A two-component complex thrombolytic microecological preparation containing cordyceps militaris plasmin and natto kinase and a preparation method thereof

Abstract

This invention discloses a two-component compound thrombolytic microecological preparation containing Cordyceps militaris fibrinolytic enzyme and nattokinase, and its preparation method, belonging to the field of functional microecological preparation technology. Each gram of the preparation contains 1000-1500 IU of Cordyceps militaris fibrinolytic enzyme, 10000-18000 IU of nattokinase, and a total viable count of Bacillus subtilis 13932 and Bacillus subtilis 22878 of not less than 1.5 × 10⁻⁶. 9 CFU; This invention utilizes the complementary substrate chain properties of Cordyceps militaris plasminogen preferentially degrading fibrinogen α-chain and nattokinase preferentially degrading fibrinogen β-chain and γ-chain, achieving rapid and complete degradation of fibrinogen, with a significant synergistic effect in in vitro thrombolysis; microencapsulation ensures that the dual enzyme activities are retained at over 90% after 12 months of storage at 25°C, and the viable bacterial count remains at 10. 9 It contains CFU / g or higher and is resistant to gastric acid and enteric-coated for sustained release. This formulation can be used for daily preventive healthcare for high-risk groups of cardiovascular and cerebrovascular diseases, as well as for adjuvant nutritional support for postoperative thrombosis prevention, and provides theoretical insights for the development of high-value-added functional probiotics.

Description

Technical Field

[0001] This invention belongs to the field of functional microecological preparation technology, specifically relating to a two-component compound thrombolytic microecological preparation containing Cordyceps militaris fibrinolytic enzyme and nattokinase and its preparation method. Background Technology

[0002] Cardiovascular and cerebrovascular diseases are the leading cause of disease threatening human health, with intravascular thrombosis forming as their common pathological basis. Thromboembolism can induce acute myocardial infarction, ischemic stroke, deep vein thrombosis, and pulmonary embolism, among other acute and critical illnesses, characterized by high morbidity, high disability rates, and high mortality rates. Commonly used thrombolytic drugs, such as urokinase, streptokinase, and recombinant tissue plasminogen activator, have limitations including low fibrin specificity, high risk of bleeding, need for intravenous administration, short half-life, and high cost. They are only suitable for acute treatment and cannot be used for long-term daily prevention in high-risk groups. Therefore, developing safe, orally administered, and long-term suitable natural thrombolytic active ingredients and their formulations is an important research direction in the field of functional foods and microecological preparations.

[0003] Nattokinase (NK) is an alkaline serine protease secreted by Bacillus subtilis (Natto Bacillus subtilis), with a relative molecular mass of approximately 27.7 kDa. Derived from the traditional fermented food natto, nattokinase is orally administered, has good safety profile, and possesses dual thrombolytic activity, directly degrading fibrinogen and activating plasminogen in the body. It is currently the most widely used food-derived thrombolytic enzyme. However, nattokinase exhibits a clear chain-biased approach to fibrinogen degradation, preferentially degrading β- and γ-chains while its degradation of α-chains is slow and incomplete. Furthermore, nattokinase is sensitive to gastric acid, gradually losing activity in environments with a pH below 5. Unprotected nattokinase preparations have low bioavailability after oral ingestion. In addition, nattokinase preparations experience rapid enzyme activity decay during storage at room temperature, affecting product quality and efficacy stability.

[0004] Cordyceps militaris is a traditional Chinese fungus used for both food and medicine, and is listed in the New Resource Food Catalogue. Studies have shown that deep fermentation of Cordyceps militaris can secrete various proteases with fibrinolytic activity. Among them, Cordyceps militaris plasminogen activators (such as the S8 family basic serine protease Alp1, with a relative molecular mass of approximately 30 kDa) are direct plasminogen activators, capable of directly degrading fibrin and fibrinogen without requiring plasminogen activation. They exhibit an optimal reaction temperature of approximately 60℃, maintain high activity and stability within a pH range of 7–11, and their activity is influenced by calcium. 2+ and Mn 2+It exhibits significant activation and other enzymatic characteristics. Unlike nattokinase, Cordyceps militaris plasmin preferentially and rapidly degrades the α chain of fibrinogen, followed by the β chain, but its degradation of the γ chain is slow and incomplete. Therefore, plasminogenases from a single source are unable to completely degrade all three peptide chains of fibrinogen, limiting their thrombolytic efficiency.

[0005] In the prior art, Chinese patent CN101962637B discloses a Cordyceps militaris fibrinolytic enzyme and its cultivation method, which only involves the fermentation preparation of a single Cordyceps militaris fibrinolytic enzyme, resulting in a single thrombolytic substrate spectrum; Chinese patent application CN104366304A discloses a microcapsule containing nattokinase and probiotics, using gelatin and β-cyclodextrin as wall materials, which only encapsulates a single nattokinase, failing to address the issues of multi-enzyme synergy and long-term storage stability at room temperature; Chinese patent application CN111280452A discloses a compound health food containing black natto powder, Cordyceps militaris powder, etc., which is a simple physical mixing of raw material powders, without quantitative control of enzyme activity, microcapsule protection, or involvement of a dual-enzyme synergistic mechanism. Furthermore, existing nattokinase microcapsules mostly use sodium alginate, gelatin, β-cyclodextrin, or enteric resin as wall materials, with single-function wall materials, and no reports of endowing the wall materials with prebiotic functions have been found.

[0006] In summary, existing thrombolytic enzyme preparations and probiotic preparations generally suffer from the following technical problems: (1) Single plasminogen degrades fibrinogen with a chain preference, resulting in incomplete degradation and limited thrombolytic efficiency; (2) Enzyme preparations have poor stability at room temperature, rapid enzyme activity decay, and short shelf life; (3) They are easily destroyed and inactivated by gastric acid and pepsin after oral administration; (4) The preparations themselves do not have the ability to continuously produce enzymes in situ in the intestine, resulting in a short duration of action. Currently, there are no reports of a compound thrombolytic probiotic preparation that scientifically combines two substrates with complementary chain preferences—direct plasminogen and enzyme-producing live bacteria—and achieves stable storage at room temperature through microencapsulation technology. Summary of the Invention

[0007] To address the aforementioned problems in existing technologies, the present invention aims to provide a two-component compound thrombolytic microecological preparation containing Cordyceps militaris plasmin and nattokinase, and its preparation method. This preparation utilizes the substrate preference of two direct plasminases for different peptide chains of fibrinogen to achieve synergistic and complete degradation. Furthermore, microencapsulation technology using resistant dextrin as the main wall material protects enzyme activity and viable bacteria, enabling the preparation to maintain high activity during long-term storage at room temperature and in acidic gastric environments. It features good synergistic thrombolytic effect, high storage stability, resistance to gastric acid, sustained intestinal release, and continuous in-situ enzyme production in the intestine.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: a two-component compound thrombolytic microecological preparation containing Cordyceps militaris fibrinolytic enzyme and nattokinase, composed of microcapsule particles and a carrier; each gram of the preparation contains 1000-1500 IU of Cordyceps militaris fibrinolytic enzyme and 10000-18000 IU of nattokinase, with a total live bacteria count of not less than 1.3 × 10⁻⁶. 9 The CFU contains live bacteria composed of Bacillus subtilis 13932 and Bacillus subtilis 22878; the core material of the microcapsule particles contains Cordyceps militaris fibrinolytic enzyme, nattokinase and live bacteria, and the wall material contains resistant dextrin; the carrier is skim milk powder and / or maltodextrin; the water activity of the formulation is less than 0.30.

[0009] The high-yielding nattokinase-producing Bacillus subtilis with accession number CGMCC No. 13932 is designated as Bacillus subtilis 13932; the Bacillus subtilis with accession number CGMCC No. 22878 is designated as Bacillus subtilis 22878. Both strains were deposited at the China General Microbiological Culture Collection Center on July 13, 2021.

[0010] Preferably, the enzyme activity ratio of Cordyceps militaris plasmin to nattokinase is 1:(5~20), more preferably 1:10; the ratio of viable bacteria count of Bacillus subtilis 13932 to Bacillus subtilis 22878 is 1:(0.5~2). The Cordyceps militaris plasmin is an S8 family basic serine protease derived from the deep liquid fermentation of Cordyceps militaris, with a relative molecular mass of 28~32 kDa. Its degradation rate of the human fibrinogen α chain is higher than its degradation rate of the β and γ chains; the nattokinase degradation rate of the human fibrinogen β and γ chains is higher than its degradation rate of the α chain. The two enzymes have complementary advantages in their degradation rates of the three peptide chains of fibrinogen: Cordyceps militaris plasmin rapidly degrades the α chain, followed by the β chain, while nattokinase rapidly degrades the β and γ chains. The combined use of these two enzymes can achieve complete degradation of the three peptide chains of fibrinogen in a relatively short time, producing a significant synergistic thrombolytic effect.

[0011] Preferably, the wall material comprises, by weight, 60-90 parts resistant dextrin, 5-20 parts sodium alginate, and 5-20 parts skim milk powder; the solid mass ratio of the core material to the wall material is 1:(2-4); the microcapsule particles have a particle size of 50-500 μm, and the encapsulation rate of both enzymes is not less than 85%. Resistant dextrin is both an encapsulation material with excellent wall-forming and moisture-barrier properties and a water-soluble dietary fiber (prebiotic) that can be utilized by intestinal flora, thus simultaneously playing a dual role in protecting enzyme activity and regulating intestinal flora in this invention. The formulation also contains an enzyme activity stabilizer, comprising, by weight, 0.05%-0.5% calcium salt, 0.01%-0.1% manganese salt, and 1%-5% trehalose; Ca 2+ With Mn 2+ It is an activator of Cordyceps militaris fibrinolytic enzyme, which can maintain the active conformation of enzyme molecules during storage and use; the moisture content of the preparation is not higher than 5%, and the water activity is less than 0.30, which further ensures the stability of room temperature storage from the perspective of moisture control.

[0012] The present invention also provides a method for preparing the above-mentioned two-component compound thrombolytic microecological preparation containing Cordyceps militaris fibrinolytic enzyme and nattokinase, comprising the following steps:

[0013] (1) The Cordyceps militaris fibrinolytic enzyme expression strain YCC1 was fermented in liquid. The supernatant was separated from the solid and liquid of the fermentation broth, concentrated by 10 kDa ultrafiltration membrane, fractionated by ammonium sulfate precipitation, and desalted to obtain Cordyceps militaris fibrinolytic enzyme concentrate.

[0014] (2) Bacillus subtilis was liquid fermented, separated and concentrated to obtain a concentrated solution containing nattokinase and bacterial cells. Bacillus subtilis was liquid fermented and centrifuged to collect bacterial sludge.

[0015] (3) Mix the double enzyme concentrate, bacterial mud and protectant as core material, mix with wall material solution containing resistant dextrin, and then spray dry or freeze dry at low temperature after shearing emulsification and high pressure homogenization to obtain microcapsule particles; (4) Mix the microcapsule particles with pre-dried carrier and enzyme activity stabilizer evenly, control the water activity of the finished product to be less than 0.30, and seal and package.

[0016] The Cordyceps militaris plasmin expression strain YCC1 is a recombinant Pichia pastoris strain GS115 / pPIC9K-CmFE that secretes and expresses Cordyceps militaris plasmin; the sequence of the Cordyceps militaris plasmin is shown in SEQ. NO. 1. The Cordyceps militaris plasmin gene was cloned using molecular cloning technology and constructed into the plasmid pPIC9K using homologous recombination. Subsequently, the recombinant plasmid was transformed into the host Pichia pastoris GS115 for expression.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) Complementary thrombolysis of two enzyme chains: Cordyceps militaris plasmin prefers to degrade the α chain of fibrinogen, while nattokinase prefers to degrade the β and γ chains. When the two are combined at an enzyme activity ratio of 1:(5~20), the degradation rate of the three peptide chains of human fibrinogen α, β and γ exceeds 95% within 60 min, achieving complete degradation. The combined use of the two direct plasminases produces better technical effects.

[0019] (2) Excellent stability during room temperature storage: The microcapsule encapsulation with resistant dextrin as the main wall material, combined with water activity control (less than 0.30), ensured that after 12 months of storage at 25℃ and 60% relative humidity, the activity retention rates of Cordyceps militaris fibrinolytic enzyme and nattokinase were both greater than 90% (less than 55% in the unencapsulated control), and the viable count remained at 1.0 × 10⁻⁶. 9 With CFU / g or higher, the shelf life is significantly extended.

[0020] (3) Resistant to gastric acid and enteric sustained release: After 2 hours of action in simulated gastric juice (pH 1.2), the activity retention rate of both enzymes of the microcapsule particles was greater than 85% (less than 32% in the unencapsulated control). The cumulative release rate in simulated intestinal juice was greater than 80% after 2 hours, achieving targeted release of enzymes into the intestine. The gastric acid survival rate of the encapsulated live bacteria was about 4 times higher than that of the unencapsulated bacteria.

[0021] (4) In situ continuous enzyme production and microbial regulation in the intestine: Bacillus subtilis in the preparation colonizes and multiplies in the intestine and can continuously secrete active proteases such as nattokinase, forming a release-regeneration gradient supply with the pre-embedded dual enzymes; the resistant dextrin wall material, as a prebiotic, further promotes the proliferation of beneficial bacteria in the intestine, realizing the dual effects of enzyme preparation and microecological preparation. Attached Figure Description

[0022] Figure 1 Construction and expression of recombinant plasmid pPIC9K-CmFE; (a) pPIC9K-CmFE plasmid map, (b) agarose gel electrophoresis of CmFE fragment PCR amplification, lanes 1-2 are CmFE fragments, (c) colony PCR verification of recombinant plasmid pPIC9K-CmFE, lanes 1-8 are colony PCR verification, (d) SDS-PAGE electrophoresis analysis of recombinant protein expression, lanes 1-2 are fermentation broth supernatant, lanes 3-4 are cell lysate. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to embodiments. These embodiments are only for explaining the present invention and are not intended to limit the scope of protection of the present invention. All equivalent substitutions or improvements made based on the concept of the present invention should be included within the scope of protection of the present invention.

[0024] (a) Source of strain

[0025] Bacillus subtilis 13932 is a high-yield nattokinase-producing Bacillus subtilis, with accession number CGMCC No. 13932; Bacillus subtilis 22878, with accession number CGMCC No. 22878, originated from Nanning Bio-Engineering Co., Ltd.

[0026] Bacillus subtilis 22878 / pMA5-ilvc originated from Professor Hao Ning's research group at Nanjing University of Technology. The construction process is as follows:

[0027] Using the genome of B. subtilis 168 as a template, the gene ilvC with a homologous arm was amplified. The recombinant plasmid constructed from E. coli DH5α was extracted and transformed into B. subtilis 22878 competent cells. The transformation product was plated on kanamycin-containing solid medium for screening, and positive recombinant strains were obtained.

[0028] (II) Main Detection Methods

[0029] Plasmin activity assay (fibrin plate method): Mix 5 mL of 0.4% (w / v) fibrinogen solution (prepared with pH 7.4 PBS), 10 mL of 0.5% agarose solution, and 1 mL of thrombin (100 U / mL), pour the mixture onto a plate, and allow it to solidify at room temperature for 1 h. Spot 20 μL of the sample and incubate at 37℃ for 18 h, measuring the diameter of the lysis zone. Construct a standard curve using urokinase standard (regression equation y = 5.738x - 451.81, correlation coefficient 0.99631), and calculate the plasmin activity of the sample, expressed in IU. Direct fibrinolytic activity was measured using fibrin plates heated at 80℃ for 30 min (inactivating plasminogen).

[0030] Total viable count: Performed according to GB 4789.2. Bacillus subtilis was counted separately on selective culture medium and then summed. Water activity was determined according to GB 5009.238 (diffusion method using a water activity meter); moisture content was determined according to GB 5009.3 direct drying method. Microcapsule encapsulation efficiency: 1 g of microcapsule powder was rapidly washed with 10 mL of cold physiological saline, and the free enzyme activity (surface enzyme) in the eluent was determined. Encapsulation efficiency = (total enzyme activity - surface free enzyme activity) / total enzyme activity × 100%. Particle size was determined using a laser particle size analyzer.

[0031] Example 1 Construction of Cordyceps militaris fibrinolytic enzyme expression strain

[0032] Cordyceps militaris plasminogen lysate (sequence shown in SEQ. NO. 1) was successfully cloned using molecular cloning technology and constructed into plasmid pPIC9K using homologous recombination. Subsequently, the recombinant plasmid was transformed into the host Pichia pastoris GS115 for expression, resulting in the recombinant strain GS115 / pPIC9K-CmFE. The expression product of the recombinant strain was detected by SDS-PAGE electrophoresis and fibrinogen plate assay, indicating that the recombinant strain could effectively express biologically active Cordyceps militaris plasminogen lysate.

[0033] Example 2: Preparation of Cordyceps militaris fibrinolytic enzyme concentrate, and preparation of nattokinase concentrate and Bacillus subtilis mycelial sludge.

[0034] Strain activation: After the recombinant strain GS115 / pPIC9K-CmFE was plated onto MD plates and colonies grew, numerous histolytic cells were screened by growing the strain on 4 mg / mL of the antibiotic Geneticin at 30°C for 3-6 days. + Mut + Phenotypic transformants. Positive transformants GS115 / pPIC9K-CmFE from YPD-Geneticin plates were picked and incubated in 25 mL of BMGY medium at 30°C with a shaker at 220 rpm until cell OD reached 1 / 20. 600 Cells were collected by centrifugation at 2-6,5000 r / min for 5 min, and then resuspended in BMGY medium to OD. 600 The culture was incubated at 30℃ and 220 rpm for 5 days with a concentration of 1.0. Methanol was added every 24 h to bring the final concentration to 1%. Finally, the culture supernatant was collected by centrifugation at 8000 rpm for 10 min and analyzed by SDS-PAGE for protein analysis. (MD solid medium: 20 g / L glucose, 13.4 g / L yeast nitrogen source (YNB), 20 g / L agar powder, sterilized at 115℃ for 15 min; YPD solid medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, 20 g / L agar powder, sterilized at 115℃ for 15 min; BMGY medium: 20 g / L peptone, 10 g / L yeast extract, 13.4 g / L yeast nitrogen source, 10% (v / v) glycerol, 10% (v / v) 1 M pH 6.0 phosphate buffer, sterilized at 115℃ for 15 min.) The fibrinolytic activity of the fermentation broth reached 1022.4 IU / mL.

[0035] Enzyme concentration: The fermentation broth was centrifuged at 10000×g for 10 min at 4℃, and the supernatant was collected. The supernatant was concentrated 8 times by ultrafiltration with a molecular weight cutoff of 10kDa. Ammonium sulfate was slowly added to 40% saturation with stirring, and the mixture was allowed to stand at 4℃ for 2 h. The precipitate was then centrifuged and discarded. Ammonium sulfate was added to the supernatant to 70% saturation, and the mixture was allowed to stand at 4℃ overnight. The precipitate was collected by centrifugation. The precipitate was reconstituted with a small amount of 0.01 M PBS (pH 7.4), dialyzed to desalt, and the concentrated Cordyceps militaris plasmin was obtained. The concentration of Cordyceps militaris plasmin in the concentrated solution was 8605.6 U / mL, and the protein concentration was 4.12 mg / mL.

[0036] Liquid fermentation of Bacillus subtilis 22878 / pMA5-ilvc: Seed culture (10 g / L glucose, 6 g / L soybean peptone, 1 g / L K2HPO4, 0.23 g / L CaCl2, initial pH 7.2, sterilized at 110℃ for 15 min) was inoculated at a 3% inoculation rate into fermentation medium (30 g / L glucose, 20 g / L soybean peptone, 2.5 g / L NaCl, 1.4 g / L K2HPO4, 0.58 g / L MgSO4, 0.26 g / L CaCl2, initial pH 7.2, sterilized at 110℃ for 15 min, cultured at 37℃ and 200 r / min for 36 h). The nattokinase activity of the fermentation broth reached 15021.4 IU / mL, and the cell concentration was 2.1 × 10⁻⁶. 9 CFU / mL. The fermentation broth was concentrated 6 times by ceramic membrane and ultrafiltration to obtain a nattokinase concentrate containing nattokinase, with a nattokinase activity of 90128.4 IU / mL.

[0037] Liquid fermentation of Bacillus subtilis 13932: Seed culture was inoculated at a rate of 2% into fermentation medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L glucose, 5 g / L NaCl, pH 7.2), and cultured at 37℃ and 220 r / min for 20 h, resulting in a cell concentration of 3.2 × 10⁻⁶ cells / day. 9 CFU / mL;

[0038] Liquid fermentation of Bacillus subtilis 22878: Seed culture was inoculated at a 2% inoculation rate into fermentation medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L glucose, 5 g / L NaCl, pH 7.2), and cultured at 37℃ and 220 r / min for 20 h, with a cell concentration of 1.5 × 10¹. 0 CFU / mL.

[0039] The fermentation broth was centrifuged at 4℃ and 8000×g for 15 min to collect the bacterial cells, which were then resuspended in physiological saline to obtain Bacillus subtilis sludge.

[0040] Example 3: Verification Experiment of Two-Component Enzyme Synergistic Degradation of Bovine Fibrinogen

[0041] Take 200 μL of bovine fibrinogen solution (10 mg / mL, prepared with physiological saline, preheated at 37℃), and add 20 μL of the following enzyme solutions respectively: Cordyceps militaris fibrinolytic enzyme group (CFE group, 200 IU), nattokinase group (NK group, 2000 IU), and two-component enzyme groups (enzyme activity ratio 1:5, 1:10, 1:15); incubate at 37℃, and take 15 μL samples at 0, 5, 10, 15, 30, 60, and 90 min respectively, and calculate the degradation rate.

[0042] Table 1. Degradation rate (%) of the three peptide chains of human fibrinogen after 90 min of treatment with different enzymes.

[0043] Processing group α-chain degradation rate % β-chain degradation rate % γ-chain degradation rate % Are the triple chains completely degraded? CFE group (200 IU) 78.3±2.1 96.5±1.4 52.5±2.2 Incomplete degradation (α, γ chain residue) NK group (2000 IU) 42.7±1.9 98.2±0.9 95.8±1.7 Incomplete degradation (large amount of alpha chain remains) CFE+NK group 1:10 (200 IU+2000 IU) 95.6±1.9 99.6±0.8 97.4±1.8 Complete degradation of the three chains within 60 minutes CFE+NK group 1:5 (200 IU+1000 IU) 90.8±2.7 93.5±3.2 92.8±1.4 Almost completely degraded CFE+NK group 1:15 (200 IU+3000 IU) 92.6±1.5 95.7±2.4 94.9±2.9 Complete degradation

[0044] Cordyceps militaris plasmin preferentially degrades the α chain (the α chain is significantly weakened within 5 min, and more than 60% is degraded within 15 min), and the β chain is almost completely degraded within 60 min, but the α and γ chains still remain at 90 min; nattokinase preferentially degrades the β and γ chains (the β chain basically disappears within 10 min, and the γ chain is degraded by more than 90% within 45 min), but the α chain is only degraded by 42.7% at 90 min; the two-component enzyme group fully utilizes the complementary advantages of the chains, with the α chain degraded by more than 80% within 15 min, the β chain completely degraded within 10 min, and the γ chain degraded by 90% within 30 min. At 60 min, the degradation rate of all three peptide chains exceeds 95%, achieving rapid and complete degradation of fibrinogen, which is significantly better than any single enzyme group.

[0045] The enzyme activities of fermentation broth CFE solution, NK solution, and the two-component mixed enzyme solution were measured separately. 20 μL of each solution was spotted onto agarose-fibrinogen plates and incubated at 37℃ for 10 h. The diameter of the lysosome was measured, with urokinase (1000 U / mL) as a control. The results are shown in Table 2. The enzyme activity and lysosome size of the two-component mixed enzyme solution were significantly larger than those of any single enzyme group, and all three produced lysosomes on the plates, confirming that both enzymes are direct fibrinolytic enzymes, and their combined use enhanced direct fibrinolytic activity.

[0046] Table 2. Fibrinolytic protein plate method for enzyme activity determination

[0047] sample Enzyme activity (IU / mL) Cordyceps militaris fibrinolytic enzyme solution 968.21±43.84 Nattokinase solution 15602.35±108.65 Two-component mixed enzyme solution (1:10) 16204.23±234.67

[0048] In addition, the optimal temperature for Cordyceps militaris fibrinolytic enzyme is 60℃ and pH 7~11, while the optimal temperature for nattokinase is about 50℃ and pH 6~12. The combined enzyme system can maintain more than 80% of its activity within the range of pH 6.0~9.0 and 25~55℃, complementarily covering the physiological environment of the gastrointestinal tract and systemic circulation.

[0049] Example 4: Preparation of a two-component composite thrombolytic microcapsule containing Cordyceps militaris fibrinolytic enzyme and nattokinase

[0050] Six formulations (Table 3) were designed using food-grade wall materials such as resistant dextrin, sodium alginate, skim milk powder, maltodextrin, β-cyclodextrin, and gelatin. The core material composition and drying process were fixed, and the formulations were screened based on the encapsulation efficiency of dual enzymes and the moisture barrier properties (equilibrium moisture content) of the microcapsules. The results showed that the composite wall material with 80 parts resistant dextrin, 10 parts sodium alginate, and 10 parts skim milk powder exhibited the best overall performance, with encapsulation efficiencies of 86.8% (NK) and 89.6% (CFE), respectively. Furthermore, resistant dextrin also possessed prebiotic functions, which was superior to traditional wall material combinations such as gelatin and β-cyclodextrin.

[0051] Table 3 Screening of Microcapsule Wall Material Formulations

[0052] Wall material formulation (parts by weight) NK embedding rate (%) CFE encapsulation rate (%) Equilibrium moisture content at 25℃ (%) 100 parts of resistant dextrin 83.5±1.3 85.6±1.4 4.2 80 parts resistant dextrin + 10 parts sodium alginate + 10 parts skim milk powder 86.8±0.8 89.6±1.3 3.3 70 parts resistant dextrin + 30 parts gelatin 85.5±1.6 86.8±1.4 3.3 100 parts maltodextrin 71.4±1.5 73.6±1.6 5.5 50 parts β-cyclodextrin + 50 parts gelatin 79.4±1.7 77.2±1.4 4.6 60 parts sodium alginate + 40 parts skim milk powder 80.4±1.1 81.5±1.3 4.3

[0053] Microcapsule preparation (spray drying method): Weigh the wall material according to the preferred formula in Table 3, add purified water to prepare a wall material solution with a solid content of 20%, stir to dissolve at 60°C, and then cool to 30°C for later use; Combine the Cordyceps militaris fibrinolytic enzyme concentrate (Cordyceps militaris fibrinolytic enzyme ≥1000 IU), nattokinase concentrate (nattokinase ≥15000 IU), and Bacillus subtilis sludge (containing a total viable count of not less than 1.0 × 10⁻⁶) from Example 2. 9 CFU (Chemical Fumed Bacillus subtilis 13932: Bacillus subtilis 22878 viable count ratio of 1:5) was mixed with a protective agent (trehalose 4%, glycerol 1%, CaCl2 0.1%, MnSO4 0.02%, based on core material solids) as the core material. The core material was slowly added to the wall material solution at a core material to wall material solids mass ratio of 1:3, sheared and emulsified at 10000 r / min for 5 min, and then homogenized twice under high pressure at 30 MPa to obtain a stable emulsion. The emulsion was then spray-dried at low temperature with an inlet air temperature of 120±5℃, an outlet air temperature of 60±3℃, and an atomization pressure of 0.2 MPa to collect microcapsule particles. The microcapsules were tested and found to have a particle size D50 of 182 μm, with 90% of the particles distributed between 80 and 350 μm; NK encapsulation rate of 87.2%, CFE encapsulation rate of 89.7%, and viable bacterial encapsulation survival rate of 81.1%; and a moisture content of 3.2%.

[0054] As another implementation method, the above emulsion can also be used to prepare microcapsules by vacuum freeze-drying: after the emulsion is dispensed, it is pre-frozen at -45°C for 4 h, then vacuum freeze-dried for 24 h (cold trap temperature -55°C, vacuum degree 20 Pa), pulverized and sieved. The resulting microcapsules have double enzyme encapsulation rates of 90.6% (NK) and 91.9% (CFE), respectively. The encapsulation rate is slightly higher, but the production efficiency is lower, which is suitable for small-batch high value-added products.

[0055] Example 5: Formulation and index control of a two-component compound thrombolytic probiotic containing Cordyceps militaris fibrinolytic enzyme and nattokinase

[0056] According to the formula in Table 4 (based on 1000 g): the microcapsule powder obtained in Example 4, along with pre-dried (moisture content ≤ 4%) skim milk powder, maltodextrin (DE value 10), microcrystalline cellulose, silicon dioxide, calcium lactate, manganese sulfate, and trehalose, were sequentially added to a three-dimensional motion mixer and mixed for 15 min; the water activity of the finished product was tested to be 0.22 and the moisture content was 3.6%, which met the control requirement of water activity < 0.30; after the semi-finished product passed the inspection, it was sealed in an aluminum-plastic composite bag filled with nitrogen, with a specification of 2 g / bag, thus obtaining the two-component compound thrombolytic microecological preparation.

[0057] Table 4 Formulation of Two-Component Compound Thrombolytic Microecological Preparation (1000 g)

[0058] raw material Dosage (g) effect Two-component composite microcapsule powder (Example 4) 400 Core material: dual enzymes + dual bacteria; Wall material: resistant dextrin composite wall material Skim milk powder (pre-dried, aw 0.18) 350 Carrier / filler Maltodextrin DE10 (pre-dried, aw 0.20) 200 Carrier / filler microcrystalline cellulose 30.5 Filling Flow silicon dioxide 9 Anti-caking and flow aid Calcium lactate 3.5 Enzyme activity stabilizer (Ca²⁺ activates dual enzymes) manganese sulfate 0.5 Enzyme stabilizer (Mn²⁺ activates Cordyceps militaris fibrinolytic enzyme) Trehalose 6.5 Enzymes and cell protectants

[0059] Product quality indicators: Each gram of the preparation contains 987.8 IU of Cordyceps militaris fibrinolytic enzyme and 15602.24 IU of nattokinase (enzyme activity ratio approximately 1:15.8); total viable count 2.4 × 10⁻⁶. 9 CFU / g, of which Bacillus subtilis 13932 2.8×10 9 CFU / g, Bacillus subtilis 22878 1.9×10 9 CFU / g (viable bacteria ratio approximately 1:1.47); water activity 0.22 (<0.30), moisture content 3.6% (≤5%); double enzyme encapsulation rate ≥85%.

[0060] Example 6: Stability test of the formulation at room temperature

[0061] The microcapsule formulation obtained in Example 5 and the unencapsulated formulation (as a control) were packaged in aluminum-plastic composite bags and stored in a stability test chamber at 25±2℃ and 60%±5% relative humidity for one year. Samples were taken at 0, 30, 90, 180, 270 days, and 1 year to determine the retention rate of the dual enzyme activities (with 0 months of activity as 100%), the total number of viable bacteria, and the water activity. The results are shown in Table 5. (Unencapsulated formulation: The same ratio of compound enzyme-bacterial powder was directly mixed without microcapsule encapsulation.)

[0062] Table 5. Stability data after 12 months of storage at 25℃ and 60% relative humidity.

[0063] Group detection indicators October 30 days 90 days 180 days 270 days December Microencapsulation formulation NK vitality retention rate (%) 100 99.2 97.6 95.9 93.5 92.4 Microencapsulation formulation CFE viability retention rate (%) 100 98.6 96.5 95.3 92.4 91.8 Microencapsulation formulation <![CDATA[Total number of viable bacteria (×10 9 CFU / g)]]> 3.4 2.6 2.2 1.8 1.6 1.2 Microencapsulation formulation water activity 0.22 0.22 0.24 0.26 0.28 0.29 Unembedded control NK vitality retention rate (%) 100 90.1 78.4 66.9 60.4 52.6 Unembedded control CFE viability retention rate (%) 100 87.5 74.8 62.3 54.2 45.6 Unembedded control <![CDATA[Total number of viable bacteria (×10 9 CFU / g)]]> 3.4 2.2 1.8 1.5 0.3 0.1 Unembedded control water activity 0.28 0.32 0.38 0.43 0.49 0.52

[0064] After 12 months of storage, the NK and CFE activity retention rates of the microcapsule formulation were 92.4% and 91.8%, respectively, both greater than 90%; the total viable count was 1.2 × 10⁻⁶. 9 CFU / g still meets the requirement of ≥1.0×10 9 The quality requirements for CFU / g were: water activity consistently below 0.30. In contrast, the unencapsulated control showed that after 12 months, the retention rates of the two enzymes decreased to 52.6% and 45.6%, respectively, and the total viable count decreased to 0.1 × 10⁻⁶. 9 The CFU / g level no longer meets quality requirements. Furthermore, accelerated testing at 40℃ and 75% relative humidity for 3 months showed that the NK and CFE retention rates of the microcapsule formulation were 90.6% and 89.2%, respectively, with a viable count of 1.5 × 10⁻⁶. 9 The CFU / g of the resistant dextrin microcapsule was significantly higher than that of the unencapsulated control, with a retention rate of less than 50% for both enzymes. This further demonstrates the crucial role of resistant dextrin microcapsule encapsulation and water activity control in ensuring stability during room temperature storage.

[0065] Example 7: Simulated gastrointestinal fluid tolerance and intestinal release experiment

[0066] Simulated gastric juice (SGF) tolerance test: Simulated gastric juice containing pepsin (pH 1.2) was prepared according to the Chinese Pharmacopoeia. 1 g of the microcapsule formulation and the unencapsulated formulation were added to 50 mL of SGF, and the mixture was shaken at 37℃ and 100 r / min for 2 h. Samples were taken to determine the retention rate of the two enzymes and the viable bacterial survival rate. Simulated intestinal fluid (SIF) release test: Microcapsules treated with SGF for 2 h were transferred into simulated intestinal fluid containing pancreatin and bile salts (pH 6.8), and the mixture was shaken at 37℃. Samples were taken at 0.5, 1, 2, and 3 h to determine the activity of the two enzymes in the supernatant, and the cumulative release rate was calculated. The results are shown in Table 6.

[0067] Table 6. Simulated gastrointestinal fluid tolerance and release characteristics

[0068] project Detection object Microencapsulation formulation Unembedded control SGF (pH 1.2) activity retention rate (%) after 2 h Nattokinase 87.3±1.8 31.6±2.3 SGF (pH 1.2) activity retention rate (%) after 2 h Cordyceps militaris fibrinolytic enzyme 88.6±2.5 29.6±1.4 SGF (pH 1.2) survival rate (%) after 2 h Double-bacterial live bacteria 73.6±2.8 18.2±1.6 SIF (pH 6.8) cumulative release rate (%) over 2 hours Nattokinase 82.3±3.9 — SIF (pH 6.8) cumulative release rate (%) over 2 hours Cordyceps militaris fibrinolytic enzyme 83.3±2.6 —

[0069] The microcapsule wall material can significantly resist the damage of gastric acid and pepsin. After 2 hours of SGF treatment, the retention rates of both enzyme activities were greater than 85% and the viable bacterial survival rate was 73.6%, which were 2.7 to 4.0 times that of the unencapsulated control, respectively. After being transferred into SIF, the microcapsule wall material swelled and released rapidly. The cumulative release rates of NK and CFE after 2 hours reached 82.3% and 83.3%, respectively. The released enzyme solution maintained complete lysis activity on fibrinogen plates, achieving targeted delivery of enzymes through gastric protection and intestinal release.

[0070] Cordyceps militaris fibrinolytic enzyme sequence SEQ.NO.1:

[0071] atgagaaacc aactcgccct cgtcgccctc gccagccagg cggccgcctttgctgtcccttccgtcgcca ccaggagtga ggcgattgtg ggcggcgtgt ctgtcaagatcgaggacttcccctaccagg tggacctgcg cgtcaacgac agggccaact gcggcggcaccgtcatcagcgagaaatacg tcctgacggc cggccactgc gccgagggct acacgggcctgaacattcgcgttggcagcg ccaccaacgg caagggcacc aactacaacg tcacccgggccgtcgtccaccccaagtaca actccgagtc gtacgcctac gacgccgcca ttctggagatcagcccggccatcaagttcg gcaccacggt caaggccatt gccctggccg acgtggagcccgccgtcggcaccgacacgg tcgtctccgg ctggggctcc ctcaccgaga cacccaactaccccacggccctccaggccg tccacgtccc catctacaac cgcgccacct gcaagacgaactacgccagcgtcaccccaa tcacggccga catgatctgc gctggcttcc ctgaaggcaagaaggattcttgctctggcg acagcggcgg tcctctggtg actggcggca aggttgttggcatcgtctctttcggaactg gctgtgctcg ggccaataaa cccggcgttt actccagcgtcgccagcgctgagattcgtt ccttcatcaa gagcacgact ggcctgtaa.

Claims

1. A two-component compound thrombolytic microecological preparation containing Cordyceps militaris fibrinolytic enzyme and nattokinase, characterized in that, The formulation consists of microcapsule particles and a carrier; each gram of the formulation contains 1000-1500 IU of Cordyceps militaris fibrinolytic enzyme, 10000-18000 IU of nattokinase, and a total live bacteria count of not less than 1.0 × 10⁻⁶. 9 CFU, the live bacteria being Bacillus subtilis Bacillus subtilis 13932, Bacillus subtilis Bacillus subtilis Composition 22878; the core material of the microcapsule particles contains the Cordyceps militaris fibrinolytic enzyme, the nattokinase and the live bacteria, and the wall material contains resistant dextrin; the carrier is skim milk powder and / or maltodextrin; the water activity of the formulation is less than 0.

30.

2. The two-component compound thrombolytic microecological preparation containing Cordyceps militaris fibrinolytic enzyme and nattokinase according to claim 1, characterized in that, The enzyme activity ratio of the Cordyceps militaris fibrinolytic enzyme to the nattokinase is 1:(5~20).

3. The two-component compound thrombolytic microecological preparation of Cordyceps militaris fibrinolytic enzyme and nattokinase according to claim 1 or 2, characterized in that, The Cordyceps militaris fibrinolytic enzyme is derived from Cordyceps militaris (… Cordyceps militaris The S8 family basic serine protease derived from liquid fermentation has the gene sequence shown in SEQ. NO. 1; the nattokinase is derived from Bacillus subtilis. Bacillus subtilis 22878 / pMA5- ilvc .

4. The two-component compound thrombolytic microecological preparation of Cordyceps militaris fibrinolytic enzyme and nattokinase according to claim 1, characterized in that, Bacillus subtilis Bacillus subtilis 13932, Bacillus subtilis Bacillus subtilis The ratio of viable bacteria in 22878 is 1:(0.5~2).

5. The two-component compound thrombolytic microecological preparation of Cordyceps militaris fibrinolytic enzyme and nattokinase according to claim 1, characterized in that, The wall material comprises, by weight, 60-90 parts resistant dextrin, 5-20 parts sodium alginate, and 5-20 parts skim milk powder; the solid mass ratio of the core material to the wall material is 1:(2-4).

6. The two-component compound thrombolytic microecological preparation of Cordyceps militaris fibrinolytic enzyme and nattokinase according to claim 1 or 5, characterized in that, The microcapsule particles have a particle size of 50~500 μm; the encapsulation rate of both Cordyceps militaris fibrinolytic enzyme and nattokinase is not less than 85%.

7. The two-component compound thrombolytic microecological preparation of Cordyceps militaris fibrinolytic enzyme and nattokinase according to claim 1, characterized in that, The formulation further comprises an enzyme activity stabilizer; the enzyme activity stabilizer comprises, by weight of the total mass of the formulation, 0.05% to 0.5% calcium salt, 0.01% to 0.1% manganese salt and 1% to 5% trehalose; the moisture content of the formulation is not higher than 5%.

8. A method for preparing a two-component compound thrombolytic microecological preparation of Cordyceps militaris fibrinolytic enzyme and nattokinase as described in any one of claims 1 to 7, characterized in that, Includes the following steps: (1) Preparation of Cordyceps militaris fibrinolytic enzyme concentrate: Cordyceps militaris fibrinolytic enzyme expression strain YCC1 was fermented in liquid. The fermentation broth was separated into solid and liquid to obtain the supernatant. The supernatant was concentrated by ultrafiltration membrane with a molecular weight cutoff of 10 kDa. Then, it was subjected to ammonium sulfate fractionation precipitation and desalting to obtain Cordyceps militaris fibrinolytic enzyme concentrate. (2) Preparation of nattokinase concentrate and bacterial sludge: Bacillus subtilis Bacillus subtilis 22878 / pMA5- ilvc After liquid fermentation, the fermentation broth is concentrated to obtain a concentrated solution containing nattokinase; Bacillus subtilis 13932 and Bacillus subtilis 22878 were liquid-fermented and the bacterial sludge was collected by centrifugation. (3) Microencapsulation: The Cordyceps militaris fibrinolytic enzyme concentrate obtained in step (1), the nattokinase concentrate obtained in step (2), and Bacillus subtilis sludge and protectant are mixed as core material and mixed with a wall material solution containing resistant dextrin. After shear emulsification and high-pressure homogenization, the mixture is spray-dried at low temperature or freeze-dried in vacuum to obtain microcapsule particles. (4) Compound preparation: Mix the microcapsule particles obtained in step (3) with the pre-dried carrier and enzyme activity stabilizer evenly, control the water activity of the finished product to be less than 0.30, seal and package to obtain the two-component compound thrombolytic microecological preparation.

9. The preparation method according to claim 8, characterized in that, The conditions for liquid fermentation in step (1) are 28~32℃, 150~250 r / min, and culture for 36~48 h; the ammonium sulfate fractionation is used to collect the precipitate in the 40%~70% saturation range.

10. The preparation method according to claim 8, characterized in that, The conditions for liquid fermentation of Bacillus subtilis in step (2) are 36~38℃, 180~220 r / min, and culture for 24~30 h; the solid mass concentration of the wall material solution in step (3) is 15%~25%, and the inlet air temperature of the low-temperature spray drying is 110~130℃ and the outlet air temperature is 55~65℃.

Images