Use of dabavancin in the preparation of a medicament for the prevention and / or treatment of dengue virus infection

Abstract

The application relates to application of darabavine in preparation of a medicine for preventing and / or treating dengue virus infection and belongs to the technical field of biological medicine. The application proves that exogenous addition of darabavine can effectively inhibit replication and gene expression of dengue virus, exhibits significant antiviral activity, and proves that darabavine has significant inhibiting effect on dengue virus; darabavine has the activity of resisting dengue virus at the cell level, thereby establishing the feasibility of darabavine in preparation of the medicine for preventing and / or treating dengue virus infection, and providing a new potential medicine for prevention and / or treatment of dengue virus infection.

Description

Technical Field

[0001] This invention relates to a novel use of dapavancin, specifically its application in the preparation of drugs for the prevention and / or treatment of dengue virus infection, belonging to the field of biomedical technology. Background Technology

[0002] Dengue virus belongs to the Flaviviridae family and Flavivirus genus. The virus particles are spherical, with a diameter of 45–55 nm. There are four serotypes: DENV-1, DENV-2, DENV-3, and DENV-4. The general population is susceptible to infection. The dengue virus genome is approximately 11 kb in length and contains only one open reading frame (ORF). Dengue fever (DF) is an acute mosquito-borne infectious disease caused by dengue virus infection, primarily transmitted by Aedes mosquitoes. It is classified as a Class B infectious disease and is a systemic illness. Clinical features include sudden onset of fever, body aches, rash, bleeding, and leukopenia. Severe cases can lead to shock, vital organ failure, and even death. Due to the wide distribution of its vectors and its short reproductive cycle, dengue fever is prevalent in tropical and subtropical countries and regions. In recent years, global warming, commercial trade development, and increased population mobility have further expanded the distribution of Aedes mosquitoes.

[0003] Currently, dengue virus drug research employs two targeting approaches: targeting the host and targeting viral proteins. However, many drugs have failed to enter clinical application due to poor selectivity, unsatisfactory physicochemical and pharmacokinetic properties, and so far, there is no specific antiviral drug for dengue fever. Instead, supportive treatment is the primary approach, focusing on fluid replacement, fever reduction, monitoring of the condition, and timely identification and management of severe cases. In recent years, the "drug repurposing" strategy has reshaped the landscape of new drug development. Because the clinical safety of "old drugs" has been verified, the research and development cycle has been shortened and costs reduced. For dengue virus-related infectious diseases that lack specific drugs, experience recurring outbreaks, and urgently require rapid response, this represents a highly efficient, low-risk, and rapidly translatable research and development path, and has become a hot topic in antiviral research.

[0004] Dapavancin is a marketed second-generation glycopeptide antibiotic that exerts a long-lasting bactericidal effect by inhibiting cell wall synthesis in Gram-positive bacteria. It has a half-life of up to 14 days, and its safety has been validated in clinical applications. Furthermore, studies have found that dapavancin can directly bind to the human angiotensin-converting enzyme 2 (ACE2) receptor, blocking its interaction with the SAR-CoV-2 spike protein, and significantly reducing viral load and lung pathological damage in an ACE2 mouse model. This research reveals that dapavancin, in addition to its antibacterial properties, can also act as a host-targeted antiviral molecule. Summary of the Invention

[0005] The purpose of this invention is to provide an application of dapavancin in the preparation of drugs for the prevention and / or treatment of dengue virus infection. Experimental data provided by this invention demonstrate that dapavancin can effectively inhibit the replication and expression of dengue virus in host cells in vitro, and can be used to provide technical support for the preparation of drugs that have a preventive and / or therapeutic effect against dengue virus infection, thereby enabling the application of dapavancin in drugs for the prevention and / or treatment of dengue virus infection.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: The use of dapavancin in the preparation of drugs for the prevention and / or treatment of dengue virus infection.

[0007] Furthermore, the drug for the prevention and / or treatment of dengue virus infection comprises, but is not limited to, an active ingredient and a pharmaceutically acceptable carrier; the active ingredient is dapavancin and / or a pharmaceutically acceptable salt thereof, and the pharmaceutically acceptable carrier is a hydrochloride salt.

[0008] Furthermore, the drug for preventing and / or treating dengue virus infection is a pharmaceutically acceptable oral, injectable, or inhaled formulation.

[0009] Furthermore, the drug for preventing and / or treating dengue virus infection works by inhibiting dengue virus replication and proliferation.

[0010] Furthermore, dapavancin in the drug for the prevention and / or treatment of dengue virus infection can inhibit the replication and gene expression of dengue virus, and as the concentration of dapavancin in the drug for the prevention and / or treatment of dengue virus infection increases, the replication and expression of dengue virus in host cells gradually weakens.

[0011] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1) This invention demonstrates through in vitro cell experiments that exogenous addition of dapavancin can effectively inhibit dengue virus replication and gene expression, exhibiting significant antiviral activity, proving that dapavancin has a significant inhibitory effect on dengue virus, and providing an effective new approach for the prevention and / or treatment of dengue virus infection.

[0012] 2) The experimental data provided by this invention confirms that dabavancin has anti-dengue virus activity at the cellular level, thereby establishing the feasibility of dabavancin in the preparation of drugs for the prevention and / or treatment of dengue virus infection, and providing a new potential drug for the prevention and / or treatment of dengue virus infection. Attached Figure Description

[0013] Figure 1African green monkey kidney cells-Vero cells were pretreated with different concentrations of dapavancin (50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, 0.78 μM, and 0.36 μM). The cells were then infected with dengue virus type 2 at an MOI of 0.5. After 1 hour of adsorption, the virus-drug mixture was discarded, and the cells were cultured again with the corresponding concentration of drug in maintenance medium. Cytopathic effect (CPE) was observed and recorded after 48 hours. The results showed that dapavancin treatment of Vero cells inhibited the cytopathic effect of dengue virus type 2. Figure 2 Vero cells were pretreated with different concentrations (100 μM, 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, and 0.78 μM) of dapavancin and NITD008, respectively. Cell viability was assessed by the MTS assay after 48 h. The results showed that the half-maximal cytotoxic concentration (CMC) of dapavancin and NITD008 on Vero cells was [value missing]. 50 Value >100μM, no toxicity to cells within the 100μM concentration range; Figure 3 Vero cells were pretreated with different concentrations of dapavancin (50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, 0.78 μM, 0.36 μM, and 0.18 μM) for 1 h. The cells were then infected with dengue virus type 2 (DNV) at an MOI of 0.5. After 1 h of adsorption, the virus-drug mixture was discarded, and the cells were cultured again with the corresponding concentration of DNV. After 48 h, the cell pellet was collected, and the viral genome copy number was detected by real-time quantitative PCR (qPCR). The results showed that dapavancin treatment of Vero cells inhibited the replication of DNV 2, with an effective half-maximal concentration (EC50) of 100%. 50 It is 12.93 μM; Figure 4 To pretreat Vero cells with different concentrations of dapavancin (50 μM, 25 μM, 5 μM) and NITD008 (25 μM) for 1 h, and infect them with dengue virus type 2 at MOI=0.5, after 1 h of adsorption, the virus-drug mixture was discarded, and the corresponding concentration of drug was added again for maintenance culture. After 48 h, total protein was collected for Western blot, and viral protein expression was detected by anti-nonstructural protein (NS3) antibody. The results showed that dapavancin treatment of Vero cells inhibited the protein expression of dengue virus type 2, and the inhibitory effect was stronger with increasing drug concentration. Figure 5To pretreat Vero cells with different concentrations of dapavancin (50 μM, 25 μM, 5 μM) for 1 h, and infect them with dengue virus type 2 at MOI=0.5, after 1 h of adsorption, the virus-drug mixture was discarded, and the corresponding concentration of drug was added again for maintenance culture. After 48 h, the supernatant was collected, and the virus titer was detected by plaque assay. The results showed that after dapavancin treatment of Vero cells, the release of mature dengue virus particles (DENV-2) was inhibited, and the inhibitory effect was stronger with increasing drug concentration. Figure 6 To verify the inhibitory effect of dapavancin on dengue virus protein expression at different treatment time points using Western blot experiments: Dapavancin was administered at 50 μM and the patients were infected with dengue virus type 2 (MOI=0.5) in three groups: full-course dosing, pre-invasion dosing, and post-invasion dosing. Total protein was collected 48 h later for Western blot analysis, and viral protein expression was detected using an anti-nonstructural protein (NS3) antibody. The results showed that the NS3 protein bands were weakest in the full-course dosing group and the post-invasion dosing group, indicating a significantly better inhibitory effect than the pre-invasion dosing group. Figure 7 To analyze the inhibitory effect of dapavancin on dengue virus replication at different treatment time points using qPCR, Vero cells were pretreated with dapavancin at a final concentration of 50 μM, and then infected with dengue virus type 2 (MOI=0.5). The viral genome copy number was detected after 48 h. The results showed that the inhibitory effect on viral replication was most significant in the full-dose group and the post-dose group. Figure 8 To analyze the inhibitory effect of dapavanin on the release of mature dengue virus at different treatment time points using the plaque assay, Vero cells were pretreated with dapavanin at a final concentration of 50 μM, and then infected with dengue virus type 2 (MOI=0.5). The viral titer in the supernatant was measured after 48 h. The results showed that the inhibitory effect on the release of mature virus particles was most significant in the full-dose group and the post-infection group. Figure 9 Vero cells were pretreated with 50 μM, 25 μM, and 5 μM dapavancin and 25 μM NITD008 for 1 h, respectively. They were then infected with DENV-1 dengue virus at an MOI of 0.5. After 1 h of adsorption, the supernatant was discarded, and the cells were cultured again with the corresponding concentration of dapavancin in maintenance medium. After 48 h, total protein was collected for Western blot analysis. Viral protein expression was detected using an anti-nonstructural protein (NS3) antibody. The results showed that dapavancin treatment of Vero cells inhibited the protein expression of DENV-1 dengue virus, and the inhibitory effect was stronger with increasing dapavancin concentration. Figure 10 Vero cells were pretreated with 50 μM, 25 μM, and 5 μM dapavancin and 25 μM NITD008 for 1 h, respectively. They were then infected with DENV-3 dengue virus at an MOI of 0.5. After 1 h of adsorption, the supernatant was discarded, and the cells were cultured again with the corresponding concentration of dapavancin in maintenance medium. After 48 h, total protein was collected for Western blot analysis. Viral protein expression was detected using an anti-nonstructural protein (NS3) antibody. The results showed that dapavancin treatment of Vero cells inhibited the protein expression of DENV-3 dengue virus, and the inhibitory effect was stronger with increasing dapavancin concentration. Figure 11 Vero cells were pretreated with 50 μM, 25 μM, and 5 μM dapavancin and 25 μM NITD008 for 1 h. They were then infected with DENV-4 dengue virus at an MOI of 0.5. After 1 h of adsorption, the supernatant was discarded, and the cells were cultured again with the corresponding concentration of dapavancin in maintenance medium. After 48 h, total protein was collected for Western blot analysis. Viral protein expression was detected using an anti-nonstructural protein (NS3) antibody. The results showed that dapavancin treatment of Vero cells inhibited the protein expression of DENV-4 dengue virus, and the inhibitory effect was stronger with increasing dapavancin concentration. Detailed Implementation

[0014] The present invention will now be described in further detail with reference to the embodiments.

[0015] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0016] The complete culture medium formulations used in the embodiments of this invention are as follows: DMEM complete medium: Add 1% (v%) of antibiotics and 8% (v%) of fetal bovine serum to commercial DMEM (Viva cell) medium. 2% DMEM maintenance solution: Add 1% (v%) of antibiotics and 2% (v%) of fetal bovine serum to commercial DMEM (Viva cell) culture medium. Serum-free culture medium: commercially available DMEM (Viva cell) medium.

[0017] The culture medium used for LLC-MK2 cell culture in the plaque assay is as follows: MEM complete medium: 1% (v%) of antibiotics and 8% (v%) of fetal bovine serum were added to the commercially available MEM (Procell System) medium.

[0018] The viruses involved in this invention are dengue virus strains: DENV-1 virus (isolated from Li Jianhua serum), DENV-2 virus (NGC), DENV-3 virus (JH-58), and DENV-4 virus (H241), all provided by the Vaccine Research Laboratory of the Institute of Medical Biology, Chinese Academy of Medical Sciences.

[0019] The antibodies involved in this invention are shown in Table 1.

[0020] Table 1

[0021] The reagents involved in this invention are shown in Table 2.

[0022] Table 2

[0023] The reagents involved in this invention are prepared as follows: (1) The composition of the transfer buffer is shown in Table 3: Table 3

[0024] After mixing the above ingredients, add 600 mL of deionized water, stir to dissolve, and then make up to 1 L with deionized water. (2) The composition of 10×TBS buffer is shown in Table 4: Table 4

[0025] After mixing the above ingredients, add 400mL of ultrapure water, stir to dissolve, adjust the pH to 7.5 with concentrated hydrochloric acid or NaOH, and then make up to 500mL with ultrapure water. (3) The composition of 1×TBST is shown in Table 5: Table 5

[0026] Mix the above ingredients thoroughly and prepare immediately before use; (4) The composition of the sealing liquid is shown in Table 6: Table 6

[0027] Mix the above ingredients thoroughly and prepare immediately before use; (5) The composition of 0.25% pancreatic enzymes is shown in Table 7: Table 7

[0028] After mixing the above ingredients, dispense them into portions and store them in a -40°C refrigerator.

[0029] The primer and probe sequences involved in this invention are shown in Table 8: Table 8

[0030] The English abbreviations involved in this invention and their corresponding Chinese and English names are shown in Table 9: Table 9

[0031] Example 1

[0032] After treating Vero cells with dapavancin, they were infected with dengue virus. The degree of Vero cytopathic effect (CPE) was recorded to determine the antiviral activity of dapavancin. The specific steps are as follows: 1. Cell preparation: Take well-grown Vero cells for passage culture. Add 100 μL of complete culture medium to each well of a 96-well plate, and add the culture at a rate of 2 × 10⁻⁶. 4 Add Vero cells at a rate of 1 cell per well and incubate overnight in a cell culture incubator at 37°C and 5% CO2 concentration. 2. Treatment of cells with dapavancin: Prepare a 100mM stock solution of dapavancin using dimethyl sulfoxide (DMSO) as the solvent; take out the 96-well plate from step 1, and add dapavancin at final concentrations of 50μM, 25μM, 12.5μM, 6.25μM, 3.125μM, 1.56μM, 0.78μM, and 0.36μM to the wells in sequence, with DMSO as the negative control. Set up three replicates for each group, mix well, and incubate in a cell culture incubator at 37℃ and 5% CO2 concentration for 1h. 3. Viral infection: Take out the 96-well plate from step 2, add an equal volume of dengue virus solution (DENV-2, MOI=0.5) diluted with commercial DMEM medium to each well, incubate in a cell culture incubator with 5% CO2 concentration for 1 h, remove the supernatant, wash the wells twice with PBS, and add dapavancin to the wells in sequence at final concentrations of 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, 0.78 μM and 0.36 μM, mix well, and continue to incubate the 96-well plate in an incubator with 37℃ and 5% CO2 for 48 h; 4. Observe the cell CPE: Take out the 96-well plate from step 3, observe and photograph it under an optical microscope to record the degree of cytopathic effect; 5. The results showed that treatment of Vero cells with dapavancin inhibited the expression and replication of dengue virus DENV-2, as shown in the experimental results. Figure 1As shown.

[0033] Example 2

[0034] Evaluation of the cytotoxicity and CC of different concentrations of dapamide and NITD008 on Vero cells 50 The specific steps for the determination are as follows: 1. Cell preparation: Take Vero cells in good growth condition, digest them and count the cells. Spread 100 μL of cell suspension into each well of a 96-well plate, with three replicates per group. Incubate overnight at 37°C in a 5% CO2 incubator until the cells are fully attached to the plate. 2. Drug treatment: Dapavancin and NITD008 at final concentrations of 100 μM, 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM and 0.78 μM were added to the wells of the Vero cell plate from step 1 and cultured at 37°C and 5% CO2 for 48 h. 3. Cell viability assay: After the culture in step 2 is completed, add 20 μL of MTS solution to each well and continue to incubate in the incubator for 2 h. Use a multi-functional microplate reader to detect the absorbance value of each well at a wavelength of 490 nm. 4. Data Analysis: Absorbance data were processed using standard GraphPad Prism software to plot cell viability curves. The half-maximal cytotoxic concentrations (CMCs) of dapavancin and NITD008 on Vero cells were calculated using standard nonlinear regression analysis. 50 ; 5. The CC effects of dapavancin and NITD008 on Vero cells were calculated using dose-toxicity curve analysis. 50 Values ​​>100 μM, and dapavanin showed no toxicity to Vero cells within the 100 μM concentration range, as experimental results are shown below. Figure 2 As shown.

[0035] Example 3

[0036] qPCR-based dabavancin anti-dengue virus EC 50 The specific steps for the determination are as follows: 1. Cell preparation: Take well-grown Vero cells for passage culture. Add 100 μL of complete culture medium to each well of a 96-well plate, and incubate at a rate of 2 × 10⁻⁶. 4 Add Vero cells at a rate of 1 cell per well and incubate overnight in a cell culture incubator at 37°C and 5% CO2 concentration. 2. Drug treatment: Using DMSO as a solvent, dapavancin was prepared into a 100mM stock solution. Dapavancin was added sequentially to the 96-well plates in step 1 at final concentrations of 50μM, 25μM, 12.5μM, 6.25μM, 3.125μM, 1.56μM, 0.78μM, 0.36μM, and 0.18μM. The solution was incubated for 1 hour. DMSO was used as a negative control. Three replicates were set for each group. The solution was mixed and incubated in a cell culture incubator at 37℃ and 5% CO2 concentration for 1 hour. 3. Virus infection and culture: Take out the 96-well plate from step 2, add an equal volume of dengue virus solution (DENV-2, MOI=0.5) diluted with commercial DMEM medium to each well, incubate for 1 h, remove the supernatant, wash the wells twice with PBS, and then add dapavancin to the wells in the following concentrations: 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, 0.78 μM, 0.36 μM, and 0.18 μM, respectively. Mix well and incubate at 37°C in a 5% CO2 incubator for 48 h. 4. qPCR detection: Collect cells from step 3, extract RNA using the Trizol method, and perform real-time quantitative PCR (qPCR) detection using dengue virus-specific primers to analyze the viral genome copy number; The dengue virus-specific primers are as follows: Den-FP:GCATATTGACGCTGGGAGAGA Den-RP: GGCGTTCTGTGCCTGGAAT Den-PP: FAM-CAGAGATCCTGCTGTCTC-MGB The dengue virus-specific primers mentioned above are from the "People's Republic of China Health Industry Standard (WS216-2017)"; 5. Process the data and plot it using standard GraphPad software; 6. Calculated, its EC 50 The value was 12.93 μM, indicating that dapavancin has significant inhibitory activity against dengue virus, and that dapavancin can dose-dependently inhibit the replication of dengue virus DENV-2 within the concentration range of 0.18-50 μM. The experimental results are as follows. Figure 3 As shown.

[0037] Example 4

[0038] Vero cells were treated with different concentrations of dapavancin (50 μM, 25 μM, 5 μM), then infected with dengue virus and cultured in the same drug-concentrated maintenance medium. Total protein samples were harvested after 48 hours. The specific steps are as follows: 1. Cell preparation: Take Vero cells in good growth condition for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and add 2 × 10⁻⁶ cells / well. 5 Add Vero cells at a rate of 1 cell / well and incubate overnight at 37°C in a 5% CO2 incubator. 2. Drug treatment and viral infection: Using DMSO as solvent, dapavancin was prepared into a 100mM stock solution. A 12-well plate was taken out, and dapavancin at final concentrations of 50μM, 25μM, and 5μM was added, with 3 replicates per group. After mixing, the plate was incubated at 37℃ in a cell culture incubator with 5% CO2 for 1 hour. Then, an equal volume of dengue virus solution (DENV-2, MOI=0.5) diluted with commercial DMEM medium was added to each well, and the plate was incubated for 1 hour. The supernatant was removed, and the wells were washed twice with PBS. Dapavancin at final concentrations of 50μM, 25μM, and 5μM was added sequentially, mixed, and the plate was incubated at 37℃ in a cell culture incubator with 5% CO2 for another 48 hours. 3. Protein sample harvesting: Remove the 12-well plate from step 2 after 48 hours of culture, remove the supernatant, wash the wells twice with PBS, and place the 12-well plate on ice. On ice, add 15 μL of PMSF to 1.5 mL of RIPA lysis buffer, mix well, and obtain a lysis buffer containing PMSF. Add 50 μL of RIPA lysis buffer containing PMSF to each well of the 12-well plate and lyse on ice for 30 min. To ensure complete cell lysis, the culture flask should be shaken frequently. After lysis, use a pipette to transfer cell debris and lysis buffer to 1.5 mL centrifuge tubes and centrifuge at 4°C and 12500 rpm for 5 min. Finally, aliquot the centrifuged protein supernatant into 1.5 mL centrifuge tubes and store at -80°C. 4. The expression of dengue virus protein NS3 was detected by Western blotting. The specific steps are as follows: 41) Sample preparation: For protein concentration detection by BCA method, take the supernatant containing protein obtained in step 3, and calculate the volume of solution containing 20 μg of protein as the loading amount (the loading amount of each well should be consistent, and the sample concentration can be adjusted in advance to ensure consistent volume and mass; 5 μL of protein marker is loaded; the loading volume of 15-well plate should not exceed 20 μL), add 5×SDS loading buffer to the final concentration of 1×, mix repeatedly by pipetting, and incubate in boiling water for 10 min to denature the protein, centrifuge at 10000g for more than 5 min, take the supernatant as the sample and place it on ice for later use; 42) SDS-polyacrylamide gel electrophoresis: Assemble the electrophoresis tank, add MOPS electrophoresis buffer, ensuring the inner side is submerged above the sample wells and the outer side reaches the 4-Gels position. Remove the comb from the precast gel and slowly add the sample, trying to add it to the middle wells. Before adding the next sample, wash the sample three times in the electrophoresis buffer to avoid contamination. Finally, add the protein marker. After adding the sample, close the top cover, connect the electrophoresis apparatus, turn on the electrophoresis apparatus, and run it at 80V for 30 minutes. Then increase the voltage to 120V, and the total electrophoresis time is 100 minutes. Stop electrophoresis when the bromophenol blue indicator migrates to a position 1-2 cm from the front. 43) Transfer: After electrophoresis, gently pry open the two glass plates of the gel plate with a thin plate. Using the protein marker as a guide, cut out the gel containing the target protein and carefully lay it flat on filter paper. Place the pre-cut and marked PVDF membrane on the corresponding gel, ensuring there are no air bubbles between them. Assemble the sandwich plate with the black (gel) facing the black negative electrode and the transparent (membrane) facing the red positive electrode. Pour in the transfer buffer (wet transfer buffer) to fill the entire transfer tank and add ice for an ice bath transfer. Set the transfer current to a constant current of 300mA. The transfer time depends on the protein size; generally, 1KD requires 1 minute. 44) Blocking: After the transfer, remove the membrane with the protein side facing up, rinse once with 1×TBST, and then place it in blocking solution and block on a horizontal shaker at room temperature for 2 hours or more. 45) Incubation of primary antibody: Dilute the primary antibody with Beyotime primary antibody dilution buffer according to the dilution ratio recommended in the antibody instructions (the primary antibodies used are NS3 and β-actin); after aspirating the blocking buffer, immediately add the diluted primary antibody and incubate on a horizontal shaker at room temperature for 2 hours, then place in a 4°C refrigerator overnight; the dilution ratios of each antibody are: NS3 (1:5000); β-actin (1:10000). 46) Washing the membrane: After incubation, the primary antibody is collected and recovered (it can be reused 3-4 times within one or two weeks at 4℃). Add 1×TBST to a square food storage box, put the membrane in it, and make sure that 1×TBST covers the PVDF membrane. Shake at 70rpm for 10min on a shaker. Repeat the washing 4 times. 47) Incubation of secondary antibody: Dilute the secondary antibody with blocking buffer to the concentration specified in the antibody instructions, immerse the PVDF membrane with protein transfer into a square food storage box containing the antibody, and incubate at a low speed of 70 rpm for 2 hours on a shaker; 48) Washing the membrane: After incubation, take the secondary antibody, add 1×TBST to a square food storage box, put the membrane in it, so that 1×TBST covers the PVDF membrane, shake it at 70 rpm for 10 min on a shaker, and repeat the washing 4 times. 49) Development: Prepare the developing solution (prepare the developing solution A and B from the Beyotime Ultrasensitive ECL Chemiluminescence Kit in a 1:1 ratio and use immediately). During development, drop the developing solution onto the membrane until it is completely covered. After reacting in the dark for 1 minute, place the membrane in a UVP instrument to expose the protein bands and take pictures. 5. Detection of dengue virus protein NS3 expression: The results showed that treatment of Vero cells with different concentrations of dabavancin followed by dengue virus type 2 infection inhibited dengue virus protein expression, and the inhibitory effect was stronger with increasing drug concentration. The experimental results are as follows: Figure 4 As shown.

[0039] Example 5

[0040] Vero cells were treated with different concentrations of dapavancin (50 μM, 25 μM, 5 μM), then infected with dengue virus and cultured in the same drug-concentrated maintenance medium for 48 hours. Total protein samples were collected. The specific steps are as follows: 1. Cell preparation: Take Vero cells in good growth condition for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and add 2 × 10⁻⁶ cells / well. 5 Add Vero cells at a rate of 1 cell / well and incubate overnight at 37°C in a 5% CO2 incubator. 2. Drug treatment and viral infection: Dapavancin was prepared into a 100mM stock solution using DMSO as the solvent; 12-well plates were taken out and dapavancin was added to final concentrations of 50μM, 25μM, and 5μM, with 3 replicates for each group. After gentle mixing, the plates were incubated in a cell culture incubator at 37℃ and 5% CO2 for 1 hour; then, an equal volume of dengue virus solution (DENV-2, MOI=0.5) diluted with commercial DMEM medium was added to each well, and the plates were incubated for 1 hour. The virus solution and drug mixture were removed, and dapavancin was added again. After gentle mixing, the plates were incubated in a cell culture incubator at 37℃ and 5% CO2 for another 48 hours. 3. Collect the culture supernatant into a 1.5ml centrifuge tube and store at -80℃; 4. The specific steps for determining the viral titer in the supernatant using the plaque assay are as follows: 41) Preparation of 2% low melting point agarose: Weigh 2g of low melting point agarose into a 250mL Erlenmeyer flask, add 100mL of distilled water, preheat the water to 60℃ and shake well. Autoclave at 121℃ for 15 minutes. When the temperature drops to about 50℃, remove it from the autoclave and transfer it to a biosafety cabinet for sterilization and dispensing. Store at 4℃. 42) Preparation of 1% crystal violet: Weigh 0.5g of crystal violet granules, dissolve them in 450mL PBS, add 50mL of formaldehyde solution, prepare in a fume hood, and store at room temperature. 43) Cell preparation: Take healthy LLC-MK2 cells for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and culture at a ratio of 2.5 × 10⁻⁶ cells / well. 5 Add LLC-MK2 cells at a rate of 1 cell / well and incubate overnight at 37°C in a 5% CO2 incubator. 44) Virus titer detection: Dilute the supernatant sample with serum-free culture medium, set two dilution factors, and set 3 replicates for each dilution factor. Dilution factor: 10 -1 -10 -2 Remove the culture medium, add 200 μL of virus solution to each well, and incubate at 37°C and 5% CO2 for 1 h; remove the inoculum, add 1 mL of 2X DMEM medium (1:1 mixture) containing 2% low melting point agarose and (4% FBS, 2% P / S) to each well, and incubate at 37°C and 5% CO2 for 4-6 days; fix with tissue fixative and stain with 1% crystal violet; 5. Plaque detection results showed that dapavancin treatment of Vero cells inhibited the release of mature dengue virus particles (DENV-2), and the inhibitory effect increased with increasing drug concentration. The experimental results are as follows: Figure 5 As shown.

[0041] Example 6

[0042] Vero cells were treated with dapavancin via three administration methods: full-course dosing, pre-invasion dosing, and post-invasion dosing. After infection with dengue virus, the expression of the dengue virus protein NS3 was detected by Western blotting. The specific steps are as follows: 1. Cell preparation: Take well-grown Vero cells for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and add 2 × 10⁻⁶ cells per well. 5 Add Vero cells at a rate of 1 cell per well and incubate overnight in a cell culture incubator at 37°C and 5% CO2 concentration. 2. Dapavancin treatment of cells and viral infection using different administration methods: Dapavancin was prepared into a 100mM stock solution using DMSO as the solvent; and administered according to the following methods: Drug administration method: Add 50 μM dapavancin to the wells and treat for 1 h, then add dengue virus (DENV-2, MOI=0.5) diluted with DMEM and incubate for 1 h, then replace with 50 μM dapavancin to maintain culture for 48 h. DMSO is used as a negative control. Three replicates are set for each group. Drug administration method before cell entry: Add dengue virus (DENV-2, MOI=0.5) diluted with DMEM and dapavancin at a final concentration of 50 μM to the well and incubate for 1 h. Then replace with maintenance medium and maintain culture for 48 h. DMSO is used as a negative control. Three replicates are set up for each group. Drug administration after cell entry: Add dengue virus (DENV-2, MOI=0.5) diluted with DMEM to the wells and incubate for 1 h, then replace with 50 μM dapavancin to maintain culture for 48 h. Use DMSO as a negative control. Set up three replicates for each group, mix well, and incubate in a cell culture incubator at 37℃ and 5% CO2 concentration for 48 h. 3. Protein sample harvesting: Remove the 12-well plate from step 2 after 48 hours of culture, remove the supernatant, wash twice with colorless PBS, and place the 12-well plate on ice. On ice, add 15 μL of PMSF to 1.5 mL of RIPA lysis buffer, mix well, and obtain a lysis buffer containing PMSF. Add 50 μL of RIPA lysis buffer containing PMSF to each well of the 12-well plate and lyse on ice for 30 min. To ensure complete cell lysis, the culture flask should be shaken frequently. After lysis, use a pipette to transfer cell debris and lysis buffer to 1.5 mL centrifuge tubes and centrifuge at 12500 rpm for 5 min at 4°C. Finally, aliquot the centrifuged protein supernatant into 1.5 mL centrifuge tubes and store at -80°C. 4. The expression of dengue virus protein NS3 was detected by Western blotting. The specific steps are as follows: 41) Sample preparation: For protein concentration detection by BCA method, take the supernatant containing protein obtained in step 3, and calculate the volume of solution containing 20 μg of protein as the loading amount (the loading amount of each well should be consistent, and the sample concentration can be adjusted in advance to ensure consistent volume and mass; 5 μL of protein marker is loaded; the loading volume of 15-well plate should not exceed 20 μL), add 5×SDS loading buffer to the final concentration of 1×, mix repeatedly by pipetting, and incubate in boiling water for 10 min to denature the protein, centrifuge at 10000g for more than 5 min, take the supernatant as the sample and place it on ice for later use; 42) SDS-polyacrylamide gel electrophoresis: Assemble the electrophoresis tank, add MOPS electrophoresis buffer, ensuring the inner wells are submerged and the outer wells reach 4 Gels. Carefully remove the comb from the precast gel and slowly add the sample, trying to add it to the middle wells. Wash the sample three times in electrophoresis buffer before adding the next sample to avoid contamination. Finally, add the protein marker. After loading the sample, close the cap, connect the electrophoresis apparatus, turn it on, and run at 80V for 30 minutes. Then increase the voltage to 120V, for a total electrophoresis time of 100 minutes. Stop electrophoresis when the bromophenol blue indicator migrates to 1-2 cm from the front. 43) Transfer: After electrophoresis, gently pry open the two glass plates of the gel plate with a thin plate. Using the protein marker as a guide, cut out the gel containing the target protein and carefully lay it flat on filter paper. Place the pre-cut and marked PVDF membrane on the corresponding gel, ensuring there are no air bubbles between them. Assemble the sandwich plate with the black (gel) facing the black negative electrode and the transparent (membrane) facing the red positive electrode. Pour in the transfer buffer (wet transfer buffer) to fill the entire transfer tank and add ice for an ice bath transfer. Set the transfer current to a constant current of 300mA. The transfer time depends on the protein size; generally, 1KD requires 1 minute. 44) Blocking: After the transfer, remove the membrane with the protein side facing up, rinse once with 1×TBST, and then place it in blocking solution and block on a horizontal shaker at room temperature for 2 hours or more. 45) Incubation of primary antibody: Dilute the primary antibody with Beyotime primary antibody dilution buffer according to the dilution ratio recommended in the antibody instructions (the primary antibodies used are NS3 and β-actin); after aspirating the blocking buffer, immediately add the diluted primary antibody and incubate on a horizontal shaker at room temperature for 2 hours, then place in a 4°C refrigerator overnight; the dilution ratios of each antibody are: NS3 (1:5000); β-actin (1:10000). 46) Washing the membrane: After incubation, the primary antibody is collected and recovered (it can be reused 3-4 times within one or two weeks at 4℃). Add 1×TBST to a square food storage box, put the membrane in it, and make sure that 1×TBST covers the PVDF membrane. Shake at 70rpm for 10min on a shaker. Repeat the washing 4 times. 47) Incubation of secondary antibody: Dilute the secondary antibody with blocking buffer to the concentration specified in the antibody instructions, immerse the PVDF membrane with protein transfer into a square food storage box containing the antibody, and incubate at a low speed of 70 rpm for 2 hours on a shaker; 48) Washing the membrane: After incubation, take the secondary antibody, add 1×TBST to a square food storage box, put the membrane in it, so that 1×TBST covers the PVDF membrane, shake it at 70 rpm for 10 min on a shaker, and repeat the washing 4 times. 49) Development: Prepare the developing solution (prepare the developing solution A and B from the Beyotime Ultrasensitive ECL Chemiluminescence Kit in a 1:1 ratio and use immediately). During development, drop the developing solution onto the membrane until it is completely covered. After reacting in the dark for 1 minute, place the membrane in a UVP instrument to expose the protein bands and take pictures. 5. Detection of dengue virus protein NS3 expression: The results showed that Vero cells were treated with dabavancin via full-cycle dosing, pre-infection dosing, and post-infection dosing, and infected with dengue virus DENV-2. The full-cycle dosing and post-infection dosing methods showed the most significant inhibitory effects. The experimental results are as follows: Figure 6 As shown.

[0043] Example 7

[0044] After treating Vero cells with dapavanin via three administration methods—full-cycle dosing, pre-infection dosing, and post-infection dosing—and infecting them with dengue virus, viral nucleic acid levels were measured using qPCR, and the inhibition rate was calculated. The specific steps are as follows: 1. Cell preparation: Take well-grown Vero cells for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and add 2 × 10⁻⁶ cells per well. 5 Add Vero cells at a rate of 1 cell per well and incubate overnight in a cell culture incubator at 37°C and 5% CO2 concentration. 2. Different administration methods of dapavancin to cells and infection with viruses: Dapavancin was prepared into a 100mM stock solution using DMSO as the solvent; it was then administered in the following ways: Drug administration method: Add 50 μM dapavancin to the wells and treat for 1 h, then add dengue virus (DENV-2, MOI=0.5) diluted with DMEM and incubate for 1 h, then replace with 50 μM dapavancin to maintain culture for 48 h. DMSO is used as a negative control. Three replicates are set for each group. Pre-infection administration: DMEM-diluted dengue virus (DENV-2, MOI=0.5) and dapavancin at a final concentration of 50 μM were added to the wells and incubated for 1 h. Then the medium was replaced with maintenance medium and cultured for 48 h. DMSO was used as a negative control. Three replicates were set up for each group. Post-infection administration: DMEM-diluted dengue virus (DENV-2, MOI=0.5) was added to the wells and incubated for 1 h. Then, it was replaced with 50 μM dapavancin for maintenance culture for 48 h. DMSO was used as a negative control. Three replicates were set up for each group. After gentle mixing, the cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 48 h. 3. Add 300 μL of Trizol to each well, extract total RNA from the cells, and perform qPCR detection of viral genome copy number; 4. The results showed that both full-process drug administration and post-invasion drug administration significantly inhibited the drug's effects; experimental results are as follows. Figure 7 As shown.

[0045] Example 8

[0046] After Vero cells were treated with dapavancin via three administration methods—full-course dosing, pre-invasion dosing, and post-invasion dosing—the cells were infected with dengue virus. The viral titer in the supernatant was determined using the plaque assay. The specific steps are as follows: 1. Cell preparation: Take well-grown Vero cells for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and add 2 × 10⁻⁶ cells per well. 5Add Vero cells at a rate of 1 cell per well and incubate overnight in a cell culture incubator at 37°C and 5% CO2 concentration. 2. Different administration methods of dapavancin to cells and infection with viruses: Dapavancin was prepared into a 100mM stock solution using DMSO as the solvent; it was then administered in the following ways: Drug administration method: Add 50 μM dapavancin to the wells and treat for 1 h, then add dengue virus (DENV-2, MOI=0.5) diluted with DMEM and incubate for 1 h, then replace with 50 μM dapavancin to maintain culture for 48 h. DMSO is used as a negative control. Three replicates are set for each group. Pre-infection administration: DMEM-diluted dengue virus (DENV-2, MOI=0.5) and dapavancin at a final concentration of 50 μM were added to the wells and incubated for 1 h. Then the medium was replaced with maintenance medium and cultured for 48 h. DMSO was used as a negative control. Three replicates were set up for each group. Post-infection administration: DMEM-diluted dengue virus (DENV-2, MOI=0.5) was added to the wells and incubated for 1 h. Then, it was replaced with 50 μM dapavancin for maintenance culture for 48 h. DMSO was used as a negative control. Three replicates were set up for each group. After gentle mixing, the cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 48 h. 3. Collect the culture supernatant into a 1.5ml centrifuge tube and store at -80℃; 4. The specific steps for determining the viral titer in the supernatant using the plaque assay are as follows: 41) Preparation of 2% low melting point agarose. Weigh 2g of low melting point agarose into a 250mL Erlenmeyer flask, add 100mL of distilled water, preheat the water to 60℃ and shake well. Autoclave at 121℃ for 15 minutes. When the temperature drops to about 50℃, remove from the autoclave and transfer to a biosafety cabinet for aseptic dispensing. Store at 4℃. 42) Preparation of 1% crystal violet. Weigh 0.5g of crystal violet granules, dissolve in 450mL PBS, add 50mL of formaldehyde solution, prepare in a fume hood, and store at room temperature; 43) Cell preparation: Take healthy LLC-MK2 cells for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and culture at a ratio of 2.5 × 10⁻⁶ cells / well. 5 Add LLC-MK2 cells at a rate of 1 cell / well and incubate overnight at 37°C in a 5% CO2 incubator. 44) Virus titer detection: Dilute the supernatant sample with serum-free culture medium, set two dilution factors, and set 3 replicates for each dilution factor. Dilution factor: 10 -1 -10 -2Remove the culture medium, add 200 μL of virus solution to each well, and incubate at 37°C and 5% CO2 for 1 h; remove the inoculum, add 1 mL of 2X DMEM medium (1:1 mixture) containing 2% low melting point agarose and (4% FBS, 2% P / S) to each well, and incubate at 37°C and 5% CO2 for 4-6 days; fix with tissue fixative and stain with 1% crystal violet; 5. Plaque detection results showed that the release of mature dengue virus particles (DENV-2) was inhibited, with both full-cycle and post-infection dosing showing more significant inhibitory effects. Experimental results are as follows: Figure 8 As shown.

[0047] Example 9

[0048] Vero cells were treated with different concentrations of dapavancin (50 μM, 25 μM, 5 μM), then infected with dengue virus and cultured in the same drug-concentrated maintenance medium for 48 hours. Total protein samples were collected. The specific steps are as follows: 1. Cell preparation: Take Vero cells in good growth condition for passage culture. Add 1 mL of complete culture medium to each well of a 12-well plate, and add 2 × 10⁻⁶ cells / well. 5 Add Vero cells at a rate of 1 cell / well and incubate overnight at 37°C in a 5% CO2 incubator. 2. Drug treatment and viral infection: Dapavancin was prepared into a 100mM stock solution using DMSO as the solvent; 12-well plates were taken out and dapavancin was added to final concentrations of 50μM, 25μM, and 5μM, with 3 replicates per group. The mixture was mixed and incubated in a cell culture incubator at 37℃ and 5% CO2 for 1 hour; then, an equal volume of dengue virus solution (DENV-1, DENV-3, DENV-4, MOI=0.5) diluted with commercial DMEM medium was added to each well and incubated for 1 hour. The supernatant was removed, and the wells were washed twice. Then, dapavancin was added to final concentrations of 50μM, 25μM, and 5μM in sequence, mixed, and incubated in a cell culture incubator at 37℃ and 5% CO2 for 48-72 hours. Specifically, DENV-1 virus was cultured for 48 hours, and DENV-3 and DENV-4 viruses were cultured for 72 hours each. 3. Protein sample harvesting: Remove the 12-well plate from step 2, remove the cell culture supernatant, wash twice with colorless PBS, and place the 12-well plate on ice. On ice, add 15 μL of PMSF to 1.5 mL of RIPA lysis buffer, mix well to obtain a lysis buffer containing PMSF. Add 50 μL of RIPA lysis buffer containing PMSF to each well and lyse on ice for 30 min. To ensure complete cell lysis, the culture flask should be shaken frequently. After lysis, use a pipette to transfer cell debris and lysis buffer to a 1.5 mL centrifuge tube and centrifuge at 12500 rpm for 5 min at 4 °C. Finally, aliquot the centrifuged protein supernatant into 1.5 mL centrifuge tubes and store at -80 °C. 4. The expression of dengue virus protein NS3 was detected by Western blotting. The specific steps are as follows: 41) Sample preparation: For protein concentration detection by BCA method, take the supernatant containing protein obtained in step 3, and calculate the volume of solution containing 20 μg of protein as the loading amount (the loading amount of each well should be consistent, and the sample concentration can be adjusted in advance to ensure consistent volume and mass; 5 μL of protein marker is loaded; the loading volume of 15-well plate should not exceed 20 μL), add 5×SDS loading buffer to the final concentration of 1×, mix repeatedly by pipetting, and incubate in boiling water for 10 min to denature the protein, centrifuge at 10000g for more than 5 min, take the supernatant as the sample and place it on ice for later use; 42) SDS-polyacrylamide gel electrophoresis: Assemble the electrophoresis tank, add MOPS electrophoresis buffer, ensuring the inner wells are submerged and the outer wells reach 4 Gels. Carefully remove the comb from the precast gel and slowly add the sample, trying to add it to the middle wells. Wash the sample three times in electrophoresis buffer before adding the next sample to avoid contamination. Finally, add the protein marker. After loading the sample, close the cap, connect the electrophoresis apparatus, turn it on, and run at 80V for 30 minutes. Then increase the voltage to 120V, for a total electrophoresis time of 100 minutes. Stop electrophoresis when the bromophenol blue indicator migrates to 1-2 cm from the front. 43) Transfer: After electrophoresis, gently pry open the two glass plates of the gel plate with a thin plate. Using the protein marker as a guide, cut out the gel containing the target protein and carefully lay it flat on filter paper. Place the pre-cut and marked PVDF membrane on the corresponding gel, ensuring there are no air bubbles between them. Assemble the sandwich plate with the black (gel) facing the black negative electrode and the transparent (membrane) facing the red positive electrode. Pour in the transfer buffer (wet transfer buffer) to fill the entire transfer tank and add ice for an ice bath transfer. Set the transfer current to a constant current of 300mA. The transfer time depends on the protein size; generally, 1KD requires 1 minute. 44) Blocking: After the transfer, remove the membrane with the protein side facing up, rinse once with 1×TBST, and then place it in blocking solution and block on a horizontal shaker at room temperature for 2 hours or more. 45) Incubation of primary antibody: Dilute the primary antibody with Beyotime primary antibody dilution buffer according to the dilution ratio recommended in the antibody instructions (the primary antibodies used are NS3 and β-actin); after aspirating the blocking buffer, immediately add the diluted primary antibody and incubate on a horizontal shaker at room temperature for 2 hours, then place in a 4°C refrigerator overnight; the dilution ratios of each antibody are: NS3 (1:5000); β-actin (1:10000). 46) Washing the membrane: After incubation, the primary antibody is collected and recovered (it can be reused 3-4 times within one or two weeks at 4℃). Add 1×TBST to a square food storage box, put the membrane in it, and make sure that 1×TBST covers the PVDF membrane. Shake at 70rpm for 10min on a shaker. Repeat the washing 4 times. 47) Incubation of secondary antibody: Dilute the secondary antibody with blocking buffer to the concentration specified in the antibody instructions, immerse the PVDF membrane with protein transfer into a square food storage box containing the antibody, and incubate at a low speed of 70 rpm for 2 hours on a shaker; 48) Washing the membrane: After incubation, take the secondary antibody, add 1×TBST to a square food storage box, put the membrane in it, so that 1×TBST covers the PVDF membrane, shake it at 70 rpm for 10 min on a shaker, and repeat the washing 4 times. 49) Development: Prepare the developing solution (prepare the developing solution A and B from the Beyotime Ultrasensitive ECL Chemiluminescence Kit in a 1:1 ratio and use immediately). During development, drop the developing solution onto the membrane until it is completely covered. After reacting in the dark for 1 minute, place the membrane in a UVP instrument to expose the protein bands and take pictures. 5. Detection of dengue virus protein NS3 expression: The results showed that treatment of Vero cells with different concentrations of dapavancin followed by dengue virus (DENV-1, DENV-3, DENV-4) inhibited dengue virus protein expression, and the inhibitory effect was stronger with increasing drug concentration. The experimental results are as follows: Figure 9 As shown.

[0049] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. The use of dapavancin in the preparation of drugs for the prevention and / or treatment of dengue virus infection.

2. The use of dapavancin according to claim 1 in the preparation of drugs for the prevention and / or treatment of dengue virus infection, characterized in that: The drugs for the prevention and / or treatment of dengue virus infection include, but are not limited to, an active ingredient and a pharmaceutically acceptable carrier; the active ingredient is dapavancin and / or its pharmaceutically acceptable salt, and the pharmaceutically acceptable carrier is hydrochloride.

3. The use of dapavancin according to claim 1 in the preparation of drugs for the prevention and / or treatment of dengue virus infection, characterized in that: The drugs mentioned for the prevention and / or treatment of dengue virus infection are pharmaceutically acceptable oral, injectable, or inhaled formulations.

4. The use of dapavancin according to claim 1 in the preparation of drugs for the prevention and / or treatment of dengue virus infection, characterized in that: The drugs mentioned for the prevention and / or treatment of dengue virus infection work by inhibiting the replication and proliferation of dengue virus.

5. The use of dapavancin according to claim 1 in the preparation of drugs for the prevention and / or treatment of dengue virus infection, characterized in that: Dabavancin in the drug for the prevention and / or treatment of dengue virus infection can inhibit the replication and gene expression of dengue virus, and as the concentration of dabavancin in the drug for the prevention and / or treatment of dengue virus infection increases, the replication and expression of dengue virus in host cells gradually weakens.

Images