC regions, with normalized coverage decreasing to approximately 0.5 at either extreme. Figure 7 Nevertheless, GC bias does not appear to significantly affect overall coverage uniformity, as >90% of bases have a coverage rate more than 0.2 times that of the average coverage rate (17x). Figure 2 D).

[0121] To investigate sequence-specific bias in both advanced ligase ligation and circular ligation, randomized nucleotide extensions (NNNNN, N=A / T / C / G) were designed at the 5' and 3' ends of single-stranded adaptors. Reads 1 and 2 mapped from *E. coli* DISTAL-seq data were aligned, and the sequence environment on either side of the ligation site was analyzed to detect potential bias. Figure 2 C). For example Figure 2 As shown in Figure C, there is no significant sequence bias at the join site on the genomic insert side. For DISTAL or circular joins, there is a slight sequence bias on the adaptor side, which is not a concern and may be related to the synthetic degenerate adaptor itself. Additionally, the degenerate regions at both ends of the adaptor provide further utility as unique molecular identifiers (UMIs) and can be used for further error suppression. Figure 2 D).

[0122] Because several steps during the preparation of this exemplary DISTAL-seq library require prolonged incubation at elevated temperatures (6 hours at 75°C for advanced ligase ligation and 1 hour at 60°C for cyclase II reaction), a potential concern is the potential for heat-induced DNA damage, including but not limited to C>T conversions and G>T transversions (19). To address this, DISTAL-seq data from a reference genomic material (E. coli O157 (EDL 933)) were used, and mutations were retrieved from the sequencing data (see Methods). Figure 2 As shown in E, all possible mutation types are at a relatively comparable level, indicating that the effect of heat as an artificial source of mutation is negligible. The allele fractions for each mutation type are shown in... Figure 8 Furthermore, since the UMI is designed to be at both ends of the DISTAL-seq connector, further error suppression can be achieved by grouping reads with the same UMI. Figure 2 E).

[0123] Double-stranded end recovery sequencing (DUET-seq) and validation Double-stranded sequencing employs a strategy where each strand is labeled with a different but corresponding UMI, allowing the two strands to pair during analysis (5). Double-stranded sequencing has been used to detect rare genomic mutations with high positive predictive value (PPV) (5) and has proven valuable in various research and clinical applications. As previously mentioned, with current double-stranded sequencing library preparation methods, native ends are filled in or cut off to blunt ends, making these ends irrecoverable after double-stranded reconstruction. The principle of DISTAL-seq provides a feasible framework in which double-stranded and native end recovery sequencing (DUET-seq) can be made possible if the strands can pair.

[0124] Figure 3 A demonstrates an exemplary adaptor design and preparation process for DUET-seq. Chain-specific UMIs are complementary to each other via primer extension. A single dU base is present in the newly synthesized moiety, which can then be cleaved by USER reagents (uracil DNA glycosylase and Endo VIII) to generate a closed 3'-phosphate terminus. Figure 3 A). The remaining portion of the template used for primer extension is designed so that no additional dU is incorporated, thus avoiding unintended USER cleavage. Additionally, due to dU incorporation, a single dI is designed into the loop region and can be readily cleaved by endonuclease V. The 5' end of the DUET-seq adaptor can be enzymatically phosphorylated and adenylated (…). Figure 3A). Similar to the DISTAL-seq library preparation process, since both ligation is performed at elevated temperatures (75°C for higher ligases and 60°C for cyclases), it is generally expected that the DUET-seq adaptor will be in single-stranded form rather than stem-loop form and will be ligated to each strand separately.

[0125] The reading segment structure and chain pairing diagram are also included. Figure 3 As shown in A. If the coordinates of two sets of paired reads overlap by more than the heuristic threshold (150 bp used in this study), and they share the same set of UMIs with AB and BA structures (read 1 UMI - read 2 UMI), then the two sets of paired reads are considered to originate from the same double strand.

[0126] To validate DUET-seq, a mixture of DNA with known ends was used: λ DNA (48 kb) digested with FauI (CCCGC(N)4↓ / GGGCG(N)6↓) was incorporated into λ DNA digested with AluI (AG↓CT / TC↓GA) at a ratio of 1:2000. FauI was expected to generate 2-nt 3'-single-stranded overhangs, while AluI was expected to generate blunt ends. In a 50 ng starting DNA mixture used for DUET-seq, at 9 x 10⁻⁶... 8 Approximately 4.5 x 10⁻⁶ copies of the AluI-digested genomic equivalent were present in the background. 5 One copy of the FauI-digested genomic equivalent. The theoretical diversity of barcode combinations from DUET-seq adaptors is 4 x 10^6. 7 ( Figure 3 A). Therefore, for FauI-digested DNA fragments, fragments sharing the same start and end coordinates are unlikely to be labeled with the same unique set of UMI combinations. For other applications with much larger genome sizes, such as human genomic DNA, 50 ng contains approximately 1.39 x 10⁻⁶ kilobytes per cubic centimeter. 4 The amount of a single copy of the haploid genome is far less than the diversity of barcode combinations. The possibility of "UMI conflict" is not a major concern. The goal of the validation experiment is to test whether DUET-seq can faithfully recover the FauI-digested duplex and restore the FauI cutting pattern.

[0127] Double-strand sequencing has been reported to be inefficient in recovering both strands and often requires excessive sequencing (20). During DUET-seq, an additional step of exonuclease treatment can be added before the endonuclease V digestion step (…). Figure 3B). Unligated and partially ligated products, but not fully ligated products, are substrates for exonucleases I and III and are subject to degradation. The benefit of exonuclease treatment is the enrichment of fully ligated DNA strands, allowing for sequencing of both strands and their representation in the sequencing data. Figure 3 C shows the Tapestation traces of λ DUET-seq libraries with and without exonuclease treatment. These libraries were then sequenced, showing 3.1 M paired reads (median coverage ~250x) on the Exo-Duet-seq library and 2.9 M paired reads (median coverage ~250x) on the Exo+DUET-seq library.

[0128] Compared to 11 bistranded FauI-digested fragments, chain pairing analysis identified one bistranded FauI-digested fragment from the Exo-library, representing approximately 10-fold enrichment in bistrand recovery. For the bistranded FauI-digested fragments identified from both libraries, both strands of the bistrand originated from genuine FauI cuts, with no chain exchange between the FauI-digested and AluI-digested strands. Signed single-strand end lengths ( Figure 3 D) indicates that most ends are 3'-single-stranded overhangs with 2-nt overhangs, while a small subset show 3-nt overhangs. The observation of 3-nt overhangs is interesting because type IIs-like restriction enzymes (FauI) are known to wobble at their cleavage sites (21). However, the relatively low sequencing depth may also have contributed to sampling bias. Overall, these results support the ability of DUET-seq to recover duplex DNA and the native ends associated with duplexes.

[0129] Applications of DUET-seq in human genomic DNA and cell-free DNA Finally, this exemplary DUET-seq was applied to some real-world samples to analyze the state of native ends. First, DUET-seq was used to compare the end profiles between sonicated genomic DNA and enzymatically fragmented genomic DNA. For example... Figure 4 As shown in Figure A, most DNA fragments in sonicated genomic DNA have blunt ends or ends with short single-stranded overhangs (2-3 nt). The proportion of 5'-single-stranded overhangs or 3'-single-stranded overhangs is almost equal. However, most ends of enzymatically fragmented genomic DNA are 3'-single-stranded overhangs, with a much wider size distribution of single-stranded overhangs. The dominant peak at -1 nt represents a 1-base 3'-single-stranded overhang, accounting for ~10% of all ends. The nature of the 3'-single-stranded overhangs at the ends may reflect the nuclease preference in the fragmentation enzyme product mixture. Figure 9 and 10Insert size distributions for sonicated and enzymatically fragmented libraries are shown, and they are similar. Although both fragmentation methods are widely used in NGS library preparation, the results of this paper indicate that identifying significant differences in the end patterns generated by the two methods is important, as they may lead to different levels of end repair during ER / AT.

[0130] Interestingly, for cell-free plasma DNA, the first observation was that its terminal pattern showed a striking similarity to that of enzymatically fragmented DNA: most ends were 3'-single-stranded overhangs, with the main peak at -2 nt (~10%). This served as a quality check for the DUET-seq library. Figure 4 Figure B shows the insert size distribution of the cell-free DNA library. The figure clearly shows the characteristic ~170 bp mononucleosome main peak and ~340 bp binucleosome secondary peak, consistent with previous reports (22). Attempts were made to look for sequence motifs near the 5' and 3' ends, but no significant findings were made (data not shown). The size distribution of single-stranded dangling ends also showed similarities between the two types of DNA: for cell-free DNA (min = -47 nt, maximum = 37 nt, mean = -7.9 nt) and for enzymatically fragmented DNA (min = -118 nt, maximum = 49 nt, mean = -8.7 nt). Most ends had single-stranded end lengths within the (-25, 2) interval ( Figure 4 B). Compared with previous reports on the distribution of end lengths ((3) Figure 5 Compared to A), one of the main differences is that fragments with long single-chain dangling (>30nt) are very rare in the results here.

[0131] The ligation of adaptors with well-defined sequences to library DNA is crucial for advancing creative methods to prepare sequenceable libraries for probing genomic alterations. Numerous ligation strategies have been described, including duplex-to-duplex ligation (such as A / T ligation, blunt-end-to-blunt ligation, etc.) and single-strand ligation (e.g., splint-mediated or direct single-strand-to-single-strand ligation). Here, an alternative strategy is described in which a single-stranded adaptor is directly ligated to duplex DNA. This is referred to as DISTAL (single-tail-preserving duplex) ligation. As illustrated in this embodiment, DISTAL ligation enables sequencing library preparation workflows where conventional end-repair is no longer required.

[0132] Reaction temperature plays a role in the efficiency of driving DISTAL connections, such as Figure 1As shown. It appears that advanced ligase ligation occurs within a temperature window of approximately 75°C. Lower temperatures may affect the thermodynamics of DNA ends by reducing the duration of “respiration,” thereby decreasing the accessibility of the 3'-end. This conclusion is supported by evidence that the efficiency of advanced ligases decreases significantly at 65°C, and that thermostable Mth App ligases are observed to be unable to drive ligation at 65°C. On the other hand, much higher temperatures may increase the likelihood of separating the entire duplex and lead to bias in sequencing data. Indeed, when DISTAL ligation was performed at 80°C, DISTAL-seq data using E. coli gDNA showed a higher GC bias in the high GC region (data not shown). Other experimental techniques that can be employed to lower the duplex melting temperature, such as betaine supplementation or the use of thermostable single-strand binding proteins, are possible.

[0133] Another key element of DISTAL ligation is the selection of a thermostable ligase capable of linking two single-stranded DNA molecules. In this embodiment, a thermostable mutant ligase with a wide range of temperature tolerance was selected to achieve advanced ligase ligation (10). Furthermore, the mutation at the catalytic lysine residue in the enzyme determines the unidirectional link between the 5'-adenylate terminus and the 3'-hydroxy terminus, thereby minimizing the chance of unwanted byproduct formation. Other enzymes with similar characteristics may also be suitable for this purpose through database mining.

[0134] DISTAL ligation implementations allow for deeper insights into adaptor design used for sequencing library preparation. For example, unlike conventional Y-adaptors, which require short double strands due to substrate requirements of the T4 DNA ligase, ligation in DISTAL-seq implementations is typically performed in two separate steps, with the substrate in single-stranded DNA in either step. In certain implementations, substrate requirements may render the double-stranded portion of conventional Illumina adaptors unnecessary. This can have the added benefit of reducing adaptor length and adaptor dimer length, thereby enabling more efficient removal of adaptor dimers through size selection.

[0135] Although the DISTAL workflow is designed for ligation with duplex DNA, it does not preclude the ligation of single-stranded DNA from the starting material with adaptors. The products of these ligations can then undergo subsequent library preparation steps for amplification and sequencing. Therefore, DISTAL-seq and DUET-seq data may have captured both duplex and single-stranded DNA populations from the starting material. In fact, for cell-free plasma DNA, such as… Figure 4As shown in B, in addition to mononuclear and binuclear cfDNA, there are sequencing inserts in a small size range (such as less than 50 bp) that may have already undergone the DISTAL workflow as single-stranded to single-stranded ligation. These inserts may be present as part of single-stranded DNA or as part of nicked double-stranded DNA in the starting cfDNA sample (23).

[0136] For DUET-seq, note that, as proof of principle, chain-specific UMIs are designed to be complementary via primer extension to facilitate synthesis. Figure 3 A). However, due to the nature of the separate linking steps, chain-specific UMIs do not need to be complementary. As long as there is a corresponding table linking two different UMIs, chains from the same duplex can be paired during computational analysis. For example, multiple adaptor oligonucleotides, each with different 5'- and 3'-UMIs, can be designed and synthesized and combined for DUET-seq. Given the advances in high-throughput oligonucleotide synthesis, this provides another pathway for DUET-seq adaptor preparation.

[0137] Finally, since ER / AT is not used in library preparation, DISTAL-seq can be extended to workflows for reading epigenetic base modifications. For the collected dataset, no dilution of epigenetic signals is expected, particularly at the beginning of read 2, as observed in (3). Such high-fidelity epigenomic datasets should be useful for elucidating epigenetic changes in disease processes, especially in early onset. Current examples include sequencing genetics. For instance, when the adaptor is methylated, examples of sequencing the epigenome can be demonstrated.

[0138] References All publications and patents mentioned in and / or listed below are incorporated herein by reference. Various modifications and variations of the methods and systems described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in conjunction with specific embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. Indeed, various modifications to the modes of carrying out the invention that will be apparent to those skilled in the art are intended to be within the scope described herein.

Claims

1. A method for linking an adaptor to a DNA duplex molecule while retaining a 5' or 3' single-stranded overhang, the method comprising: a) Generate a sample comprising: a DNA double-stranded molecule, a first single-stranded adaptor, and a single-stranded ligase. The single-stranded ligase described therein has the ligase activity of step 3 but not the adenosine transfer activity of step 2. The DNA double-stranded molecule comprises: i) a first double-stranded end, the first double-stranded end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second double-stranded end, the second double-stranded end comprising a 3' end and a 5' end, the second double-stranded end optionally having a 3' or 5' single-stranded overhang. The first single-stranded linker comprises a first nucleic acid sequence and a 3' end blocking group attached to the 3' end of the first nucleic acid sequence. The 5' end of the first nucleic acid sequence is adenylated, and The first nucleic acid sequence includes: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, and b) Incubate the sample at a certain temperature so that the single-stranded ligase connects the 5' end of the first single-stranded linker to the 3' end of the first double-stranded linker.

2. The method of claim 1, further comprising: c) Optionally, the sample is contacted with a deblocking agent that removes or modifies the 3'-terminal blocking group such that the 3' end of the first single-chain linker contains a 3' end available for connection; d) Contact the sample with a ligase that connects the 3' end of the first single-stranded linker to the 5' end of the first double-stranded end, thereby generating a first loop-like structure at the first double-stranded end of the DNA double-stranded molecule; as well as e) Optionally, the sample is contacted with one or more enzymes such that the cleavable region of the first nucleic acid sequence is cleaved, thereby generating a first two-part adapter at the end of the first duplex, retaining the 3' or 5' single-stranded overhang at the end of the first duplex, wherein the first two-part adapter comprises: i) The 5' region of the first nucleic acid sequence linked to the 3' end of the first double-stranded end of the DNA double-stranded molecule, and ii) The 3' region of the first nucleic acid sequence connected to the 5' end of the first double-stranded end of the DNA double-stranded molecule.

3. The method of claim 2, wherein the sample in a) further comprises a second single-stranded adapter, wherein the second single-stranded adapter comprises a second nucleic acid sequence and optionally a 3' blocking group attached to the 3' end of the second nucleic acid sequence. The 5' end of the second nucleic acid sequence is adenylated, and The second nucleic acid sequence includes: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, and Optionally, the first and / or second nucleic acid sequences are methylated at each or nearly every cytosine present in the first and / or second nucleic acid sequences, and in: i) During step b), the single-stranded ligase connects the 5' end of the second single-stranded adapter to the 3' end of the second double-stranded assembly. ii) Optionally, during step c), the deblocking agent removes or modifies the 3'-terminal blocking group such that the 3' end of the second single-chain linker includes a 3' end available for connection; and iii) Optionally during step d), the ligase connects the free 3' end of the second single-stranded adapter to the 5' end of the second duplex of the DNA duplex molecule, thereby generating a second loop-like structure at the second duplex end of the DNA duplex molecule.

4. The method of claim 3, wherein during step e), the one or more enzymes cleave the cleavable region of the second nucleic acid sequence to generate a second two-part adaptor at the end of the second double-stranded structure, wherein the second two-part adaptor comprises: i) the 5' region of the second nucleic acid sequence connected to the 3' end of the second double-stranded end of the DNA double-stranded molecule, and ii) The 3' region of the second nucleic acid sequence connected to the 5' end of the second double-stranded end of the DNA double-stranded molecule.

5. The method of claim 1, wherein the length of the 3' or 5' single-stranded overhang is exactly or at least 3 nucleotides, and optionally, the length of the 3' or 5' single-stranded overhang is exactly or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 20 nucleotides.

6. The method of claim 2, wherein the 5' region and 3' region of the first two-part connector are substantially or completely non-hybridized to each other.

7. The method of claim 6, wherein when the 5' region and the 3' region do not hybridize with each other, the first two portions of the connective tissue are generally V-shaped; wherein when the 5' region and the 3' region hybridize with each other, the first two portions of the connective tissue are generally Y-shaped.

8. The method of claim 4, wherein the 5' region and 3' region of the second two-part connector are substantially or completely non-hybridized to each other.

9. The method of claim 8, wherein when the 5' region and the 3' region do not hybridize with each other, the second two-part connective is generally V-shaped; wherein when the 5' region and the 3' region hybridize with each other, the first two-part connective is generally Y-shaped.

10. The method of any one of claims 1-9, wherein the cleavable region comprises: A) the modified non-canonical base; B) a backbone link of the nucleic acid sequence, optionally a thiophosphate bond or a phosphodiester bond; or C) an endonuclease recognition site, wherein the endonuclease recognition site is formed at the junction of the 5' and 3' regions or is composed of a sequence between the 5' and 3' regions; or D) one or more RNA bases, wherein optionally, the remainder of the first and second nucleic acid sequences is composed of DNA; or E) a sequence that, when a secondary oligonucleotide is added, forms an endonuclease recognition sequence.

11. The method of any one of claims 1-9, wherein the DNA duplex molecule is not subjected to end repair and / or A-tail addition.

12. The method of any one of claims 1-9, wherein the temperature of the incubation is sufficient to cause the ends of the first and / or second duplexes to separate instantaneously.

13. The method of any one of claims 1-9, wherein the temperature of the incubation is between 70 and 80 degrees Celsius, or about 75 degrees Celsius.

14. The method of any one of claims 1-13, wherein the single-stranded ligase is a thermostable lysine mutant ssDNA / RNA ligase, which is a mutant form of the precursor thermostable ssDNA / RNA ligase, wherein the precursor thermostable ssDNA / RNA ligase has motif I EKx(D / N / H)G, and wherein the thermostable lysine mutant replaces K in motif I with any other amino acid, or is selected from alanine (A), serine (S), cysteine ​​(C), valine (V), threonine (T), and glycine (G).

15. The method of any one of claims 1-13, wherein the single-stranded ligase has at least 95% or 99% or 100% identical amino acid sequence to any one of SEQ ID NO:1-21.

16. The method of any one of claims 1-5, wherein the DNA duplex molecule is cell-free DNA (cfDNA) from the subject, and wherein the first and second duplex ends of the DNA duplex molecule are not altered by the addition or deletion of nucleotides.

17. The method of claim 16, wherein the subject is a human, and optionally wherein the cell-free DNA double strand is extracted from a bodily fluid, which is optionally plasma, urine, blood, or CSF.

18. The method of any one of claims 1-17, wherein the single-stranded ligase is a naturally occurring enzyme or a mutant thereof.

19. The method of any one of claims 1-18, wherein the first duplex end of the DNA duplex molecule has a 3' single-stranded overhang, the 3' single-stranded overhang optionally comprising at least one methylated cytosine.

20. The method of any one of claims 1-18, wherein the first duplex end of the DNA duplex molecule has a 5' single-stranded overhang, the 5' single-stranded overhang optionally comprising at least one methylated cytosine.

21. The method of any one of claims 1-20, wherein the second duplex terminus of the DNA duplex molecule has a 3' single-stranded overhang, the 3' single-stranded overhang optionally comprising at least one methylated cytosine.

22. The method of any one of claims 1-21, wherein the second duplex terminus of the DNA duplex molecule has a 5' single-stranded overhang, the 5' single-stranded overhang optionally comprising at least one methylated cytosine.

23. The method of any one of claims 1-22, wherein the first and / or second single-chain linker comprises the 3' end blocking group, and wherein the c) is performed.

24. The method of any one of claims 1-23, wherein the first and / or second single-chain linker does not have the 3' blocking group, and step c is not performed.

25. The method of any one of claims 1-23, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise at least one element selected from: flow cell ligation sequence, unique barcode sequence, non-unique barcode sequence, sample identification index sequence, read 1 primer binding sequence, read 2 primer binding sequence, and universal PCR amplification primer binding sequence.

26. The method of any one of claims 1-23, wherein the 5' region and the 3' region of the first nucleic acid sequence each comprise a barcode sequence, and optionally wherein the barcode sequences have a predefined relationship with each other, and optionally wherein the barcode sequences are not complementary to each other, and optionally wherein the barcodes have different lengths, and optionally wherein the barcodes are identical.

27. The method of claim 2, further comprising: The sample is brought into contact with primers, which hybridize with at least a portion of the 3' and 5' regions of the first nucleic acid sequence of the first two-part adapter, and PCR amplification is performed to generate an amplicon.

28. The method of claim 4, further comprising: The sample is brought into contact with primers, which hybridize with at least a portion of the 3' and 5' regions of the first and second nucleic acid sequences of the first and second intercalators, and PCR amplification is performed to generate amplicon; And / or the method further includes: contacting the sample with primers, the primers hybridizing with at least a portion of the 3' and 5' regions of the first and second nucleic acid sequences of the first and second intercalators, and performing rolling circle amplification to generate an amplicon.

29. The method of any one of claims 3-26, wherein the 5' region and 3' region of the second nucleic acid sequence each comprise at least one element selected from: flow cell ligation sequence, unique barcode sequence, non-unique barcode sequence, sample identification index sequence, read 1 primer binding sequence, read 2 primer binding sequence, and universal PCR amplification primer binding sequence.

30. The method of any one of claims 3-26, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise barcode sequences having a predefined relationship with each other, the predefined relationship optionally being based on a predefined association that can be a lookup table.

31. The method of claim 28, wherein the amplicon comprises a barcode, and the method further comprises: The amplicon is sequenced to generate reads, the reads are grouped at least in part based on the barcode, and the original top and bottom strands of the DNA duplex molecule are optionally identified.

32. The method of claim 31, further comprising: The original first and second ends of the DNA double-stranded molecule were determined by calculation.

33. The method of any one of claims 1-33, wherein the 3'-terminal blocking group is selected from nucleotides having a 3'-phosphate group and nucleotide reversible terminators.

34. The method of any one of claims 1-33, wherein the deblocking agent is selected from: enzymes having phosphatase activity, optionally selected from: T4 polynucleotide kinase, calf intestinal alkaline phosphatase (CIP), shrimp alkaline phosphatase (SAP); and chemical or physical agents for deblocking nucleotide reversible terminators, optionally buffered sodium nitrate or UV light.

35. The method of any one of claims 1-34, wherein the ligase is selected from: cyclase I, cyclase II, Mth DNA ligase, RtcB ligase or homolog from Escherichia coli, thermostable RtcB or homolog, Taq DNA ligase, T4 RNA ligase 1, and T4 RNA ligase 2.

36. The method according to any one of claims 2-35, wherein the one or more enzymes are selected from: endonuclease, endonuclease V, endonuclease VIII, endonuclease and uracil DNA glycosylase, thermostable oxoguanine glycosylase (OGG) and iodine.

37. A composition comprising: a) A plurality of single-stranded adapters, wherein each of the single-stranded adapters comprises a nucleic acid sequence and optionally a 3' end blocking group attached to the 3' end of the nucleic acid sequence, wherein the 3' end blocking group is optionally a modified non-canonical nucleotide or a phosphate group. The 5' end of the nucleic acid sequence is adenylated, and The nucleic acid sequence comprises a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions. Optionally, the nucleic acid sequence is methylated at each or nearly every cytosine present in the nucleic acid sequence; and b) A single-stranded ligase, wherein the single-stranded ligase has the ligase activity of step 3 but not the adenosine transfer activity of step 2.

38. The composition of claim 37, wherein the cleavable region comprises: A) the modified non-canonical base; B) a backbone link; or C) an endonuclease recognition site, wherein the endonuclease recognition site is formed at the junction of the 5' and 3' regions or consists of a sequence between the 5' and 3' regions; or D) one or more RNA bases, wherein optionally, the remainder of the first and second nucleic acid sequences consists of DNA; or E) a sequence that, when a secondary oligonucleotide is added, forms an endonuclease recognition sequence.

39. The composition of any one of claims 37 and 38, wherein the single-stranded ligase is a thermostable lysine mutant ssDNA / RNA ligase, which is a mutant form of the precursor thermostable ssDNA / RNA ligase, wherein the precursor thermostable ssDNA / RNA ligase has the motif I EKx(D / N / H)G, and wherein the thermostable lysine mutant is replaced by any other amino acid in place of K in the motif I, or selected from alanine (A), serine (S), cysteine ​​(C), valine (V), threonine (T), and glycine (G).

40. The composition of any one of claims 37-39, wherein the single-stranded ligase has at least 95% or 100% identical amino acid sequence to any one of SEQ ID NO: 1-21.

41. The composition of any one of claims 37-40, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise at least one element selected from: flow cell ligation sequence, unique barcode sequence, non-unique barcode sequence, sample identification index sequence, read 1 primer binding sequence, read 2 primer binding sequence, and universal PCR amplification primer binding sequence.

42. The composition of any one of claims 37-41, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise barcode sequences having a predefined relationship with each other, the predefined relationship optionally being based on a predefined association that can be a lookup table, and optionally wherein the barcode sequences are not complementary to each other, and optionally wherein the barcodes have different lengths.

43. The composition of any one of claims 37-42, wherein the 3' end blocking group is present.

44. The composition of claim 43, wherein the 3'-terminal blocking group is selected from: nucleotides having a 3'-phosphate group and nucleotide reversible terminators.

45. The composition of any one of claims 43-44, wherein the composition further comprises a deblocking agent.

46. ​​The composition of any one of claims 37-45, wherein the composition further comprises a ligase selected from the group consisting of: cyclase I, cyclase II, RtcB ligase or homolog from Escherichia coli, thermostable RtcB or homolog, TS2126 RNA ligase and Mth DNA ligase, T4 RNA ligase 1 and T4 RNA ligase 2.

47. The composition of any one of claims 37-46, wherein the composition further comprises one or more enzymes capable of cleaving the cleavable region of the nucleic acid sequence.

48. The composition of claim 47, wherein the one or more enzymes are selected from: endonucleases, endonuclease V, endonuclease VIII, endonucleases and uracil DNA glycosylases and thermostable oxoguanine glycosylase (OGG).

49. The composition of any one of claims 37-48, further comprising a plurality of DNA duplex molecules, wherein each of the DNA duplex molecules comprises: i) a first duplex terminus comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang or a blunt end; and ii) a second duplex terminus comprising a 3' end and a 5' end, the second duplex terminus optionally having a 3' or 5' single-stranded overhang or a blunt end, and optionally, any or all of the overhangs comprising at least one methylated cytosine.

50. The composition of claim 49, wherein each DNA double-stranded molecule comprises a loop-like structure at the first and second double-stranded ends, wherein the loop-like structure is composed of the acid sequence.

51. A composition comprising: a plurality of DNA double-stranded molecules, said plurality of DNA double-stranded molecules being fragmented genomic DNA double-stranded molecules and / or cell-free DNA double-stranded molecules, Each of the aforementioned DNA duplex molecules comprises: i) a first duplex end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second duplex end comprising a 3' end and a 5' end, the second duplex end optionally having a 3' or 5' single-stranded overhang or a blunt end. Any or all of the protrusions contain at least one methylated cytosine, and Neither the first nor the second duplex terminus was altered by adding or deleting nucleotides, and One of the following situations exists: i) Each of the DNA double-stranded molecules comprises a loop-like structure at the first and second ends of the double strand, wherein the loop-like structure consists of a nucleic acid sequence comprising: The 5' region, the 3' region, and the cleavable region between the 5' and 3' regions, and optionally wherein the nucleic acid sequence is methylated at each or nearly every cytosine present in the nucleic acid sequence; or ii) wherein each of the DNA duplex molecules comprises a first two-part adapter at the end of the first duplex, wherein each first two-part adapter comprises: A) The 5' region of the nucleic acid sequence linked to the 3' end of the first double-stranded end of the DNA double-stranded molecule, and B) The 3' region of the first nucleic acid sequence linked to the 5' end of the first double-stranded end of the DNA double-stranded molecule, and Optionally, the nucleic acid sequence is methylated at each or almost every cytosine present in the nucleic acid sequence.

52. The composition of claim 51, wherein, For part ii), each DNA double-stranded molecule further comprises a second two-part adapter at the end of the second double strand, wherein each second two-part adapter comprises: A) The 5' region of the second nucleic acid sequence connected to the 3' end of the second double-stranded end of the DNA double-stranded molecule, and B) The 3' region of the second nucleic acid sequence connected to the 5' end of the second double-stranded end of the DNA double-stranded molecule.

53. The composition of claim 51 or 52, wherein the cleavable region comprises: A) a modified non-canonical base; B) a nucleic acid backbone linker; or C) an endonuclease recognition site, wherein the endonuclease recognition site is formed at the junction of the 5' and 3' regions or consists of a sequence between the 5' and 3' regions; or D) one or more RNA bases, wherein optionally, the remainder of the first and second nucleic acid sequences consists of DNA; or E) a sequence that, when a secondary oligonucleotide is added, forms an endonuclease recognition sequence.

54. The composition of any one of claims 51-53, wherein the fragmented genome or cell-free DNA double strand is derived from a human or mammalian species, optionally from a bodily fluid sample, said bodily fluid sample optionally being plasma, blood, urine or semen.

55. The composition of any one of claims 51-54, wherein the 5' region and 3' region of the nucleic acid sequence each comprise at least one element selected from: flow cell ligation sequence, unique barcode sequence, non-unique barcode sequence, sample identification index sequence, read 1 primer binding sequence, read 2 primer binding sequence, and universal PCR amplification primer binding sequence.

56. The composition of any one of claims 51-55, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise barcode sequences having a predefined relationship with each other, the predefined relationship optionally being based on a predefined association that can be a lookup table, and optionally wherein the barcode sequences are not complementary to each other, and optionally wherein the barcodes have different lengths.

57. The composition of any one of claims 51-56, wherein the composition further comprises one or more enzymes capable of cleaving the cleavable region of the nucleic acid sequence.

58. The composition of claim 57, wherein the one or more enzymes are selected from: endonuclease, endonuclease V, endonuclease VIII, endonuclease and uracil DNA glycosylase and thermostable oxoguanine glycosylase (OGG) and iodine.

59. A reagent kit or system comprising: a) A plurality of single-stranded adapters, wherein each of the single-stranded adapters comprises a nucleic acid sequence and optionally a 3' end blocking group attached to the 3' end of the nucleic acid sequence, wherein the 3' end blocking group is optionally a modified non-canonical nucleotide or a phosphate group. The 5' end of the nucleic acid sequence is adenylated, and The nucleic acid sequence comprises a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, and optionally is methylated at each or nearly every cytosine present in the nucleic acid sequence; and b) A single-stranded ligase, wherein the single-stranded ligase has the ligase activity of step 3 but not the adenosine transfer activity of step 2.

60. The kit or system of claim 59, wherein the cleavable region comprises: A) a modified non-canonical base; B) a nucleic acid backbone linker; or C) an endonuclease recognition site, wherein the endonuclease recognition site is formed at the junction of the 5' and 3' regions or consists of a sequence between the 5' and 3' regions; or D) one or more RNA bases, wherein optionally, the remainder of the first and second nucleic acid sequences consists of DNA; or E) a sequence that, when a secondary oligonucleotide is added, forms an endonuclease recognition sequence.

61. The kit or system of any one of claims 59 and 60, wherein the single-stranded ligase is a thermostable lysine mutant ssDNA / RNA ligase, which is a mutant form of the precursor thermostable ssDNA / RNA ligase, wherein the precursor thermostable ssDNA / RNA ligase has the motif I EKx(D / N / H)G, and wherein the thermostable lysine mutant replaces K in the motif I with any other amino acid, or is selected from alanine (A), serine (S), cysteine ​​(C), valine (V), threonine (T), and glycine (G).

62. The kit or system according to any one of claims 59-62, wherein the single-stranded ligase has 95% or 100% identical amino acid sequence to any one of SEQ ID No: 1-21.

63. The kit or system according to any one of claims 59-62, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise at least one element selected from: flow cell ligation sequence, unique barcode sequence, non-unique barcode sequence, sample identification index sequence, read 1 primer binding sequence, read 2 primer binding sequence, and universal PCR amplification primer binding sequence.

64. The kit or system of any one of claims 59-63, wherein the 5' region and 3' region of the first nucleic acid sequence each comprise barcode sequences having a predefined relationship with each other, the predefined relationship optionally being based on a predefined association that can be a lookup table, and optionally wherein the barcode sequences are not complementary to each other, and optionally wherein the barcodes have different lengths.

65. The kit or system of any one of claims 59-64, wherein the 3' end blocking group is present.

66. The kit or system of claim 65, wherein the 3'-terminal blocking group is selected from: nucleotides having a 3'-phosphate group and nucleotide reversible terminators.

67. The kit or system according to any one of claims 59-66, wherein the kit or system further comprises a deblocking agent.

68. The kit or system according to any one of claims 59-67, wherein the kit or system further comprises a ligase selected from: cyclase I, cyclase II, RtcB ligase or homolog from Escherichia coli, thermostable RtcB or homolog, TS2126 RNA ligase and Mth DNA ligase, T4 RNA ligase 1 and T4 RNA ligase 2.

69. The kit or system according to any one of claims 59-67, wherein the kit or system further comprises one or more enzymes capable of cleaving the cleavable region of the nucleic acid sequence.

70. The kit or system of claim 69, wherein the one or more enzymes or reagents are selected from: endonuclease, endonuclease V, endonuclease VIII, endonuclease and uracil DNA glycosylase and thermostable oxoguanine glycosylase (OGG) and iodine.

71. The kit or system of any one of claims 59-70, further comprising a plurality of DNA duplex molecules, wherein each of the DNA duplex molecules comprises: i) a first duplex terminus comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second duplex terminus comprising a 3' end and a 5' end, the second duplex terminus optionally having a 3' or 5' single-stranded overhang or a blunt end, and optionally, any or all of the overhangs comprising at least one methylated cytosine.

72. The kit or system of claim 71, wherein each DNA double-stranded molecule comprises a loop-like structure at the first and second double-stranded ends, wherein the loop-like structure is composed of the acid sequence.

73. The kit or system of any one of claims 59-73, further comprising one or more containers for containing the listed components together or separately, optionally wherein the components are present within the containers.

74. The kit or system of claim 73, wherein the one or more containers are selected from cardboard boxes, plastic bags or plastic containers, glass vials and plastic vials.

75. A method for linking an adaptor to a DNA duplex molecule while retaining the 5' or 3' single-stranded overhang of the DNA duplex molecule, the method comprising: a) Generate a sample comprising: multiple DNA duplex molecules, multiple single-stranded adaptors, and a single-stranded ligase. The single-stranded ligase described therein has the ligase activity of step 3 but not the adenosine transfer activity of step 2. Each of the aforementioned DNA duplex molecules comprises: i) a first duplex end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, wherein the 3' or 5' single-stranded overhang is a single non-adenine nucleotide or at least two nucleotides in length; and ii) a second duplex end comprising a 3' end and a 5' end, the second duplex end optionally having a 3' or 5' single-stranded overhang or a blunt end, and optionally, any or all of the overhangs comprising at least one methylated cytosine. Each of the single-stranded adapters comprises a nucleic acid sequence and optionally a 3' blocking group attached to the 3' end of the nucleic acid sequence, wherein the 3' blocking group is optionally a modified non-canonical nucleotide or a phosphate group, and optionally the nucleic acid sequence is methylated at each or nearly each cytosine present in the nucleic acid sequence. The 5' end of the nucleic acid sequence is adenylated, and The nucleic acid sequence comprises a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions. b) Incubate the sample at a certain temperature, so that the single-stranded ligase connects the 5' end of the single-stranded adaptor to the 3' end of the first and second double-stranded ends. c) If present, optionally contact the sample with a deblocking agent that removes the 3' blocking group from the single-chain linker; as well as d) Contact the sample with a ligase that connects the 3' end of the single-stranded linker to the 5' end of the first and second duplex ends, thereby generating a first loop-like structure at the first duplex ends of the plurality of DNA duplex molecules and a second loop-like structure at the second duplex ends of the plurality of DNA duplex molecules.

76. The method of claim 75, further comprising: e) Contacting the sample with one or more enzymes to cleave the cleavable region of the nucleic acid sequence, thereby generating two-part adaptors at the first and second duplex ends of the plurality of duplex DNA molecules, wherein each of the two-part adaptors comprises: i) The 5' region of the nucleic acid sequence connected to the 3' end of the first double-stranded end of the plurality of DNA double-stranded molecules, and ii) The 3' region of the nucleic acid sequence connected to the 5' end of the first duplex of the plurality of DNA duplex molecules.

77. A composition, kit, or system comprising: Multiple single-stranded adapters, wherein each of the single-stranded adapters comprises a nucleic acid sequence, wherein the nucleic acid sequence is optionally methylated at each or nearly each cytosine present in the nucleic acid sequence. The 5' end of the nucleic acid sequence is adenylated. The nucleic acid sequence comprises a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions. The 5' and 3' regions of the first nucleic acid sequence each contain barcode sequences that have a predefined relationship with each other, and At least one of the following situations exists: i) wherein the barcode in the 5' region is not complementary to the barcode in the 3' region, and / or ii) wherein the barcode in the 5' zone has a different length than the barcode in the 3' zone.

78. The composition, kit, or system of claim 77, wherein the predefined association of the barcode is based on a lookup table.

79. The composition, kit, or system of claim 77, wherein a 3' end blocking group is attached to the 3' end of the nucleic acid sequence, wherein the 3' end blocking group is optionally a modified non-canonical nucleotide or a phosphate group.

80. A composition comprising: A sequencing library containing multiple DNA double-stranded molecules, each with a Y-shaped adaptor attached to its end. Each Y-shaped connector described herein comprises a 5' arm and a 3' arm. The 5' arm has a first barcode and the 3' arm has a second barcode, and at least one of the following conditions exists: i) The first barcode and the second barcode are not complementary, and / or ii) The first barcode has a different length than the second barcode.

81. The composition of claim 80, wherein the Y-shaped adaptor is methylated at each or nearly each cytosine present in the nucleic acid sequence.

82. A method for linking an adaptor to a DNA double-stranded molecule, the method comprising: a) Generate a sample comprising: a DNA double-stranded molecule, a first single-stranded adaptor, and a single-stranded ligase. The single-stranded ligase described therein has the ligase activity of step 3 but not the adenosine transfer activity of step 2. The DNA double-stranded molecule described herein comprises: i) a first double-stranded end, the first double-stranded end comprising a 3' end and a 5' end, and ii) a second double-stranded end, the second double-stranded end comprising a 3' end. The first single-stranded linker comprises a first nucleic acid sequence and a 3' end blocking group attached to the 3' end of the first nucleic acid sequence. The 5' end of the first nucleic acid sequence is adenylated, and The first nucleic acid sequence includes: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, and b) Incubate the sample at a certain temperature so that the single-stranded ligase connects the 5' end of the first single-stranded linker to the 3' end of the first double-stranded linker.

83. The method of claim 82, further comprising: c) Contact the sample with a deblocking agent that removes or modifies the 3' end blocking group, such that the 3' end of the first single-chain linker contains a 3' end that can be used for connection; d) Contact the sample with a ligase that connects the 3' end of the first single-stranded linker to the 5' end of the first double-stranded end, thereby generating a first loop-like structure at the first double-stranded end of the DNA double-stranded molecule; as well as e) Contacting the sample with one or more enzymes to cleave the cleavable region of the first nucleic acid sequence, thereby generating a first two-part adaptor at the end of the first double-stranded structure, wherein the first two-part adaptor comprises: i) The 5' region of the first nucleic acid sequence linked to the 3' end of the first double-stranded end of the DNA double-stranded molecule, and ii) The 3' region of the first nucleic acid sequence connected to the 5' end of the first double-stranded end of the DNA double-stranded molecule.

84. A method for linking an adaptor to a DNA duplex molecule while retaining a 5' or 3' single-stranded overhang, the method comprising: a) Generate a sample comprising: a DNA duplex molecule, first and second single-stranded adapters, and a single-stranded ligase. The single-stranded ligase described therein has the ligase activity of step 3 but not the adenosine transfer activity of step 2. The DNA double-stranded molecule comprises: i) a first double-stranded end, the first double-stranded end comprising a 3' end and a 5' end, and having a 3' or 5' single-stranded overhang, the 3' or 5' single-stranded overhang being a single non-adenine nucleotide or having a length of at least two nucleotides; and ii) a second double-stranded end, the second double-stranded end comprising a 3' end and a 5' end, the second double-stranded end optionally having a 3' or 5' single-stranded overhang. The first and second single-stranded linkers each comprise a first nucleic acid sequence and a 3' end blocking group attached to the 3' end of the first nucleic acid sequence. The 5' end of the first nucleic acid sequence is adenylated, and The first nucleic acid sequence includes: a 5' region, a 3' region, and a cleavable region between the 5' and 3' regions, and b) Incubate the sample at a certain temperature to allow the single-stranded ligase to: i) Connect the 5' end of the first single-chain connector to the 3' chain end of the first double-chain body, and ii) Connect the 5' end of the second single-chain connector to the 3' chain end of the second double-chain body. c) Contact the sample with a deblocking agent that removes or modifies the 3' terminal blocking group, such that the 3' ends of the first and second single-chain linkers contain 3' ends that can be used for connection; d) Incubate the sample at a certain temperature to denature the DNA duplex into first and second target-adaptor constructs; e) Contact the sample with the cyclase, thereby connecting the ends of the first and second target-adaptor constructs to form a first target-adaptor loop structure and a second target-adaptor loop structure; and f) Optionally, the sample is contacted with one or more enzymes such that the cleavable region of the first nucleic acid sequence of the first and second adaptors is cleaved, thereby: i) Generate a first two-part connector at the end of the first double-chain body, retaining the 3' or 5' single-chain protrusion at the end of the first double-chain body; and ii) Generate a second two-part connector at the end of the second double chain.

85. A composition, kit, or system comprising: a) Multiple single-chain connectors, Each of the single-stranded adapters contains a single-stranded nucleic acid sequence of DNA except for one uracil base. The single-stranded nucleic acid sequence described herein includes: i) The first sequencing primer binding site, which optionally includes SEQ ID NO:

56. ii) A second sequencing primer binding site, which optionally includes SEQ ID NO:57, iii) Adenosylated 5' end, and iv) Contains a 3' end with a phosphate group; and The uracil base is located between the binding sites of the first and second sequencing primers, and Optionally, the nucleic acid sequence is methylated at each or almost every cytosine present in the nucleic acid sequence.

86. The composition, kit, or system of claim 85, wherein the plurality of single-stranded adapters comprises at least 50 single-stranded adapters, and wherein each nucleic acid sequence further comprises a different barcode sequence, wherein the length of the barcode sequence is optionally 2-15 nucleotides.

87. The composition, kit, or system of claim 85, further comprising: b) a single-stranded ligase, wherein the single-stranded ligase has the ligase activity of step 3 but not the adenosine transfer activity of step 2.

88. The composition, kit, or system of claim 85, wherein the single-stranded nucleic acid sequence further comprises: i) optionally comprising a first flow cell binding sequence of SEQ ID NO:59, and ii) optionally comprising a second flow cell binding sequence of SEQ ID NO:

60.

89. The composition, kit, or system of claim 85 or 88, wherein the single-stranded nucleic acid sequence further comprises: i) a first sample index sequence optionally comprising SEQ ID NO:62, and ii) a second sample index sequence optionally comprising SEQ ID NO:

63.

90. The composition, kit, or system of claim 85, wherein the single-stranded sequence comprises a sequence selected from the group consisting of SEQ ID NO: 54, 55, 58, and 61.

Images