Ebium selenide derivatives containing a hydrophobic tag, methods of making and using the same

Abstract

The application discloses an ebselen derivative containing a hydrophobic label, a preparation method and application thereof. The compound prepared by the application has an inhibition activity on CypD equivalent to that of ebselen, but has better selectivity, can selectively degrade CypD protein in vivo, and has less influence on CypA. The compound of the application has no significant toxicity to BV2 cells, and the cell survival rate of ebselen is only 10% at 50 μM. The compound of the application has less toxicity to BV2 cells, and is more biologically safe. Especially, the compound 6 of the application has a protective effect on BV-2 cell damage induced by glutamate, and has a better effect than ebselen at the same dose, and is more biologically safe.

Description

Technical Field

[0001] This invention belongs to the field of compound preparation and application technology, specifically relating to ibuselenium derivatives containing hydrophobic tags, their preparation methods and applications. Background Technology

[0002] Alzheimer's disease (AD) is a progressive degenerative disease of the central nervous system. Due to its unclear pathogenesis, current clinical small-molecule therapies primarily focus on improving symptoms in the progressive stage, and these therapies suffer from drawbacks such as significant individual variability, unsatisfactory therapeutic activity, and short duration of effectiveness. Therefore, identifying novel small-molecule therapies that address the root causes of AD based on early pathological characteristics is of great significance. Recent studies have shown that mitochondrial dysfunction is an early pathological feature of AD. The mechanism by which decreased mitochondrial calcium uptake and cytoplasmic calcium overload in the brains of AD patients lead to mitochondrial membrane potential imbalance has been widely supported through cell models, animal experiments, and human brain tissue studies. Therefore, targeting mitochondrial membrane potential balance (such as mPTP inhibitors) is one of the main potential strategies for AD treatment.

[0003] However, research has revealed that novel small-molecule drugs targeting mitochondrial membrane potential balance still face key challenges, including poor blood-brain barrier penetration, unsatisfactory inhibitory activity, and poor selectivity due to off-target effects. Therefore, currently, there are no novel small-molecule drugs targeting mitochondrial membrane potential balance for the treatment of Alzheimer's disease (AD) in clinical practice. Targeting mitochondrial membrane potential balance can effectively restore calcium homeostasis, thereby treating AD. This is based on the core role of mitochondria in cellular energy metabolism and calcium ion regulation. Mitochondria release calcium ions through the sodium-calcium exchanger (NCLX) and mPTP to maintain calcium homeostasis. Inhibiting the opening of mPTP (e.g., using cyclosporine A) can prevent mitochondrial membrane potential collapse and abnormal calcium ion release. Current research on the structure of mPTP has made significant progress, with the latest results suggesting that cyclophilin D (CypD) and F1FO ATPase are fundamental components of mPTP.

[0004] Cyclophilic D (CypD), a crucial component of mitochondria, is currently the only definitively identified positive regulator of mPTP opening, causing mitochondrial dysfunction and cell death. Studies have found that CypD-mediated mPTP is directly associated with cellular and synaptic perturbations observed in Alzheimer's disease (AD); gene knockout of CypD sustainably protects against Aβ toxicity and cognitive impairment in AD mouse models, thus inhibiting CypD activity is a potential therapeutic approach for AD. Research indicates that in early neurodegenerative changes in AD, mitochondrial-related energy depletion may precede glycolysis-related hypometabolism, suggesting that glycolysis may play a crucial role in AD development. In AD-derived mitochondria, both mitochondrial respiration and glycolytic bioenergetics are disrupted, and inhibiting or blocking CypD can rescue mitochondrial and glycolytic bioenergetics impairments in AD. Therefore, CypD plays a vital role in intervening in mitochondrial membrane potential, and inhibiting CypD could potentially treat AD.

[0005] Although CypD inhibitors have been studied for many years, their variety and quantity remain limited. Currently, CypD inhibitors are mainly classified into the following categories:

[0006] 1) Cyclosporine A and its derivatives: Cyclosporine A (CsA) was the first discovered CypD inhibitor. It inhibits the PPIase activity of CypD by binding to its active site, thereby preventing the opening of mPTPs. However, CsA has immunosuppressive effects, limiting its clinical application. To overcome this drawback, researchers have developed a series of CsA derivatives, such as Debio-025 and NIM811. These derivatives retain CypD inhibitory activity but with significantly reduced immunosuppressive effects.

[0007] 2) Non-immunosuppressive CypD inhibitors: Researchers have screened and designed a series of non-immunosuppressive compounds, such as Alisporivir and C105. These compounds inhibit CypD activity through different mechanisms, such as binding to the active site of CypD and interfering with the interaction between CypD and mPTP component proteins.

[0008] However, some of the CypD inhibitor candidates mentioned above, such as Cyclosporine A (CsA), have immunosuppressive effects, serious side effects, and cannot cross the blood-brain barrier (BBB); Sanglifehrin A and Antamanide have side effects such as nephrotoxicity, neurotoxicity, hepatotoxicity, and poor BBB permeability. Therefore, there are currently no effective CypD inhibitors available for the treatment of Alzheimer's disease.

[0009] Furthermore, the cyclophilin family has a rich variety of isoforms, such as CypA, which has multiple biological effects in vivo. Excessive inhibition of CypA can easily lead to severe immunosuppression. Based on the sequences and disclosed crystal structures of various isoforms, there is a high degree of similarity between the structures of the domains (and their binding pockets) in specific cyclophilic proteins, which complicates the development of selective inhibitors. It has been reported that occupancy of the S2 pocket may achieve selectivity for some isoforms. Recently, David R. Liu discovered a lead compound from a macrocyclic DNA library that achieved selectivity for CypA by introducing a polar amino group into the S2 pocket. However, the physicochemical properties and brain permeability of molecules using this strategy are unfavorable.

[0010] A team led by Professor Shirley ShiDu Yan from Columbia University in the United States has screened a new class of non-toxic and biocompatible CypD inhibitors—episeselenium—using an FDA-approved drug library. Its binding mode is different from all currently reported molecules; it is a covalent inhibitor and mainly occupies the S1 and S1' pockets. However, its subtype selectivity remains low.

[0011] Targeted protein degradation, a rapidly developing technology in the last decade, has garnered significant attention. It may address the challenge of targeting untreatable molecules and contribute to improving in vivo selectivity. Hydrophobic tag-based protein degradation (HyT-PD) is another promising strategy, similar to PROTACs. The pioneering work of Crews et al. in 2011 led to the development of the first HyT-PD compound, HyT13, composed of an adamantane tag, a PEG linker, and a chloroalkane linker, which specifically and irreversibly binds to the HaloTag2 protein. In 2023, Xie et al. discovered a novel hydrophobic tag—norbornene—and designed compounds to degrade anaplastic lymphoma kinase (ALK) fusion proteins. However, hydrophobic tags can trigger unintended protein aggregation or cytotoxicity, posing higher safety requirements for molecular design. Furthermore, improper control of the hydrophobic strength of lipophilic tags can easily lead to nonspecific toxicity due to excessive hydrophobicity.

[0012] In light of the shortcomings of existing technologies, there is currently a lack of HyT-PD compounds capable of selectively degrading CypD proteins while having minimal impact on CypA. Existing CypD inhibitors (such as selenium ibex) possess some CypD inhibitory activity, but their selectivity is insufficient, and they exhibit significant neurocytotoxicity. Therefore, developing a novel compound that combines high selective CypD degradation activity, low cytotoxicity, and good biocompatibility remains a pressing technical challenge in this field. Summary of the Invention

[0013] Purpose of the invention: The technical problem to be solved by the present invention is to provide an ibuselenium derivative containing a hydrophobic tag or a pharmaceutically acceptable salt, ester, solvate or prodrug thereof.

[0014] Another technical problem to be solved by the present invention is to provide a method for preparing an ibuselenium derivative containing a hydrophobic tag or a pharmaceutically acceptable salt, ester, solvate or prodrug thereof.

[0015] Another technical problem to be solved by the present invention is to provide the use of ibuselenium derivatives containing hydrophobic tags or pharmaceutically acceptable salts, esters, solvates or prodrugs thereof in the specific inhibition of CypD and / or degradation of CypD protein.

[0016] Another technical problem to be solved by the present invention is to provide the use of the ibuselenium derivative containing the hydrophobic tag or its pharmaceutically acceptable salt, ester, solvate or prodrug in the preparation of a medicament for neuroprotection or repair of cell damage.

[0017] Technical solution: This invention provides an ibuselenium derivative containing a hydrophobic tag, or a pharmaceutically acceptable salt, ester, solvate, or prodrug thereof, wherein the structural formula of the ibuselenium derivative is shown in formula (I):

[0018]

[0019] (I)

[0020] Among them, the linker is C2-C 24 The alkylene chain is optionally substituted by one or more substituents independently selected from halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, and oxoyl groups, wherein the HyT TAG is adamantyl or norbornenyl, preferably, the adamantyl is selected from 1-adamantyl or 2-adamantyl, and preferably, the norbornenyl is selected from 5-norbornen-2-yl.

[0021] Optionally, one or more linking groups selected from -O-, -NH-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -S-, -SO2-, -SS-, -triazolyl-, and -phenylene- are inserted into the linker.

[0022] The linker is selected from the following structures: -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)7-, -(CH2)8-; preferably, the linker is selected from -(CH2)4-, -(CH2)6- or -(CH2)8-.

[0023] The structural formula of the ibuselenium derivative is as follows:

[0024] Wherein, n is 4, 6, or 8.

[0025] or Where m is 3, 5, or 7.

[0026] The compounds are N-(4-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)butyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)-yl)benzamide, N-(6-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)hexyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)-yl)benzamide, N-(8-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)octyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)-yl)benzamide, N- (4-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-4-oxobutyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)yl)benzamide, N-(6-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-6-oxohexyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)yl)benzamide or N-(8-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-8-oxooctyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)yl)benzamide)

[0027] The present invention also provides a method for preparing the aforementioned hydrophobic-labeled ibuselenium derivative or its pharmaceutically acceptable salt, ester, solvate, or prodrug, comprising the following steps:

[0028] (1) Using compound A1 as the starting material, a condensation reaction agent is added and the condensation reaction is carried out through a linker to obtain compound B1-B3 or compound D1-D3;

[0029] (2) Compounds B1-B3 were deprotected by removing the Boc protecting group under acidic conditions to obtain compounds C1-C3, and compounds D1-D3 were hydrolyzed under alkaline conditions to obtain compounds E1-E3;

[0030] (3) Compounds C1-C3 or E1-E3 were reacted with adamantine or norbornene to prepare compounds of formula (I);

[0031] The structural formula of compound A1 is as follows: The structural formulas of compounds B1-B3 are as follows: The structural formula of the compounds C1-C3 is as follows: The structural formulas of compounds D1-D3 are as follows: The structural formulas of compounds E1-E3 are as follows: .

[0032] In step (1), the condensation agent is 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole, or benzotriazole-1-yl-oxytripyrrolidinephosphine hexafluorophosphate or 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate, and the solvent in the reaction is dichloromethane or tetrahydrofuran.

[0033] The specific reaction steps in step (3) are as follows: 1-adamantane acetic acid, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole are added to C1-C3 or compound E1-E3, or 1-adamantane acetic acid, benzotriazole-1-yl-oxytripyrrolidinephosphide or 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate is added and reacted to obtain the product. The solvent is dichloromethane or tetrahydrofuran.

[0034] The present invention also provides the use of the hydrophobically labeled ibuselenium derivative or its pharmaceutically acceptable salt, ester, solvate or prodrug in the preparation of inhibitors that specifically degrade CypD protein.

[0035] This invention also provides the use of the hydrophobically labeled ibuselenium derivative or its pharmaceutically acceptable salt, ester, solvate or prodrug in the preparation of medicaments for neuroprotection or repair of cell damage.

[0036] Beneficial Effects: Compared with existing technologies, the present invention has the following advantages: The compounds prepared by the present invention have comparable inhibitory activity against CypD to ebuselenium, but exhibit better selectivity, selectively degrading CypD protein in vivo while having less impact on CypA. The compounds of the present invention show no significant toxicity to BV2 cells, while ebuselenium only achieves a 10% cell viability rate at 50 μM. The compounds of the present invention have lower toxicity to BV2 cells and are more biosafety-free. In particular, compound 6 of the present invention has a protective effect against glutamate-induced BV-2 cell damage, and at the same dosage, it is more effective and biosafety-free than ebuselenium. Attached Figure Description

[0037] Figure 1 The reaction route diagram for synthesizing the compounds of this invention;

[0038] Figure 2 The graph shows the cytotoxicity results of the compound on mouse microglia BV-2 cells.

[0039] Figure 3 The neuroprotective efficacy of the compound against glutamate-induced cytotoxicity against human neuroblastoma cells BV-2 is expressed as the mean ± SEM of three independent experiments. Detailed Implementation

[0040] The present invention is further illustrated by the following examples, but these examples do not limit the invention in any way. All reagents, methods, and equipment involved in the examples are conventional in the art. Unless otherwise specified, all reagents and materials used in the following examples are commercially available. In these examples, the structure of the compounds was determined by nuclear magnetic resonance (NMR). The instrument used was a Bruker AVANCE-600 NMR spectrometer, the solvent was DMSO-d6, the internal standard was TMS, and the chemical shift was 10⁻⁶ ppm.

[0041] Example 1: Preparation of Compound 1

[0042] 1. Preparation of 4-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzamido)butyl)tert-butyl carbamate (B1)

[0043] Compound A1 (4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoic acid) was added to a dry reaction flask. CAS No. 153871-75-1, Synthesis Reference 10.1016 / j.bmc.2018.10.022, 159 mg, 0.5 mmol), dry dichloromethane (15 ml), 4-aminobutylcarbamate tert-butyl hydrochloride (Maclean, catalog number B840753) (134 mg, 0.6 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (Maclean, catalog number N835594) (115 mg, 0.6 mmol), 1-hydroxybenzotriazole (Maclean, catalog number H742556) (81 mg, 0.6 mmol) were added under ice bath. The mixture was stirred overnight at room temperature. After the reaction was completed by TLC monitoring, water was added to quench the reaction, and the mixture was extracted with dichloromethane (15 ml * 3). After drying the organic phase, column chromatography yielded 190 mg of white solid, with a yield of 77.8%. The white solid is compound B1, and its characterization results are as follows:

[0044] 1H NMR (600 MHz, DMSO-d6) δ 8.47 (t, J = 5.5 Hz, 1H), 8.12 (d, J =8.0 Hz, 1H), 7.94 (dd, J = 7.5, 5.4 Hz, 3H), 7.79 (d, J = 8.6 Hz, 2H), 7.74 -7.70 (m, 1H), 7.65 (t, J = 5.4 Hz, 1H), 7.51 (t, J = 7.5 Hz, 1H), 3.28 (dd, J= 13.0, 6.7 Hz, 2H), 3.03 (q, J = 6.6 Hz, 2H), 1.61 (d, J = 7.0 Hz, 4H), 1.56(s, 9H).

[0045] 2. Preparation of N-(4-aminobutyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzamide (C1)

[0046] Compound B1 (120 mg, 0.25 mmol) and ethyl acetate hydrochloride solution (4 mol / L, 10 ml) were added to a dry reaction flask and stirred overnight at room temperature. After the reaction was completed by TLC monitoring, the solvent was removed under vacuum and the next reaction was carried out directly.

[0047] 3. Preparation of N-(4-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)butyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzamide (compound 1)

[0048] Compound C1 (97 mg, 0.25 mmol) and dry dichloromethane (15 mL) were added to a dry reaction flask. Under ice bath conditions, 1-adamantaneacetic acid (58 mg, 0.3 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (58 mg, 0.3 mmol), and 1-hydroxybenzotriazole (40 mg, 0.3 mmol) were added. The mixture was stirred overnight at room temperature. After the reaction was complete as monitored by TLC, water was added to quench the reaction. The mixture was extracted with dichloromethane (15 mL * 3), and the dried organic phase was purified by column chromatography to obtain 100 mg of a white solid, which was compound 1, with a yield of 70.9%. The characterization results of compound 1 are as follows:

[0049] 1H NMR (600 MHz, DMSO-d6) δ 8.46 (t, J = 5.5 Hz, 1H), 8.12 (d, J =8.1 Hz, 1H), 7.95 – 7.90 (m, 3H), 7.79 (d, J = 8.5 Hz, 2H), 7.72 (t, J = 7.6Hz, 1H), 7.51 (t, J = 7.4 Hz, 1H), 6.77 (s, 1H), 3.28 (dd, J = 12.8, 6.5 Hz, 2H), 2.98 (dd, J = 12.5, 6.2 Hz, 2H), 1.57 – 1.50 (m, 2H), 1.39 (s, 13H),1.35 – 1.23 (m, 6H).

[0050] ESI: m / z [M + H]+ 566.1857.

[0051] Example 2 Preparation of Compound 2

[0052] 1. Preparation of (6-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)hexyl)tert-butyl carbamate (B2)

[0053] See Example 1, except that (4-aminobutyl)carbamate tert-butyl hydrochloride was replaced with (6-aminohexyl)carbamate tert-butyl hydrochloride (Maclean, catalog number N802505), with a yield of 76.1%.

[0054] 1 H NMR (600 MHz, DMSO-d6) δ 8.47 (t, J = 5.5 Hz, 1H), 8.12 (d, J =8.0 Hz, 1H), 7.94 (dd, J = 7.5, 5.4 Hz, 3H), 7.79 (d, J = 8.6 Hz, 2H), 7.74 –7.70 (m, 1H), 7.65 (t, J = 5.4 Hz, 1H), 7.51 (t, J = 7.5 Hz, 1H), 3.28 (dd, J= 13.0, 6.7 Hz, 2H), 3.03 (q, J = 6.6 Hz, 2H), 1.61 (d, J = 34.9 Hz, 4H),1.56 (s, 9H), 1.40 (m, 4H).

[0055] 2. Preparation of N-(6-aminohexyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzamide (C2)

[0056] See Example 1, except that B1 is replaced with B2.

[0057] 3. N-(6-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)hexyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)yl)benzamide (compound 2)

[0058] See Example 1, except that C1 is replaced with C2, yield is 72.4%.

[0059] 1 H NMR (600 MHz, DMSO-d6) δ 8.45 (t, J = 5.5 Hz, 1H), 8.11 (d, J =8.1 Hz, 1H), 7.95 – 7.90 (m, 3H), 7.79 (d, J = 8.5 Hz, 2H), 7.72 (t, J = 7.6Hz, 1H), 7.50 (t, J = 7.4 Hz, 1H), 6.77 (s, 1H), 3.28 (dd, J = 12.7, 6.6 Hz, 2H), 2.98 (dd, J = 12.5, 6.2 Hz, 2H), 1.57 – 1.50 (m, 2H), 1.39 (m, 13H),1.35 – 1.21 (m, 10H).

[0060] ESI: m / z [M + H]+ 594.2160.

[0061] Example 3 Preparation of Compound 3

[0062] 1. (8-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)octyl)tert-butyl carbamate (B3)

[0063] See Example 1, except that (4-aminobutyl)carbamate tert-butyl hydrochloride was replaced with (8-aminooctyl)carbamate tert-butyl ester (Maclean, catalog number B892741), yield 71.5%.

[0064] 1H NMR (600 MHz, DMSO-d6) δ 8.48 (t, J = 5.7 Hz, 1H), 8.11 (d, J =8.0 Hz, 1H), 7.94 (dd, J = 7.5, 5.4 Hz, 3H), 7.79 (d, J = 8.6 Hz, 2H), 7.74 –7.70 (m, 1H), 7.65 (t, J = 5.4 Hz, 1H), 7.51 (t, J = 7.5 Hz, 1H), 3.28 (dd, J= 13.0, 6.7 Hz, 2H), 3.03 (q, J = 6.6 Hz, 2H), 1.61 (d, J = 34.9 Hz, 4H),1.56 (s, 9H), 1.39 (m, 8H).

[0065] 2. N-(8-aminooctyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzamide (C3)

[0066] See Example 1, except that B1 is replaced with B3.

[0067] 3. N-(8-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)octyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzamide (compound 3)

[0068] See Example 1, except that C1 is replaced with C3, yield is 66.2%.

[0069] 1 H NMR (600 MHz, DMSO-d6) δ 8.46 (t, J = 5.5 Hz, 1H), 8.11 (d, J =8.1 Hz, 1H), 7.95 – 7.90 (m, 3H), 7.79 (d, J = 8.5 Hz, 2H), 7.72 (t, J = 7.6Hz, 1H), 7.50 (t, J = 7.4 Hz, 1H), 6.77 (s, 1H), 3.26 (dd, J = 12.5, 6.6 Hz, 2H), 2.98 (dd, J = 12.5, 6.2 Hz, 2H), 1.57 – 1.50 (m, 2H), 1.40 (m, 13H),1.36 – 1.20 (m, 14H).

[0070] ESI: m / z [M + H] + 622.2480

[0071] Example 4 Preparation of Compound 4

[0072] 1. Methyl 4-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)butyrate (D1)

[0073] Compound A1 (159 mg, 0.5 mmol) and dry dichloromethane (15 mL) were added to a dry reaction flask. Under ice bath conditions, methyl 4-aminobutyrate hydrochloride (Maclean, catalog number M814428) (92 mg, 0.6 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (115 mg, 0.6 mmol), and 1-hydroxybenzotriazole (81 mg, 0.6 mmol) were added. The mixture was stirred overnight at room temperature. After the reaction was complete as monitored by TLC, water was added to quench the reaction. The mixture was extracted with dichloromethane (15 mL * 3), and after drying the organic phase, column chromatography yielded 182 mg of a white solid, which was compound D1, with a yield of 87.1%. The characterization results of compound D1 are as follows:

[0074] 1 H NMR (600 MHz, DMSO-d6) δ 8.48 (t, J = 5.6 Hz, 1H), 8.12 (d, J =8.0 Hz, 1H), 7.96 – 7.91 (m, 3H), 7.80 (d, J = 8.7 Hz, 2H), 7.74 – 7.70 (m,1H), 7.51 (dd, J = 11.0, 4.0 Hz, 1H), 3.60 (s, 3H), 3.42 (dd, J = 12.5, 6.6Hz, 2H), 2.41 (t, J = 6.9 Hz, 2H), 2.05 (m, 2H).

[0075] 2,4-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)butyric acid (E1)

[0076] Add D1 (118 mg, 0.25 mmol) and lithium hydroxide (Maclean, catalog number L812391) aqueous solution (4 mol / L, 5 ml) to a dry reaction flask, stir overnight at room temperature, and after the reaction is complete as monitored by TLC, adjust the pH to >3, a white solid precipitates, filter and dry, and proceed directly to the next step of the reaction.

[0077] 3. N-(4-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-4-oxobutyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)yl)benzamide (compound 4)

[0078] In a dry reaction flask, E1 (100 mg, 0.25 mmol) and dry dichloromethane (15 ml) were added. Under ice bath conditions, 5-norbornene-2-methylamine (Maclean, catalog number N834686) (38 mg, 0.3 mmol), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (58 mg, 0.3 mmol), and 1-hydroxybenzotriazole (40 mg, 0.3 mmol) were added. The mixture was stirred overnight at room temperature. After the reaction was complete as monitored by TLC, water was added to quench the reaction. The mixture was extracted with dichloromethane (15 ml * 3), and after drying the organic phase, column chromatography yielded 102 mg of a white solid, which was compound 4, with a yield of 80.3%. The characterization results of compound 4 are as follows:

[0079] 1 H NMR (600 MHz, DMSO-d6) δ 8.48 (t, J = 5.5 Hz, 1H), 8.12 (d, J =8.1 Hz, 1H), 7.96 – 7.91 (m, 3H), 7.80 (d, J = 8.5 Hz, 2H), 7.74 – 7.70 (m,1H), 7.51 (dd, J = 10.2, 4.5 Hz, 1H), 6.00 (d, J = 9.7, 6.2 Hz, 2H), 3.42(dd, J = 12.5, 6.6 Hz, 2H), 3.28–3.25 (m, 1H), 3.01–2.99(m, 1H), 2.81–2.79(m,1H), 2.60–2.57 (m, 1H), 2.37 (t, J = 6.8 Hz, 2H), 2.05–2.01 (m, 2H), 1.75–1.72 (m, 1H), 1.55–1.53 (m, 1H), 1.35–1.33 (m, 1H).

[0080] ESI: m / z [M + H] + 510.1228

[0081] Example 5 Preparation of Compound 5

[0082] 1. Preparation of methyl hexanoate (D2) of 6-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)hexanoate

[0083] See Example 4, except that methyl 4-aminobutyrate hydrochloride was replaced with methyl 6-aminohexanoate hydrochloride (Maclean, M634632), yield 71.3%.

[0084] 1 H NMR (600 MHz, DMSO-d6) δ 8.47 (t, J = 5.6 Hz, 1H), 8.12 (d, J =8.0 Hz, 1H), 7.96 – 7.91 (m, 3H), 7.80 (d, J = 8.7 Hz, 2H), 7.74 – 7.70 (m,1H), 7.51 (dd, J = 11.0, 4.0 Hz, 1H), 3.60 (s, 3H), 3.28 (dd, J = 12.9, 6.8Hz, 2H), 2.33 (t, J = 7.4 Hz, 2H), 1.62–1.51 (m, 4H), 1.38 – 1.30 (m, 2H).

[0085] 2. Preparation of 6-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)hexanoic acid (E2)

[0086] See Example 4, except that D1 is replaced with D2.

[0087] 3. Preparation of N-(6-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-6-oxohexyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)yl)benzamide (compound 5)

[0088] See Example 4, except that E1 is changed to E2.

[0089] 1H NMR (600 MHz, DMSO-d6) δ 8.47 (t, J = 5.5 Hz, 1H), 8.12 (d, J =8.1 Hz, 1H), 7.96 – 7.91 (m, 3H), 7.81 (d, J = 8.5 Hz, 2H), 7.74 – 7.70 (m,1H), 7.51 (dd, J = 10.2, 4.5 Hz, 1H), 6.00 (d, J = 9.7, 6.2 Hz, 2H), 3.26 (dd, J = 12.1, 6.4 Hz, 2H), 3.20 –3.16 (m, 1H), 3.00–2.96(m, 1H), 2.81–2.78(m, 1H), 2.60–2.58 (m, 1H), 2.35 (t, J = 6.8 Hz, 2H), 2.04– 2.02(m, 2H), 1.75–1.73 (m, 1H), 1.55–1.52 (m, 3H), 1.35–1.3 (m, 5H).

[0090] ESI: m / z [M + H]+ 538.1538.

[0091] Example 6 Preparation of Compound 6

[0092] 1. Preparation of methyl octanoate (D3) of 8-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)octanoate

[0093] See Example 4, except that methyl 4-aminobutyrate hydrochloride was replaced with methyl 8-aminooctanoate hydrochloride (Maclean, A799742), yield 62.8%.

[0094] 1 H NMR (600 MHz, DMSO-d6) δ 8.47 (t, J = 5.6 Hz, 1H), 8.12 (d, J =8.0 Hz, 1H), 7.96 – 7.91 (m, 3H), 7.80 (d, J = 8.7 Hz, 2H), 7.74 – 7.70 (m,1H), 7.51 (dd, J = 11.0, 4.0 Hz, 1H), 3.60 (s, 3H), 3.28 (dd, J = 12.9, 6.8Hz, 2H), 2.33 (t, J = 7.4 Hz, 2H), 1.61–1.52 (m, 4H), 1.36 – 1.28 (m, 6H).

[0095] 2. Preparation of 8-(4-(3-oxobenzo[d][1,2]selenozazole-2(3H)-yl)benzoylamino)octanoic acid (E3)

[0096] See Example 4, except that D1 is replaced with D3.

[0097] 3. Preparation of N-(8-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-8-oxooctyl)-4-(3-oxobenzo[d][1,2]selenozazole-2(3H)yl)benzamide (compound 6)

[0098] See Example 4, except that E1 is replaced with E3, yield is 65.2%.

[0099] 1 H NMR (600 MHz, DMSO-d6) δ 8.46 (t, J = 5.5 Hz, 1H), 8.11 (d, J =8.0 Hz, 1H), 7.96 – 7.91 (m, 3H), 7.81 (d, J = 8.5 Hz, 2H), 7.74 – 7.70 (m,1H), 7.51 (dd, J = 10.2, 4.5 Hz, 1H), 6.00 (d, J = 9.7, 6.2 Hz, 2H), 3.25(dd, J = 12.1, 6.4 Hz, 2H), 3.18 –3.16 (m, 1H), 3.00–2.96(m, 1H), 2.81–2.78(m, 1H), 2.60–2.58 (m, 1H), 2.35 (t, J = 6.8 Hz, 2H), 2.04– 2.02(m, 2H), 1.75–1.73 (m, 1H), 1.55–1.50 (m, 5H), 1.35–1.28 (m, 7H).

[0100] ESI: m / z [M + H] + 566.1848

[0101] Example 7: Determination of Peptidyl Prolyl Cis-Trans Isomerase (PPPase) Activity

[0102] 1. Preparation of CypD stock solution:

[0103] The recombinant plasmid pET-28a(+)-CypD was constructed by GenScript and expressed as CypD protein in the BL21(DE3) strain. The human CypD gene sequence was modified by adding the promoter codon CATATG and the stop codon TGACTCGAG to obtain a 507 bp sequence as shown in SEQ ID NO. 1.

[0104] CATATGGGGAAATCCCTTAGTTTATCTAGACGTAGATGCGAACGGCAAGCCGCTGGGTCGCGTAGTCTTGGAGCTGAAGGCTGACGTGGTTCCGAAAACGGCAGAGAACTTTCGTGCCCTGTGCACCG GCGAAAAAGGTTTTGGCTACAAAGGCTCCACCTTCCATCGTGTTATTCCGTCTTTCATGTGCCAGGCAGGTGATTTTACGAACCACAACGGTACGGGCGGTAAAAGCATTTATGGTTCTCGTTTTCC GGATGAAAACTTCACTCTTAAGCACGTTGGTCCAGGTGTTTTGAGCATGGCGAATGCGGGTCCGAATACCAATGGCTCGCAATTTTTCATCTGCACCATTAAAACCGACTGGCTGGACGGCAAGCAC GTGGTGTTCGGCCATGTCATCGAAGGTATGGATGTTGTGAAAAAAATTGAGAGCTTCGGCAGCAAGAGCGGTCGCACCAGCAAGAAGATCGTGATCACCGACTGTGGTCAGCTGTCCTGACTCGAG,

[0105] The gene sequence shown in SEQ ID NO.1 was introduced into the NdeI / XhoI double-digested expression vector pET-28a(+) to construct the recombinant plasmid pET-28a(+)-CypD. The constructed recombinant plasmid pET-28a(+)-CypD was transformed into competent BL21(DE3) cells. The transformed bacterial culture was evenly spread on kanamycin-containing solid medium, and the colonies growing on the plates were the desired bacterial strain. The strain was inoculated into LB medium containing kanamycin (35 µg / mL, Beyotime, catalog number Y259322) and cultured at 37°C until the OD600nm reached approximately 0.8. Then, 1 mM IPTG (Beyotime, catalog number ST098) was added to induce expression, and the culture was continued at 30°C for 5 hours. Cells were then resuspended in 0.1 M Tris-HCl buffer (pH 8.0), 20 mM NaCl, 2 mM EDTA (Beyotime, catalog number C0196), and 5 mM DTT (Beyotime, catalog number ST043), homogenized at 110 MPa using a high-pressure homogenizer, clarified by centrifugation at 38,000 × g for 45 minutes at 4°C, and then filtered through a 0.45 µm syringe filter. The filtered sample was loaded onto a pre-equilibrated 5 mL SPFF Hitrap column (Cytiva, 17097813) for elution using an elution buffer of 0.1 M Tris-HCl buffer (pH 8.0), 20 mM NaCl, 2 mM EDTA (Beyotime, catalog number C0196), and 5 mM DTT. Finally, CypD was concentrated, aliquoted into small volumes, and flash-frozen at a concentration of 100 µM, and stored at -80°C. Dilute to 1.9 µM with elution buffer before use.

[0106] 2. Preparation of CypA stock solution:

[0107] The recombinant plasmid pET-28a(+)-CypA was constructed by GenScript and expressed as CypA protein in the BL21(DE3) strain. The human CypA gene sequence, with the addition of the promoter codon CAT and the stop codon TAACTCGAG, yielded a gene sequence of 507 bp, as shown in SEQ ID NO. 2.

[0108] CATATGGTAAATCCCACAGTTTTTTTCGATATAGCCGTTGATGGTGAGCCGCTGGGTCGTGTCAGCTTTGAACTGTTTGCGGATAAAGTGCCGAAAACTGCGGAGAACTTCCGCGCACTGTCCACCGGTGAGAAGGGCTTCGGCTACAAAGGTAGCTGCTTTCACCGTATTATCCCGGGTTTCATGTGCCAAGGTGGTGATTTCACCCGTCATAACGGCACCGGCGGCAAGTCCATTTATGGTGAGAAATTCGAGGACGAAAACTTCATCTTGAAGCACACCGGCCCAGGTATTTTGTCTATGGCGAACGCTGGTCCGAATACCAATGGCTCACAGTTTTTTATCTGCACCGCTAAAACGGAATGGCTGGACGGCAAGCATGTTGTTTTTGGCAAGGTGAAAGAAGGTATGAACATCGTGGAAGCAATGGAGCGCTTCGGCAGCCGTAATGGTAAGACGAGCAAGAAAATCACCATTGCGGACTGTGGTCAGCTGGAATAACTCGAG,

[0109] The gene sequence shown in SEQ ID NO.2 was introduced into the NdeI / XhoI double-digested expression vector pET-28a(+) to construct the recombinant plasmid pET-28a(+)-CypA. The constructed recombinant plasmid pET-28a(+)-CypA was transformed into competent BL21(DE3) cells. The transformed bacterial culture was evenly spread on kanamycin-containing solid medium, and the colonies growing on the plates were the desired bacterial strain. The strain was inoculated into LB medium containing kanamycin (35 µg / ml, Beyotime, catalog number Y259322) and cultured at 37°C until the OD600nm reached approximately 0.8. Then, 1 mM IPTG (Beyotime, catalog number ST098) was added to induce expression, and the culture was continued at 30°C for 5 hours. Cells were then resuspended in 0.1 M Tris-HCl buffer (pH 8.0), 20 mM NaCl, 2 mM EDTA (Beyotime, catalog number C0196), and 5 mM DTT (Beyotime, catalog number ST043), homogenized at 110 MPa using a high-pressure homogenizer, clarified by centrifugation at 38,000 × g for 45 minutes at 4°C, and then filtered through a 0.45 µm syringe filter. The filtered sample was loaded onto a pre-equilibrated 5 mL Ni column (Beyotime, catalog number P2210), using the same elution buffer (0.1 M Tris-HCl buffer (pH 8.0), 20 mM NaCl, 2 mM EDTA (Beyotime, catalog number C0196), and 5 mM DTT) as described above. Finally, CypA was concentrated, aliquoted, and flash-frozen at a concentration of 100 µM, and stored at -80°C. Dilute to 2.2 µM with elution buffer before use.

[0110] 3. Activity Assay: Compounds 1-6 were added to the assay buffer (25 mM Hepes, 100 mM NaCl, pH 7.8) and CypD (1.9 µM stock solution) at concentrations of 10 μL and 10 μL, respectively. -4 10 -5 10 -6 10 -7 10 -8 and 10 -9 mol / L.

[0111] Compounds 1-6 were added to the assay buffer (25 mM Hepes, 100 mM NaCl, pH 7.8) and CypA (2.2 µM stock solution) at concentrations of 10 μL and 10 μL, respectively. -4 10 -5 10 -6 10 -7 10 -8 and 10 -9mol / L.

[0112] All the assay solutions obtained above were pre-cooled to 4°C. Then, 5 µL of 50 mg / mL chymotrypsin (Aladdin, np001104, dissolved in 1 mM HCl) was added. The reaction was initiated by adding 20 µL of 3.2 mM peptide substrate (N-succinyl-Ala-Ala-Cis-Pro-Phe-p-nitroaniline, Aladdin, S357870, dissolved in lithium chloride / trifluoroethanol). The absorbance of p-nitroaniline at 390 nm was measured at 60 seconds using a spectrophotometer, followed by 1-second intervals. Ibuselenium was purchased from Aladdin, catalog number P137293. The experimental results are shown in Table 1.

[0113] Table 1. Inhibitory activity of compounds 1-6 against CypD and CypA.

[0114]

[0115] Example 8 CYP Protein Degradation Test

[0116] Glutamate-induced BV-2 cells (Procyon, catalog number CL-0493) (5×10 3 Cells (number per mL, volume 0.1 mL) were placed in 96-well flat-bottomed culture plates and cultured overnight at 37°C until they adhered. Then, 100 µL each of the test compounds 1-6 (final concentrations of 2 µM, 5 µM, and 10 µM) were added to treat the cells for 24 h. Cells were then lysed for Western blotting (WB) experiments, and protein bands were calculated using ImageJ. The experimental results are shown in Table 2.

[0117] Table 2 shows the CYP protein degradation results of compounds 1-6.

[0118]

[0119] Compounds 1-6 of the present invention exhibit inhibitory activity against CypD comparable to that of epoxetine, but with better selectivity, enabling them to selectively degrade CypD protein in vivo while having less impact on CypA.

[0120] Example 9 Cytotoxicity test

[0121] Drugs and reagents: 3-(4,5-dimethylthiazolyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (purchased from Aladdin)

[0122] Instrument: THERMO Varioskan Flash full-wavelength multi-functional microplate reader.

[0123] Experimental method: Glutamate-induced BV-2 cells (5×10⁻⁶) were used... 3Cells (number / mL, volume 0.1 mL) were placed in 96-well flat-bottom culture plates and cultured overnight at 37 °C until they reached adherence. Then, 100 µL each of the test compounds 1-6 (final concentrations: 10 µM, 20 µM, and 50 µM) were added to treat the cells for 24 h. 20 µL of MTT reagent was added to each well, and the cells were incubated at 37 °C for 4 h. 50 µL of DMSO was added to each well to dissolve the formazan, and its UV absorbance was measured at 490 nm using a microplate reader. All experiments were performed in triplicate. Results Figure 2 As shown.

[0124] Compounds 1, 2, 4, 5, and 6 of this invention showed no significant toxicity to BV2 cells at 10 μM, 20 μM, and 50 μM, while the cell survival rate of ibuselenium at 50 μM was only 10%. The compounds of this invention exhibit less toxicity to BV2 cells and are therefore more biosafety-tolerant.

[0125] Example 10: Neuroprotective effect against glutamate-induced BV2 cell damage

[0126] Drugs and reagents: 3-(4,5-dimethylthiazolyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (purchased from Aladdin)

[0127] Instrument: THERMO Varioskan Flash full-wavelength multi-functional microplate reader.

[0128] Experimental method: Glutamate-induced BV-2 cells (5×10⁻⁶) were used. 3 Cells (number / mL, volume 0.1 mL) were placed in 96-well flat-bottom culture plates and incubated overnight at 37°C to adhere to the bottom of the plate. Cells were treated for 24 h with 2 μM, 5 μM, and 10 μM of compound 6 and the control compound ebuselenium. MTT reagent was added to the wells, and the plates were incubated at 37°C for 4 h. Cells were then lysed with 0.1 mL of lysis buffer. After incubation, the cells were kept at 37°C for another 24 h, and the colorimetric reaction was measured at 490 nm using a microplate reader. All experiments were performed in triplicate. Results Figure 3 As shown. From Figure 3 It can be seen that compound 6 of the present invention has a protective effect against glutamate-induced BV-2 cell damage at 2 μM, 5 μM and 10 μM, and is more effective and biosafety-free than ibuprofen at the same dose.

Claims

1. An ibuselenium derivative containing a hydrophobic tag, or a pharmaceutically acceptable salt, ester, solvate, or prodrug thereof, characterized in that, The structural formula of the ibuselenium derivative is shown in formula (I): (I) Among them, the linker is C2-C 24 The alkylene chain is optionally substituted by one or more substituents independently selected from halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, and oxoyl groups, wherein the HyT TAG is adamantyl or norbornenyl, preferably, the adamantyl is selected from 1-adamantyl or 2-adamantyl, and preferably, the norbornenyl is selected from 5-norbornen-2-yl.

2. The ibuselenium derivative containing a hydrophobic tag according to claim 1, or its pharmaceutically acceptable salt, ester, solvate, or prodrug, is characterized in that, Optionally, one or more linking groups selected from -O-, -NH-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -S-, -SO2-, -SS-, -triazolyl-, and -phenylene- are inserted into the linker.

3. The ibuselenium derivative containing a hydrophobic tag according to claim 1, or its pharmaceutically acceptable salt, ester, solvate, or prodrug, is characterized in that, The linker is selected from the following structures: -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)7-, -(CH2)8-; preferably, the linker is selected from -(CH2)4-, -(CH2)6- or -(CH2)8-.

4. The ibuselenium derivative containing a hydrophobic tag according to claim 1, or its pharmaceutically acceptable salt, ester, solvate, or prodrug, is characterized in that, The structural formula of the ibuselenium derivative is as follows: n is 4, 6, or 8. or m is 3, 5, or 7.

5. The ibuselenium derivative containing a hydrophobic tag according to claim 1, or its pharmaceutically acceptable salt, ester, solvate, or prodrug, characterized in that, The compounds are N-(4-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)butyl)-4-(3-oxobenzo[d][1,2]selezol-2(3H)-yl)benzamide, N-(6-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)hexyl)-4-(3-oxobenzo[d][1,2]selezol-2(3H)-yl)benzamide, N-(8-(2-((3r,5r,7r)-adamantane-1-yl)acetamido)octyl)-4-(3-oxobenzo[d][1,2]selezol-2(3H)-yl)benzamide, N-(4 -((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-4-oxobutyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)yl)benzamide, N-(6-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-6-oxohexyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)yl)benzamide or N-(8-((bicyclo[2.2.1]hept-5-en-2-ylmethyl)amino)-8-oxooctyl)-4-(3-oxobenzo[d][1,2]selezazole-2(3H)yl)benzamide) 6. A method for preparing the ibuselenium derivative containing a hydrophobic tag, or a pharmaceutically acceptable salt, ester, solvate, or prodrug thereof, as described in any one of claims 1 to 5, characterized in that, Includes the following steps: (1) Using compound A1 as the starting material, a condensation reaction agent is added and the condensation reaction is carried out through a linker to obtain compound B1-B3 or compound D1-D3; (2) Compounds B1-B3 were deprotected by removing the Boc protecting group under acidic conditions to obtain compounds C1-C3, and compounds D1-D3 were hydrolyzed under alkaline conditions to obtain compounds E1-E3; (3) Compounds C1-C3 or E1-E3 were reacted with adamantine or norbornene to prepare compounds of formula (I); The structural formula of compound A1 is as follows: The structural formulas of compounds B1-B3 are as follows: The structural formulas of compounds D1-D3 are as follows: The structural formula of the compounds C1-C3 is as follows: The structural formulas of compounds E1-E3 are as follows: .

7. The method for preparing the ibuselenium derivative containing a hydrophobic tag or its pharmaceutically acceptable salt, ester, solvate, or prodrug according to claim 6, characterized in that, The condensation reaction agent in step (1) is 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole, or benzotriazole-1-yl-oxytripyrrolidinephosphine hexafluorophosphate or 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate, and the solvent in the reaction is dichloromethane or tetrahydrofuran.

8. The method for preparing the ibuselenium derivative containing a hydrophobic tag or its pharmaceutically acceptable salt, ester, solvate, or prodrug according to claim 6, characterized in that, The specific reaction steps in step (3) are as follows: 1-adamantane acetic acid, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole are added to C1-C3 or compound E1-E3, or 1-adamantane acetic acid, benzotriazole-1-yl-oxytripyrrolidinephosphide or 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate is added and reacted to obtain the product. The solvent is dichloromethane or tetrahydrofuran.

9. The use of the hydrophobic-tagged ibuselenium derivative or its pharmaceutically acceptable salt, ester, solvate or prodrug of any one of claims 1 to 5 in the preparation of a specific inhibitor of CypD and / or a degrader of CypD protein.

10. The use of the hydrophobic-tagged ibuselenium derivative or its pharmaceutically acceptable salt, ester, solvate or prodrug as described in any one of claims 1 to 5 in the preparation of a medicament for neuroprotection or repair of cell damage.

Images