Linear mRNA sequence, mRNA vaccine and construction and application thereof

Abstract

The present application relates to a linear mRNA sequence, an mRNA vaccine and its construction and application. The nucleotide sequence of the linear mRNA sequence of the present application is as shown in SEQ ID NO:1. The construction method is as follows: after obtaining the amino acid sequences of HPV16 type E6 and E7 and HPV18 type E6 and E7, the amino acid sequences of HPV16 type E6 and E7 and HPV18 type E6 and E7 are partially modified to improve the safety of the vaccine. The human IL-6 signal peptide sequence with high secretion efficiency is also fused with the HPV16 / 18 antigen. The extracellular segment of human FMS-like tyrosine kinase 3 ligand (FLT3L) protein is also selected for co-expression to promote the proliferation, differentiation and maturation of dendritic cells and natural killer cells and improve immunogenicity. The nucleic acid sequences corresponding to the four target antigens are cloned into a non-self-replicating vector. The novel HPV therapeutic mRNA vaccine of the present application contains the linear mRNA sequence, can induce a very strong HPV16 / 18 specific cellular immune response in C57BL / 6 mice, effectively inhibit tumor growth, and has good antitumor effect.

Description

Technical Field

[0001] This invention relates to the field of medical molecular biology, and in particular to linear mRNA sequences, mRNA vaccines, their construction and application. Background Technology

[0002] Human papillomavirus (HPV) is a type of DNA virus composed of double-stranded circular DNA, with a genome length of approximately 8 kb. To date, more than 200 types of HPV have been identified, classified into low-risk and high-risk types based on the severity of the disease caused by infection. Among the high-risk types, HPV16 and HPV18 cause 70% of cervical cancers. Persistent HPV infection can lead to various cancers, including cervical cancer.

[0003] Although several HPV preventive vaccines have been approved for marketing, the following reasons have led to their limited availability: (1) a large existing HPV infection base; (2) HPV preventive vaccines were previously only used in women, while men can also be infected with HPV; and (3) the availability of HPV preventive vaccines is low in developing countries. Currently, hundreds of thousands of people worldwide still develop HPV-related cancers each year, and more than half of these patients die annually.

[0004] In recent years, immunotherapies such as CAR-T and immune checkpoint blockade have achieved great success in cancer treatment. Therapeutic vaccines, also a type of immunotherapy, are an important means of eliminating HPV-related cancers, and their research is of great significance. However, currently, no therapeutic vaccine for HPV-related cancers has been approved for marketing. Furthermore, most HPV therapeutic vaccines, whether in clinical or preclinical research stages, are not effective when used alone and require combination therapy with anti-PD-1 / PD-L1 antibodies to achieve better therapeutic results. Therefore, developing a therapeutic HPV vaccine is of great importance. Summary of the Invention

[0005] This invention discloses a linear mRNA sequence, a novel therapeutic HPV mRNA vaccine, and its construction and application. In immunogenicity assays, this novel therapeutic HPV mRNA vaccine induced a very high HPV-specific cellular immune response in C57BL / 6 mice.

[0006] This invention includes the following technical solutions: A mutant HPV16 E6, with the amino acid sequence shown in SEQ ID NO:7, was introduced. A total of 7 mutations were introduced based on the structure of the HPV16E6-p53 complex. Three mutations, F9E, P12R, and E25A, were introduced at the first binding interface between the two, and three mutations, D51R, F54R, and D56A, were introduced at the second binding interface. In addition, one mutation, R84E, was introduced at the E6-E6AP binding site.

[0007] A mutant HPV18 E6, with the amino acid sequence shown in SEQ ID NO:8, was introduced. A total of 7 mutations were introduced, based on the structure of the HPV16E6 and p53 complex and through sequence alignment of HPV16 E6 and HPV18 E6, at homologous conserved sites. Three mutations, F4E, P7R, and E20A, were introduced at the first binding interface, and three mutations, E46A, F49R, and D51A, were introduced at the second binding interface. In addition, one mutation, R79E, was introduced at the E6-E6AP binding site.

[0008] A protein encoding a fusion protein, with a nucleotide sequence as shown in SEQ ID NO:4.

[0009] A linear mRNA sequence, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0010] The method for constructing the aforementioned linear mRNA sequence includes first linking the human IL-6 signal peptide to the extracellular domain of the human FLT3L protein; then, the extracellular domain of the human FLT3L protein, the aforementioned mutant HPV16 E6, mutant HPV16 E7, the aforementioned mutant HPV18 E6, and mutant HPV18 E7 are sequentially linked in tandem through two repeating rigid linkers (EAAAK). That is, the sequence is: human IL-6 signal peptide sequence + extracellular domain of human Flt3L + two rigid linkers (EAAAK) + mutant HPV16 E6 + two rigid linkers (EAAAK) + mutant HPV16 E7 + two rigid linkers (EAAAK) + mutant HPV18 E6 + two rigid linkers (EAAAK) + mutant HPV18 E7. The fusion protein is 740 amino acids long and has a predicted molecular weight of 84.32 kDa.

[0011] Preferably, the mutant HPV16 E7 introduces two mutations, C24G and E26G; and the mutant HPV18 E7 introduces two mutations, C27G and E29G.

[0012] Preferably, the nucleotide amino acid sequence of the extracellular segment of the human FLT3L protein is shown in SEQ ID NO:3.

[0013] Specifically, the method for constructing the above-mentioned linear mRNA sequence includes: following the amino acid sequence of the fusion protein shown in SEQ ID NO:2 (containing human IL-6 signal peptide, human FLT3L protein extracellular domain, mutant HPV16 E6, mutant HPV16 E7, mutant HPV18 E6, and mutant HPV18 E7), optimizing the codons and RNA sequence to obtain the nucleotide sequence encoding the fusion protein (SEQ ID NO:4); then adding a BamHI restriction site, a T7 promoter sequence, a human α-globin 5' UTR sequence, and a kozak sequence to the 5' end of SEQ ID NO:4; adding two different stop codons TGATAA (to more effectively terminate translation), a human α-globin 3' UTR sequence, and an EcoRV restriction site to the 5' end; and after gene synthesis based on the spliced ​​nucleotide sequence, cloning the gene into the vector GS-CMV-120A-BsaI (mRNA-specific vector, kanamycin resistant) through the restriction sites at both ends to obtain a non-self-replicating plasmid.

[0014] A novel therapeutic mRNA vaccine for HPV comprises the aforementioned non-self-replicating linear mRNA sequence.

[0015] The above-mentioned method for preparing mRNA vaccines includes mixing 1-octylnonyl 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]octanoic acid (SM102), DSPC, cholesterol, and DME-PEG2000 as lipid components in a mass ratio of 50:10:38.5:1.5.

[0016] The above-mentioned linear mRNA sequence is used in the preparation of anti-HPV tumor drugs. Preferably, the HPV-related disease includes cancer or tumor. The cancer or tumor includes, for example, cervical cancer, anal cancer, penile cancer, vaginal cancer, vulvar cancer, and oropharyngeal cancer in the posterior pharynx.

[0017] The above-mentioned linear mRNA sequence is used in the preparation of drugs that induce an immune response in subjects in need.

[0018] Considering vaccine safety, this invention partially modified the amino acid sequences of E6 and E7. The E6 protein sequence modification (mutation / deletion) aimed to alter the p53 binding / degradation domain and the E6AP binding domain, thereby eliminating the oncogenicity of the E6 protein. The E7 protein modification (mutation / deletion) aimed to disrupt the Rb protein binding domain. Furthermore, the human IL-6 signal peptide sequence, capable of efficient secretion, was fused with the HPV16 / 18 antigen. The extracellular domain of the human FMS-like tyrosine kinase 3 ligand (FLT3L) protein (SEQ ID NO:3) was also selected for co-expression to promote the proliferation, differentiation, and maturation of dendritic cells and natural killer cells, thereby enhancing immunogenicity. The nucleic acid sequences corresponding to the two target antigens were cloned into a non-self-replicating vector to construct the non-self-replicating mRNA HPV-001.

[0019] Compared with the prior art, the present invention has the following advantages: 1. The LNP-delivered HPV mRNA vaccine of the present invention exhibits good immunogenicity and can effectively stimulate high-level immune responses in different species, especially HPV antigen-specific cellular immunity. It can induce a very strong HPV16 / 18-specific cellular immune response in C57BL / 6 mice.

[0020] 2. The LNP-delivered HPV mRNA vaccine of the present invention can effectively inhibit tumor growth in C57BL / 6 mice and has a good anti-tumor effect.

[0021] 3. Compared with HPV therapeutic protein vaccines or DNA vaccines, the HPV mRNA vaccine of the present invention has a simpler preparation process, higher safety, and is more suitable for clinical development and application. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the mRNA construct design of the present invention.

[0023] Figure 2 This invention relates to the Western Bolt assay of the expression of the mRNA construct stock solution in HEK293T cells.

[0024] Figure 3 The study used flow cytometry to analyze the level of antigen-specific T cells produced in the spleen of C57BL / 6 mice after three immunizations with LNP-delivered HPV-001 and HPV-001-Mn vaccines.

[0025] Figure 4 This describes the changes in tumor volume in C57BL / 6 mice after inoculating them with TC-1 cells and then immunizing them three times with LNP-delivered HPV-001 or HPV-001-Mn vaccines. Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments and accompanying drawings. The advantages and features of the present invention will become clearer with the description.

[0027] Example 1 Antigen and molecular design of mRNA The amino acid sequences of HPV16 and HPV18 E6 and E7 were retrieved from the Genbank database of NCBI (https: / / www.ncbi.nlm.nih.gov / ). Based on the first 100 amino acid sequences of each protein, the amino acid sequences of HPV16 and HPV18 E6 and E7 were obtained as follows: HPV16 E6; HPV16 E7; HPV18 E6; HPV18 E7, to cover different strains of HPV16 and HPV18.

[0028] Because E6 and E7 are proto-oncogenes, considering the safety of the vaccine, the amino acid sequences of E6 and E7 were partially modified to obtain mutant HPV16 E6, mutant HPV16 E7, mutant HPV18 E6, and mutant HPV18 E7, as detailed below: (1) Mutant HPV16 E6 (SEQ ID NO:7) introduced a total of 7 mutations. Based on the structure of the HPV16 E6 and p53 complex, 3 mutations F9E, P12R, and E25A were introduced at the first binding interface between the two, and 3 mutations D51R, F54R, and D56A were introduced at the second binding interface between the two. In addition, 1 mutation R84E was introduced at the binding site between E6 and E6AP; (2) Mutant HPV16 E7 introduced a total of 2 mutations C24G and E26G. Based on the existing vaccine design and structural data, introducing two mutations in the LXCXE motif can eliminate the binding with pRb protein; (3) Mutant HPV18 E6 (SEQ ID NO:7) introduced a total of 7 mutations F9E, P12R, and E25A; and 3 mutations D51R, F54R, and D56A were introduced at the second binding interface between the two. NO:8) A total of 7 mutations were introduced. Based on the structure of the HPV16 E6 and p53 complex and through sequence alignment of HPV16 E6 and HPV18 E6, mutations were introduced at homologous conserved sites. Three mutations, F4E, P7R, and E20A, were introduced at the first binding interface between the two, and three mutations, E46A, F49R, and D51A, were introduced at the second binding interface between the two. In addition, one mutation, R79E, was introduced at the binding site between E6 and E6AP. (4) Two mutations, C27G and E29G, were introduced in the mutant HPV18 E7. Two mutations were introduced at the LXCXE motif to eliminate the binding with pRb protein. Specifically, the E6 protein sequence modification (mutation / deletion) was to change the p53 binding / degradation domain and the E6AP binding domain, thereby eliminating the carcinogenicity of the E6 protein. The E7 protein modification (mutation / deletion) was to destroy the domain that binds to retinoblastoma protein (pRb).

[0029] In addition, the human IL-6 signal peptide sequence, which can be secreted efficiently, was fused with the HPV16 / 18 antigen.

[0030] To further enhance the immunogenicity of the target antigens, the extracellular domain of human FMS-like tyrosine kinase 3 ligand (FLT3L) protein (SEQ ID NO:3) was co-expressed to promote the proliferation, differentiation, and maturation of dendritic cells and natural killer cells, thereby improving immunogenicity. The nucleic acid sequences corresponding to the two target antigens were cloned into a non-self-replicating vector to construct the non-self-replicating mRNA HPV-001.

[0031] Schematic diagram of the construct is as follows Figure 1 ,in Figure 1 The mutant HPV16 E6 / E7 and mutant HPV18 E6 / E7 represent the E6 or E7 proteins of HPV subtypes 16 or HP18 after mutation. The specific construction method is as follows.

[0032] First, the human IL-6 signal peptide was directly linked to the extracellular domain of the human FLT3L protein. Then, the five proteins—the extracellular domain of the human FLT3L protein, mutant HPV16 E6, mutant HPV16 E7, mutant HPV18 E6, and mutant HPV18 E7—were sequentially linked in tandem through two repeating rigid linkers (EAAAK). That is, the fusion protein consists of the human IL-6 signal peptide sequence + the extracellular domain of human FLT3L + two rigid linkers (EAAAK) + mutant HPV16 E6 + two rigid linkers (EAAAK) + mutant HPV16 E7 + two rigid linkers (EAAAK) + mutant HPV18 E6 + two rigid linkers (EAAAK) + mutant HPV18 E7. The full-length fusion protein is 740 amino acids long, with a predicted molecular weight of 84.32 kDa.

[0033] Example 2 Preparation of non-self-replicating mRNA 1. Construction of the non-self-replicating vector HPV-001 plasmid For the non-self-replicating mRNA construct HPV-001, the complete nucleotide sequence is shown in SEQ ID NO:1. Following the amino acid sequence of the fusion protein shown in SEQ ID NO:2 (containing human IL-6 signal peptide, human FLT3L protein extracellular domain, mutant HPV16E6, mutant HPV16 E7, mutant HPV18 E6, and mutant HPV18 E7), the codons and RNA sequence were optimized to obtain the nucleotide sequences encoding the fusion protein (SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6). Based on Table 1, SEQ ID NO:4 was selected as the nucleotide sequence encoding the fusion protein after comparing the codon fitness index (CAI) and the minimum free energy of the protein coding region (CDS MFE). Then, a BamHI restriction site, the T7 promoter sequence TAATACGACTCACTATAGG, and the human α-globin 5' UTR sequence were added to the 5' end of SEQ ID NO:4. The gene was synthesized using the following sequences: ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC, kozak sequence GCCACC, two different stop codons TGATAA added to the 5' end (for more effective translation termination), human α-globin 3' UTR sequence GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA, and EcoRV restriction site. The resulting gene was then cloned into the vector GS-CMV-120A-BsaI (mRNA-specific vector, kanamycin resistant) via the restriction sites at both ends, yielding a non-self-replicating plasmid. This plasmid was then transformed into the Stbl3 strain to obtain glycerol-containing bacteria.

[0034] Table 1 Sequence Optimization Information Table

[0035] 2. Plasmid extraction Pilosulate 20 mL of LB liquid culture medium into a sterile shake flask, add kanamycin, inoculate with glycerol bacterial suspension, and incubate to obtain activated bacterial suspension. Add the activated bacterial suspension to LB liquid culture medium, incubate, and centrifuge to discard the supernatant. Extract plasmids using kit DC205-01.

[0036] Example 3 Detection of fusion protein expression after plasmid transfection into cells The quantity on the first day is 1×10 6HEK293T cells with a viability greater than 95% were seeded into 6-well plates and cultured overnight at 37 °C. Plasmid transfection was performed the following day.

[0037] 1. Plasmid transfection Before transfection, HEK293T cells in 6-well plates were changed using DMEM medium containing 2% FBS, 2 mL / well. In a sterile 1.5 mL EP tube, 375 μL of opti-MEM medium (without serum and antibiotics) was added, followed by 7.5 μg of plasmid, and gently mixed. Then, 12 μL of Lipo8000 transfection reagent (C0533-0.5 mL) was added to the above mixture and gently mixed. The transfection reagent-nucleic acid complex was then added to the cells in the 6-well plates at 125 μL / well, gently mixed, and the cells were returned to the incubator for 48 h of further culture. A total of 3 sample wells and 3 control wells were prepared.

[0038] After culturing transfected cells for 48 h, cells were harvested. Cells from each well were gently blown off and transferred along with the supernatant to a sterile 1.5 mL EP tube. The tubes were centrifuged at 1000 rpm for 5 min at room temperature. The supernatant was then transferred to a new sterile 1.5 mL EP tube. The cell supernatant tube was labeled with the date and stored at -80 °C for later use. For each cell pellet, 100 μL of pre-added RAPI lysis buffer (strong) (P0013B) containing the protease inhibitor (P1045) was added. Lysis was performed on ice for 5 min, followed by centrifugation at 1400 g, 4 °C, for 5 min. The supernatant was transferred to a new 1.5 mL EP tube, labeled with the name and date, and stored at -80 °C for later use.

[0039] 2. Fusion protein expression detection (Western Blot method) Samples were subjected to SDS-PAGE electrophoresis. The loading volume of cell supernatant and cell lysate samples from both the control group and plasmid transfection group was 30 μL, and 10 μL of pre-stained protein marker (WJ103) was loaded. Electrophoresis was performed at 150V for 50 min. After electrophoresis, the gel was removed, and the desired portion of gel was retained according to the location of the pre-stained protein marker. Transfer was then performed at 450mA for 45 min. After transfer, the gel was discarded, and the PVDF membrane was placed in a clean, flat-bottomed plastic box with the gel-contact side facing upwards. 50 mL of 5% skim milk solution was poured into the box, and the membrane was blocked overnight at 4℃ using a shaker. After blocking, the skim milk solution was discarded. The primary antibody was diluted with 5% skim milk to a total volume of 20 mL. After blocking, pour in 20 mL of primary antibody incubation solution (HPV16 E6 + HPV18 E6 rabbit polyclonal antibody, 1:500), and incubate with gentle shaking on a shaker at 37 ℃ for 240 min. After primary antibody incubation, discard the incubation solution, add 20 mL of TBST, and wash with shaking on a shaker for 5 min. Repeat the washing at least 3 times. After washing, discard the TBST. Add 20 mL of secondary antibody incubation solution (goat anti-rabbit HRP conjugated secondary antibody, 1:2000), and incubate with gentle shaking on a shaker at 37 ℃ for 90 min. After secondary antibody incubation, discard the incubation solution, and wash three times. Develop the PVDF membrane in a developing apparatus.

[0040] Example 4 vaccine preparation LNP-mRNA was prepared, and lipid nanoparticles were prepared using SM102, DSPC, cholesterol, and DME-PEG2000 as lipid components in a ratio of 50:10:38.5:1.5. Mn-free nanoparticles were also prepared. 2+ HPV-001-LNP. Same lipid composition and ratio, but with Mn 2+ The mass ratio of Mn to packaged HPV-001 mRNA was 1:1 to prepare a solution containing Mn. 2+ The quality control parameters for HPV-001-LNP-Mn are shown in Table 2.

[0041] Table 2 Physicochemical Detection of LNP Formulations

[0042] Example 5 Immunogenicity of vaccine in mice Six-week-old (15-20g) C57BL / 6 mice were acclimatized for one week and then immunized with 20 μg mRNA of the HPV-001-LNP and HPV-001-LNP-Mn complexes in the right hind leg on days 0, 7, and 14 (D0, D7, D14). Control group 1 was injected with an equal volume of PBS solution (denoted as PBS group), and control group 2 was injected with an equal volume of MnCl2 solution (denoted as MnCl2 group). 2+ Five mice were divided into groups. On day 21 (D21), the spleens of the mice were collected and stimulated with a mixture of HPV16 E6 / HPV16 E7 / HPV18E6 / HPV18 E7 peptide libraries (containing four peptides: HPV16 E6: aa100-108 NKPLCDLLI, HPV16 E7: aa49-57 RAHYNIVTF, HPV18 E6: aa67-75 KCIDFYSRI, HPV18 E7: aa7-15 TLQDIVLHL) before flow cytometry analysis.

[0043] 1. Spleen cell treatment PBS group and Mn were collected on D21. 2+ Fresh spleens from mice immunized three times (group 1), HPV-001-LNP, and HPV-001-LNP-Mn) were rinsed with RPMI 1640 incomplete medium (containing 1% penicillin and no FBS) and placed in 15 mL centrifuge tubes containing 5 mL of RPMI 1640 incomplete medium and stored on ice.

[0044] Place a 100 μm sieve at the mouth of a 50 mL sterile centrifuge tube, rinse the sieve with 2 mL of RPMI 1640 incomplete culture medium, gently grind the spleen into single cells on the sieve using a 5 mL syringe plunger, rinse with 3 mL of incomplete RPMI 1640 culture medium, and centrifuge at 600 g for 5 min at room temperature.

[0045] Discard the supernatant, add 2 mL of erythrocyte lysis buffer, resuspend the cells, allow to stand at room temperature for 2 min, then centrifuge at 600 g for 5 min at room temperature.

[0046] Discard the supernatant, add 5 mL of RPMI 1640 complete medium (containing 1% penicillin and 10% FBS) to resuspend the cells, and centrifuge at 600 g for 5 min at room temperature.

[0047] Discard the supernatant, resuspend the cells in 5 mL of RPMI 1640 complete medium, mix 10 μL and 10 μL of AO / PI dye, count the viable cells using a cell counter, and centrifuge at 600 g for 5 min at room temperature. Discard the supernatant, resuspend the cells in an appropriate amount of RPMI 1640 complete medium, and adjust the cell concentration to 1 × 10⁻⁶ cells / mL. 7 cells / mL.

[0048] 2. Peptide library stimulation Add cells to 96-well round-bottom plates, 200 μL per well, 2×10⁶ cells / well. 6 Cells / well. Dilute the peptide with RPMI 1640 complete medium, adding 20 μL of the diluted peptide to each sample well to achieve a working concentration of 10 μg / mL. Positive control wells were added with a phorbol ester / ionomycin mixture (250×), negative control wells were added with an equal volume of RPMI 1640 complete medium, and blank control wells were added with an equal volume of RPMI 1640 complete medium. Incubate at 37 °C for 12 h.

[0049] 3. Flow cytometry staining Cell transfer: Transfer cells to V-bottom 96-well plates, centrifuge at 2000 rpm for 5 min at room temperature, and discard the supernatant. Wash once with serum-free PBS, 200 μL / well, centrifuge at 2000 rpm for 5 min at room temperature, and discard the supernatant.

[0050] Live / dead staining: Dilute Zombie Violet™ dye 1:100 with serum-free PBS, add 100 μL of dye dilution to each well, and incubate at room temperature in the dark for 20 min. Wash twice with PBS containing 2% FBS.

[0051] CD16 / CD32 antibody blocking: The antibody dosage is 2 μg / well. Dilute the antibody with PBS containing 2% FBS, 100 μL per well, mix well, incubate on ice in the dark for 5 min, centrifuge at 2000 rpm for 5 min at room temperature, discard the supernatant and proceed directly to surface staining.

[0052] Surface staining: No staining was performed on the blank control group, while staining was performed on both the negative and positive control groups. Three types of antibodies—CD3, CD4, and CD8—were used per well, at a concentration of 2 μg / well for CD3, 0.5 μg / well for CD4, and 0.5 μg / well for CD8. The solutions were diluted to 50 μL with 2% FBS in PBS, mixed thoroughly, and the cells from the negative control, positive control, and sample groups were resuspended in the mixture. Cells were incubated on ice in the dark for 20 min. Cells were washed twice with PBS containing 2% FBS, centrifuged at 2000 rpm for 5 min at room temperature, and the supernatant was discarded.

[0053] Cell permeabilization: Add 100 μL of FP solution to each well for resuspending and incubate on ice in the dark for 20 min. Wash twice with PBS containing 2% FBS, centrifuge at 2000 rpm for 5 min at room temperature, and discard the supernatant.

[0054] Intracellular staining: No staining was performed on the blank control group, while staining was performed on both the negative and positive control groups. 2 μg of IFN-γ antibody per well was added to 46 μL of wash buffer, mixed well, and the cells were resuspended in the mixture. The cells were incubated on ice in the dark for 20 min. The cells were washed twice with wash buffer, resuspended in flow cytometry buffer, transferred to flow cytometry tubes, and analyzed on the same day.

[0055] 4. Experimental Results Spleens of mice immunized with HPV-001-LNP and HPV-001-LNP-Mn were collected on day 21, and flow cytometry analysis was performed after stimulation with a mixture of HPV16 and HPV18 E6 / E7 peptide libraries. Results ( Figure 3 This indicates that, relative to the PBS group and Mn 2+ In the group, both HPV-001-LNP and HPV-001-LNP-Mn vaccines induced a very strong HPV16 / 18-specific cellular immune response in C57BL / 6 mice, with no significant difference between the two (P>0.05).

[0056] Example 6 Antitumor effects of vaccines in mice Six-week-old C57BL / 6 mice were acclimatized for one week, and on day 0 (D0), each mouse was injected subcutaneously with 2 × 10⁻⁶ g of the vaccine. 5 Five mice were injected with TC-1 cells and then immunized with 20 μg mRNA of the HPV-001-LNP and HPV-001-LNP-Mn complexes in the right hind leg on days 7, 14, and 21. The control group received an equal volume of PBS solution (PBS group). Tumor growth was continuously monitored after subcutaneous injection of TC-1 cells. Tumor size was measured every 2-3 days using electronic calipers, and tumor volume was calculated using the formula (width × width × length) / 2. Mouse weight changes and mortality were also recorded. Mice were considered considered dead at birth when they showed signs of pain or the average tumor volume exceeded 2000 mm². 3 At that time, the animals were euthanized.

[0057] Experimental results result( Figure 4The results showed that, compared with the PBS group, both HPV-001-LNP and HPV-001-LNP-Mn vaccines could effectively inhibit tumor growth and exert anti-tumor effects in C57BL / 6 mice, and the difference between the two was not significant (P>0.05).

[0058] The embodiments of the present invention are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

Claims

1. A mutant HPV16 E6, with the amino acid sequence shown in SEQ ID NO:

7.

2. A mutant HPV18 E6, with the amino acid sequence shown in SEQ ID NO:

8.

3. A protein encoding a fusion protein, the nucleotide sequence of which is shown in SEQ ID NO:

4.

4. A linear mRNA sequence, the nucleotide sequence of which is as shown in SEQ ID NO:

1.

5. The method for constructing a linear mRNA sequence according to claim 4, characterized in that, The method involves first linking the human IL-6 signal peptide to the extracellular segment of the human FLT3L protein; then, the five proteins—the extracellular segment of the human FLT3L protein, mutant HPV16 E6 as described in claim 1, mutant HPV16 E7, mutant HPV18 E6 as described in claim 2, and mutant HPV18 E7—are sequentially linked in series through two repeating rigid linkers.

6. The construction method according to claim 5, characterized in that, The mutant HPV16 E7 introduces two mutations, C24G and E26G; the mutant HPV18 E7 introduces two mutations, C27G and E29G.

7. The construction method according to claim 5, characterized in that, The amino acid sequence of the extracellular segment of the human FLT3L protein is shown in SEQ ID NO:

3.

8. A novel HPV therapeutic mRNA vaccine comprising the non-self-replicating linear mRNA sequence of claim 4.

9. The use of the linear mRNA sequence according to claim 4 in the preparation of anti-HPV tumor drugs.

10. Use of the linear mRNA sequence according to claim 4 in the preparation of a medicament for inducing an immune response in a subject in need.

Images