Pythium oligandrum strain yn-26-3-11 with growth promotion, broad-spectrum antibacterial activity and disease resistance function and application thereof

Abstract

This invention discloses a *Pythium oligandrum* strain YN-26-3-11 with growth-promoting, broad-spectrum antibacterial, and disease-resistant functions, and its applications. The preservation number of this *Pythium oligandrum* strain YN-26-3-11 is CGMCC No. 42858. This strain can significantly promote tomato plant growth and increase biomass. Simultaneously, it exhibits significant inhibitory activity against various pathogens, including *Phytophthora infestans*, *Phytophthora capsici*, *Pythium oryzae*, *Fusarium graminearum*, *Rhizoctonia solani*, and *Phytophthora sacchariformis*, and can also control tomato late blight. This strain and its microbial preparations possess dual functions of growth promotion and disease prevention, are environmentally friendly, and have broad application prospects in agriculture.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial technology, specifically relating to a strain of Pythium oligandii YN-26-3-11 with growth-promoting, broad-spectrum antibacterial and disease-resistant functions, and its application in the preparation of microbial agents, promoting crop growth, inhibiting bacteria and controlling crop diseases. Background Technology

[0002] Crops constantly face stress from pathogen infection and nutrient deficiencies during agricultural production, and severe adverse conditions can affect crop yield and quality. With the increasing demand for food, chemical pesticides and fertilizers have played a crucial role in ensuring agricultural production; however, their overuse has led to increasingly prominent problems such as soil degradation, pesticide residues, and pesticide resistance in pests, diseases, and weeds. Therefore, developing efficient biological agents and supporting application technologies has become an urgent need for the sustainable development of high and stable crop yields.

[0003] Microbial pesticides refer to biopesticides that use bacteria, fungi, viruses, protozoa, or genetically modified live microorganisms as active ingredients to control harmful organisms such as diseases, insects, weeds, and rodents. Currently, bacterial pesticides dominate the registered product list, primarily Bacillus; fungal pesticides include multiple strains such as Beauveria bassiana and Trichoderma harzianum; and viral pesticides are represented by Helicobacter pylori nucleopolyhedrovirus. In recent years, novel microbial pesticides have continued to be approved, such as Bacillus amyloliquefaciens, Bacillus belyssus, Cordyceps militaris, and Pythium oligandrum, demonstrating a trend of expanding registration of microbial pesticides.

[0004] *Pythium oligandrum* is a non-pathogenic oomycete with biocontrol activity, exhibiting broad-spectrum inhibitory activity against various plant pathogenic fungi and oomycetes. Its proven effective targets include: *Fusarium oxysporum* f.sp. *cucumerinum*, *Phytophthora capsici*, *Botrytiscinerea*, *Gaeumannomyces graminis*, *Rhizoctonia solani*, *P. infestans*, and *Verticillium dahliae*. Furthermore, it also has indirect control effects against some bacterial diseases, making it suitable for integrated management of soil-borne and airborne diseases in various systems, including vegetables, fruit trees, and grain crops. *Pythium oligandrum* has been developed into a microbial pesticide formulation and has been registered as a pesticide in my country. As a low-toxicity, environmentally friendly biological pesticide, *Pythium oligandrum* formulations meet the requirements of green agricultural development and have application value in controlling fungal and oomycete diseases of various crops. Its registered formulation is a wettable powder, and its application methods are all based on dilution followed by spraying or application. Currently, the functions and applications of its mycelium, fermentation broth, and spore mixture have not been thoroughly investigated.

[0005] The efficacy of microbial pesticides is highly dependent on the biological characteristics of the strains used, and different strains of the same species often exhibit significant differences in disease suppression mechanisms, environmental adaptability, colonization ability, and growth-promoting effects. Therefore, the species diversity of the same biocontrol fungi provides a rich resource of strains for product innovation. Thus, systematically screening, evaluating, and registering new strains with unique characteristics for different crops, disease types, and ecological regions can not only overcome the homogenization bottleneck of existing products but also protect their specific formulations, application methods, or new uses through patents, forming technological barriers and market advantages. Currently reported Pythium oligoandrogenes strains primarily focus on the control of specific diseases, while also significantly promoting the growth of economic crops. Resources of Pythium oligoandrogenes strains that can inhibit or control major diseases caused by different types of pathogens such as oomycetes and fungi (e.g., Phytophthora soybeanis, Phytophthora pathogenica, Rhizoctonia solani) remain relatively scarce.

[0006] Although *Pythium oligandrum* is known to have biocontrol activity, in the existing technology: (1) most reported *Pythium oligandrum* strains target specific diseases, and strains with both significant growth-promoting and broad-spectrum disease-resistant functions are still relatively scarce; (2) all registered *Pythium oligandrum* products are oospore preparations, and their fermentation broth mixed with mycelium and spores and application methods have not been thoroughly explored; (3) no new *Pythium oligandrum* strains with both highly efficient growth-promoting and systemic control functions have been reported for the major disease of tomato late blight, and the methods for using this type of strain for control have not been systematically studied. Therefore, isolating and screening new *Pythium oligandrum* strains with both high efficiency and development of corresponding application technologies is of great significance for the development of green ecological agriculture. Summary of the Invention

[0007] The purpose of this invention is to provide a novel *Pythium oligomastii* strain, YN-26-3-11, which can significantly promote the growth of the economic crop tomato and has a broad-spectrum and highly effective inhibitory or control effect on diseases caused by important plant pathogens.

[0008] Another objective of this invention is to provide the application of this strain and its prepared microbial preparations in agricultural production.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] In a first aspect, this invention seeks protection for a strain of *Pythium oligandrum*, YN-26-3-11, which possesses growth-promoting, broad-spectrum antibacterial, and disease-resistant functions. The strain YN-26-3-11 is classified as *Pythium oligandrum*, with the Latin scientific name *Pythium oligandrum*, and its accession number is CGMCC No. 42858. It was deposited on June 1, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0011] Furthermore, the ITS rDNA, CoxI, and CoxII sequences of the Oligandromeda strain YN-26-3-11 are shown in SEQ ID NO:1-3.

[0012] Secondly, the present invention seeks protection for the use of the above-mentioned Oligandromedae strain YN-26-3-11 in at least one of the following (a1)-(a3):

[0013] (a1) Promoting crop growth or preparing microbial preparations for promoting crop growth;

[0014] (a2) Inhibiting plant pathogens or preparing microbial antimicrobial agents for inhibiting plant pathogens;

[0015] (a3) Controlling crop diseases or preparing microbial agents for controlling crop diseases.

[0016] Furthermore, the crop is tomato; the plant pathogen is at least one of Phytophthora soybeani, Phytophthora pathogenica, Phytophthora capsici, Pyrrosia lingua, Rhizoctonia solani, and Fusarium graminearum.

[0017] Furthermore, the crop disease mentioned is tomato late blight; specifically, it is tomato late blight caused by Phytophthora infestans.

[0018] Thirdly, the present invention claims protection for a microbial preparation, the active ingredient of which comprises at least one of the hyphae, spores and fermentation broth of the above-mentioned *Pythium oligandrum* strain YN-26-3-11.

[0019] Fourthly, the present invention seeks protection for at least one application of the above-mentioned microbial preparation in promoting crop growth, inhibiting plant pathogens, and controlling crop diseases.

[0020] Furthermore, in the above application, the crop is tomato; the plant pathogen is at least one of Phytophthora soybeani, Phytophthora virosa, Phytophthora capsici, Phytophthora oryzae, Rhizoctonia solani, and Fusarium graminearum; the crop disease is tomato late blight; specifically, tomato late blight caused by Phytophthora virosa.

[0021] Fifthly, the present invention claims protection for a method for promoting tomato growth and / or controlling tomato late blight, by applying the above-mentioned *Pythium oligandrum* strain YN-26-3-11 or the above-mentioned microbial preparation to crops or crop growth environments.

[0022] Furthermore, the application method includes root irrigation or spraying.

[0023] Compared with the prior art, the present invention has the following significant advantages:

[0024] 1. Comprehensive Functional Properties: The *Pythium oligandrum* strain YN-26-3-11 provided in this invention integrates growth promotion and biocontrol functions. This application is the first to systematically verify that this strain and its preparation have a significant growth-promoting effect on tomatoes. Simultaneously, under different inoculation conditions, *Pythium oligandrum* showed control efficacy of 60.27% or 32.43% against tomato late blight, both exceeding the control efficacy of the commercial product Dolivitin (corresponding efficacy of 54.79% or 16.22%).

[0025] 2. Broad-spectrum and highly effective biocontrol: This strain exhibits good inhibitory effects against Phytophthora soybeanae, Phytophthora pathogenica, Phytophthora capsici, Pyridobacterium oryzae, Rhizoctonia solani, and Fusarium graminearum, covering oomycete and fungal pathogens. Its biocontrol spectrum has been validated to include multiple serious soil-borne diseases in Chinese crop production, providing a new solution for controlling complex soil-borne diseases. 3. Huge application potential: Based on the fermentation broth or extract preparations corresponding to this strain, it can be flexibly applied to various application methods such as root irrigation or spraying to meet the production needs of different cultivation modes.

[0026] 4. Green, Safe, and Sustainable: The strain of this invention originates from the natural ecological environment of Yunnan Province, a region rich in biodiversity. It is a wild strain isolated locally, distinct from similar strains from foreign sources. This strain and its application methods are highly environmentally friendly, significantly reducing the use of chemical pesticides and fertilizers, aligning with the sustainable development requirements of ecological and organic agriculture, and possessing significant social, economic, and ecological benefits. Attached Figure Description

[0027] Figure 1 The plate inhibition effect of 16 strains morphologically suspected to be *Pythium oligandrum*.

[0028] Figure 2 A bar chart comparing the plate inhibition rates of 16 strains morphologically suspected to be *Pythium oligandrum*.

[0029] Figure 3 This is a phylogenetic tree of strain YN-26-3-11 constructed based on multiple genes.

[0030] Figure 4 The plate inhibition effect of strain YN-26-3-11 on Phytophthora soybeanae, Pyrrosia lingua, Fusarium graminearum, Phytophthora capsici, Rhizoctonia solani, and Phytophthora pathogenica was determined.

[0031] Figure 5 The study investigated the control effect of strain YN-26-3-11 on detached leaves of tomato late blight.

[0032] Figure 6 The study investigated the control effect of strain YN-26-3-11 on live potted plants of tomato late blight.

[0033] Figure 7 The effect of strain YN-26-3-11 on promoting the growth of tomato plants.

[0034] Figure 8 This is a bar chart comparing the plant height of tomatoes treated with strain YN-26-3-11.

[0035] Information on the preservation of biological materials

[0036] The strain of Pythium oligandrum YN-26-3-11 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 1, 2026, with accession number CGMCC No. 42858. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the scope of protection of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0038] The culture medium used in the examples is as follows:

[0039] V8 medium: 100 mL of V8 vegetable juice (commercially available), 1 g of calcium carbonate, stir thoroughly, filter and collect the supernatant, 15 g of agar powder (added to solid medium), add deionized water to a final volume of 1 L, sterilize at 121℃ for 20 min.

[0040] CMA medium: 17 g / L of commercial corn flour agar (added to solid medium), bring the volume to 1 L with deionized water, and sterilize at 121℃ for 20 min.

[0041] PDA medium: 6 g potato extract powder, 20 g glucose, 15 g agar powder (added to solid medium), deionized water to a final volume of 1 L, sterilize at 121℃ for 20 min.

[0042] RSA medium: Soak 60g of rye in 800mL of water overnight, autoclave at 121℃ for 30min, then grind with a mixer, filter through 4 layers of gauze, add 100ml of V8 (add 1g of calcium carbonate to 100mL of V8 before filtration), and bring the volume to 1L. Dispense into 200mL containers, adding 4g of sucrose and 2.7g of agar. Sterilize at 121℃ for 20min.

[0043] Example 1: Isolation and Identification of Strains YN-26-3-11

[0044] 1. Strain Isolation: Soil samples were collected from the rhizosphere soil of healthy potato fields in Qujing, Kunming, Honghe, Guilin, Huizhou, and Chengde, Hebei. The soil suspension was spread onto CMA selective plates containing antibiotics (pimmicin 10 µg / mL, ampicillin 50 µg / mL, rifampin 50 µg / mL, and pentachloronitrobenzene 100 µg / mL) using the dilution-spread method and incubated in the dark at 25°C for 24–48 h. A total of 436 single colonies were selected.

[0045] 2. Initial Screening for Inhibition of Phytophthora Pathogen: The selected pathogen was Phytophthora Pathogen (strain PiLuc, which converts luciferase and can be used for biofluorescence assay), and RSA medium was used for cultivation. The assay method was the plate confrontation method. Specifically, a block of pathogenic mycelium was placed in the center of the corresponding medium, and blocks of candidate strain mycelium were symmetrically placed on the upper and lower parts of the plate, away from the edge of the culture dish. Since no visible confrontation band could be observed in the confrontation culture of Phytophthora Pathogen, the PiLuc biofluorescence method was used to determine the inhibition rate. The preservation number of the luciferase-labeled Phytophthora Pathogen PiLuc strain is: CGMCC No. 40651 (CN202410876927.5), and its biofluorescence intensity can indicate the growth and survival status of the strain. Seven days after inoculation, the sample plate was sprayed with a final concentration of 1 mM Luciferin. The images were taken using Tanon 5200Multi and Tanon bio-imaging software, and the colors were homogenized. Fluorescence detection and imaging were performed, with an exposure time of 1 s. Grayscale values ​​were statistically analyzed using the open-source software ImageJ, and biofluorescence values ​​were quantitatively compared. The inhibition rate of PiLuc was calculated as (biofluorescence area of ​​the control group - biofluorescence area of ​​the experimental group) / biofluorescence area of ​​the control group. The inhibition rates of the 436 isolates against Phytophthora infestans are shown in Table 1. Among them, 119 isolates had inhibition rates >15%, the remaining 202 isolates had inhibition rates <15%, and 115 isolates had virtually no antibacterial effect.

[0046] Table 1. Statistical analysis of the proportion of 436 isolates inhibiting pathogenic Phytophthora in experiments.

[0047]

[0048] By observing the oospores of 119 strains under a microscope, the edge hyphae of colonies morphologically similar to *Pythium oligandrum* were selected and purified multiple times to obtain 16 pure cultures. The results of the secondary screening of the antibacterial effects of these 16 strains are as follows: Figure 1 and Figure 2The inhibition rates were all greater than 19%. Genomic DNA was extracted from the above 16 strains using a plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., catalog number: DP305). Using this as a template, the ITS rDNA region (SEQ ID NO: 1) was amplified using primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) / ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). After sequencing the PCR products, BLAST analysis was performed in the GenBank database. The results showed that only YN-26-3-2 and YN-26-3-11 were potential oligomaleogenic Pythium. YN-26-3-11 showed an inhibition rate of 88.88% against Phytophthora infectivity, while YN-26-3-2 showed an inhibition rate of 51.21%. Therefore, YN-26-3-11 was preferred for further identification and functional analysis.

[0049] 3. Molecular biological identification: Genomic DNA was extracted from the strain using a plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., catalog number: DP305). Using this as a template, the ITS rDNA region (SEQ ID NO:1) was amplified using primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) / ITS4 (5′-TCCTCCGCTTATTGATATGC-3′), CoxI (SEQ ID NO:2) was amplified using primers OomCoxI-Levup (5′-TCAWCWMGATGGCTTTTTTCAAC-3′) / OomCoxI-Levlo (5′-CYTCHGGRTGWCCRAAAAACCAAA-3′), and CoxII (SEQ ID NO:3) was amplified using primers FM66 (5′-TAGGATTTCAAGATCCTGC-3′) / F58 (5′-CCACAAATTTCACTACATTGA-3′). After sequencing the PCR products, BLAST analysis was performed on the GenBank database, and the results are shown in Table 2. Analysis revealed that this strain showed the highest homology with previously reported *Pythium oligoandrogenes* in the ITS rDNA region, CoxI, and CoxII genes, with homology exceeding 98.00%. Furthermore, the three amplified sequences were joined together first-to-last. Simultaneously, the ITS rDNA region, CoxI, and CoxII sequences from strains *Pythium oligoandrogenes* Po37, *Pythium oligoandrogenes* ATCC_38472, seven other *Pythium* species, two *Phytophthora* species, and two *Phytophthora* species were downloaded from the NCBI database and joined together first-to-last in the same order. The merged sequences were aligned using the MUSCLE Wrapper in TBtools-II, and the aligned sequences were then cut using the TrimAL Wrapper. A phylogenetic tree was constructed using the IQ-Tree Wrapper (Boostrap Number=1000). Figure 3 The phylogenetic tree shows that YN-26-3-11 clusters with Pythium oligoandrogenes Po37 and ATCC_38472 into the same clade, indicating that it belongs to Pythium oligoandrogenes. Combined with its morphological characteristics (unseptate young hyphae, spherical or nearly spherical sporangia, terminal or intercalary oogonia with conical spines on the outer wall), it is confirmed to be Pythium oligoandrogenes.

[0050] Table 2. BLAST results of the amplified sequence of Pythium oligandrum YN-26-3-11

[0051]

[0052] Example 2: Plate inhibition activity of strain YN-26-3-11 against Phytophthora soybeanae, Phytophthora capsici, Phytophthora pathogenica, Pyrrosia lingua, Fusarium graminearum, and Rhizoctonia solani.

[0053] 1. Cultivating a confrontational approach:

[0054] The antibacterial activity of *Pythium oligandrum* YN-26-3-11 was determined using the plate confrontation method. The selected oomycetes were *Phytophthora sacchariformis*, *Phytophthora capsici*, and *Phytophthora virulence* (a strain of *Phytophthora virulence* was converted to luciferase, which could be used for biofluorescence assay). The selected pathogenic fungi were *Pyrrosia lingua*, *Fusarium graminearum*, and *Rhizoctonia solani*. *Phytophthora sacchariformis* and *Phytophthora capsici* were cultured on V8 medium, *Phytophthora virulence* on RSA medium, and *Pyrrosia lingua*, *Fusarium graminearum*, and *Rhizoctonia solani* on PDA medium. The assay method was the plate confrontation method. Specifically, a block of pathogenic hyphae was placed in the center of the corresponding medium, and blocks of *YN-26-3-11* hyphae were symmetrically placed at both ends of the plate, away from the edge of the petri dish. After 4-7 days of growth, the inhibition rate of the pathogenic fungi was measured. The inhibition rate of the wild-type pathogenic fungi was calculated as (colon diameter of the control group - longitudinal colony diameter of the experimental group) / colony diameter of the control group. Since no visible confrontation band could be observed in the confrontation culture of *Phytophthora virulence*, the PiLuc biofluorescence assay was used to determine the inhibition rate. The luciferase-labeled pathogenic *Phytophthora indicum* strain PiLuc has the preservation number CGMCC No. 40651 (CN202410876927.5). Its biofluorescence intensity indicates the strain's growth and survival status. Seven days after inoculation, the sample plates were sprayed with a final concentration of 1 mM Luciferin. Images were taken using Tanon 5200Multi and Tanon bio-imaging software, and color homogenization was performed. Fluorescence detection and imaging were conducted, with an exposure time of 1 second. Grayscale values ​​were statistically analyzed using the open-source software ImageJ, and biofluorescence values ​​were quantitatively compared. The inhibition rate of PiLuc was calculated as (biofluorescent area of ​​the control group - biofluorescent area of ​​the experimental group) / biofluorescent area of ​​the control group.

[0055] 2. Results Observation:

[0056] The measurement results are as follows Figure 4 As shown in Table 3, YN-26-3-11 has good antibacterial effects against Phytophthora infestans, Phytophthora capsici, Pyrrosia lingua, Fusarium graminearum, Rhizoctonia solani, and Phytophthora sacchariformis.

[0057] Table 3. Antibacterial effect of Pythium oligandrum YN-26-3-11 against pathogens

[0058]

[0059] Note: Data are expressed as mean ± standard deviation. Different lowercase letters after the data indicate significant differences (P < 0.05).

[0060] Example 3: Efficacy of strain YN-26-3-11 against late blight in detached tomato leaves

[0061] 1. Cultivation and Fermentation

[0062] YN-26-3-11 mycelial pellets were inoculated onto V8 solid medium and activated statically for 3 days at 25°C in the dark. Subsequently, the activated pellets were inoculated into V8 liquid medium and cultured at 25°C with shaking for 3 days. The resulting culture was centrifuged at 8000 r / min for 10 min, and the supernatant was collected and filtered through four layers of sterile filter paper. The filtrate was collected as the fermentation broth. The control group was treated simultaneously with an equal volume of sterile V8 liquid medium instead of the mycelial pellet.

[0063] 2. Tomato Cultivation

[0064] Mix the substrate soil with sterile water, adjusting the moisture level to a state where the soil is allowed to dry slightly between waterings. Fill flowerpots (10 cm in diameter and 10 cm in height) with the moistened substrate soil, filling to a depth of approximately 6 cm. Transplant one tomato seedling (variety: large pink tomato bred by the Beijing Academy of Agricultural and Forestry Sciences) into each pot and place them in a greenhouse for 7 days, with daytime temperatures of 20–25°C and nighttime temperatures of 18–20°C. Use healthy tomato leaves from the cultured plants for testing.

[0065] 3. Inoculation with Pythium oligandrum

[0066] Line a 30×30 cm plastic dish with paper towels and moisten them with approximately 20 mL of sterile water. Select healthy tomato leaves with uniform growth and place them in a tray. For Treatment 1, use a sterile pipette tip to drop 50 μL of YN-26-3-11 fermentation broth onto both sides of the center of the underside of the leaf. For Treatment 2, use commercially available Dorivitan, diluted according to the instructions, and inoculate at the same locations. For Treatment 3, inoculate an equal volume of V8 medium and cover the dish to maintain humidity after inoculation. The remaining treatment group was left untreated. Each treatment group had 9 leaves inoculated, with each leaf constituting one replicate. After inoculation, incubate in the dark at 25°C and 90% relative humidity for 48 h.

[0067] 4. Pathogen inoculation

[0068] 48 h after inoculating with the fermentation broth of Pythium oligandrum YN-26-3-11, approximately 50 μL of Phytophthora JH19 zoospore solution (containing 5 zoospores per μL) was added to the same location on the underside of each tomato leaf. After inoculation, the dish was covered and kept moist, and cultured at 18℃, 90% relative humidity, and in the dark for 7 days.

[0069] 5. Observation and statistics of disease incidence

[0070] Seven days later, observe the disease incidence on tomato leaves and investigate the control efficacy against the grading standards. The disease grading for tomato late blight refers to the industry standard NY / T 1858.1-2010: Grade 0: Asymptomatic; Grade 1: Small lesions on leaves, with the total lesion area less than or equal to 5% of the leaf area; Grade 3: Larger lesions on leaves, with the total lesion area greater than 5% and less than or equal to 30% of the leaf area; Grade 5: Some lesions on leaves are connected, with the total lesion area greater than 30% and less than or equal to 50% of the leaf area, and a small number of lesions on the stem; Grade 7: Interconnected lesions on leaves, with the total lesion area greater than 50% and less than or equal to 70% of the leaf area, or extended lesions on the stem; Grade 9: Lesions on leaves are almost completely connected, with the total lesion area greater than 70% and less than or equal to 100% of the leaf area, or severe stem damage or even plant death. Disease index = ∑(Number of infected plants at each level × Disease grade) / (Total number of plants surveyed × Highest representative value) × 100. Prevention and control effect (%) = [(disease index of disease control - disease index of each treatment) / disease index of disease control] × 100.

[0071] The results are as follows Figure 5 As shown in Table 4, the lesion area in the YN-26-3-11 treatment group was significantly smaller than that in the control group, with a relative efficacy of 60.27%, and the efficacy was higher than that of Dolivitin (54.79%).

[0072] Table 4. Control efficacy of Pythium oligandrum YN-26-3-11 against detached leaves of tomato late blight.

[0073]

[0074] Example 4: Efficacy of strain YN-26-3-11 against late blight in live potted tomato plants

[0075] 1. Cultivation and fermentation are the same as in Example 3.

[0076] 2. Tomato cultivation is the same as in Example 3.

[0077] 3. Inoculation with Pythium oligandrum

[0078] Select healthy tomato plants with uniform growth (variety: large pink tomato bred by Beijing Academy of Agricultural and Forestry Sciences). Treatment 1: Inoculate both sides of the tomato leaves with YN-26-3-11 fermentation broth using a spray bottle, approximately 30 mL per plant. Treatment 2: Inoculate both sides of the tomato leaves with diluted Dolivitan solution using a spray bottle, ensuring the entire plant surface is moist. Treatment 3: Inoculate with an equal volume of V8 medium. After inoculation, place in a plastic greenhouse to maintain humidity. Each treatment group has 5 tomato seedlings, with each seedling constituting one replicate. Incubate at 25℃ and 70% relative humidity for 48 h after inoculation.

[0079] 4. Pathogen inoculation

[0080] Forty-eight hours after inoculation with *Pythium oligandrum* YN-26-3-11 fermentation broth, each tomato seedling was inoculated with an equal volume of *Phytophthora infestans* JH19 zoospore suspension (5 zoospores per μL). The seedlings were then kept in a plastic greenhouse to maintain humidity. The seedlings were cultured at 18℃ and 70% relative humidity for 7 days.

[0081] 5. Observation and statistics of disease incidence

[0082] Observe the disease status of tomato plants 7 days later, and investigate the control efficacy in the same manner as in Example 3. Figure 6 As shown in Table 5, the incidence of disease in the YN-26-3-11 treatment group was significantly lower than that in the control group, with a relative efficacy of 32.43%, and the efficacy was higher than that of Dolivita (16.22%).

[0083] Table 5. Control efficacy of Pythium oligandrum YN-26-3-11 against late blight in live potted plants of tomato.

[0084]

[0085] Example 5: Growth-promoting effect of strain YN-26-3-11 on tomatoes

[0086] 1. YN-26-3-11 mycelial cakes were inoculated onto V8 solid medium and activated statically for 3 days at 25℃ in the dark. Subsequently, the activated mycelial cakes were inoculated onto V8 liquid medium and cultured at 25℃ with shaking for 3 days. The resulting culture broth was centrifuged at 8000 r / min for 10 min, and all the resulting broth was homogenized at low speed using a homogenizer to obtain the fermentation broth, which contained mycelia, spores, and components exuded into the culture medium. A control group was treated simultaneously using an equal volume of sterile V8 liquid medium instead of the mycelial culture.

[0087] 2. Tomato cultivation is the same as in Example 3.

[0088] 3. Inoculation with Pythium oligandrum

[0089] Select healthy tomato seedlings with uniform growth. Inoculate the roots of the tomato seedlings with YN-26-3-11 fermentation solution, approximately 50 mL per seedling. The control group was inoculated with an equal volume of V8 medium. After inoculation, the seedlings were placed in a greenhouse at 20-25℃ during the day and 18-20℃ at night. The seedlings were inoculated with an equal volume of fermentation solution every 7 days, for a total of three root irrigations.

[0090] 4. Results Statistics

[0091] Tomato plant height was measured at the first root irrigation and 7 days after each root irrigation to calculate the final growth rate. Final growth rate (%) = [(Plant height 7 days after the third root irrigation - Plant height at the first root irrigation) / Plant height at the first root irrigation] × 100. Results are as follows... Figure 7 , Figure 8 As shown in Table 6, from the third day after the second root irrigation, the plant height index of the YN-26-3-11 treatment group was better than that of the control group, indicating that the fermentation broth of strain YN-26-3-11 can promote the growth of tomato plants. The final growth rate increased by 14.42%.

[0092] Table 6. Effect of Pythium oligandrum YN-26-3-11 on promoting tomato plant height

[0093]

[0094] Note: Data are mean ± standard error. Different lowercase letters indicate that the difference is significant at the 0.05 level.

[0095] sequence list

[0096] SEQ ID NO:1

[0097] TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTTACCTGATATCAGGTCCAAAGTGATAAAGAGAGTAAACTCTCAGTCCCAAATTGGTGTTGTCTCCTTTACCTACCGAAGCAGGCGTCTGAAAACGCTAAACCACACAACCAAGCAACCATATAGCCTAAATCAACCTCACACACGACAGGTACACCTCAAGGAAAAGACAGAAAACCACACTCGCTTAGCTTAACGTCAGGCAAAGCCGAACATACCGCCAATTGAGGTTGCTTCCATATGTCCTAACCGAAGTCGCCCACCAGCGCAAAGCAATCTAAACCGATCACAAAGAGCATAGCATCGCAATTCGCAGACACAAGAAAGAATCAACGTACATTTAAAGGGACTCGACAGCATCTTTAAAAAGACAGCGCGAGACACCTCACATTCTGCCATCTCTAATTTTGACTACACAAAAAAAGAAAGGCAAGTTTGATGTACGGACACTGATACAGGCATACTTCCAGGCATAACCCGAAAGTGCAATATGCGTTCAAAATTTCGATGACTCACTGAATTCTGCAATTCGCATTACGTATCGCAGTTCGCAGCGTTCTTCATCGATGTGCGAGCCTAGACATCCACTGCTGAAAGTTGTTAATTGTTAAAACCAAAAACTTTCGTATTCACAGTATAGTTCAGTATTAAGTAATAGGTGTTTAAAATAACATCAGCAAATCCGCATCCAAAATAGACGCAGACTCACCTTCGTTCAGCCTCAAGTCTTGCGACGAAGCACAGAACATAGTTATAACGGTTCACGTGGAAAGTTTTTAGGTGTGGTAATGATCCTTCCGCAGGTTCACCTACGGA

[0098] SEQ ID NO:2

[0099] TCTTTCTGGGTTTGCCGAAAAAACCAAAATAAATGTTGATATAAAACAGGGTCACCTCCACCTGAAGGATCATAAAAAAAGAAGTGTTTAAATTTCTATCTGTTAATAACATTGTAATAGCTCCAGCTAAAACAGGTAAAGTTAATAATAATAAGAAAGCTGTGTAATGAAAATAGCCCAAACGAATAAAGGTAATCTATGGAAACTTAAACCAGGAGCTCTCATATTATAAATAGTTGAAAGAAAATTAATAGCACCTAATAAAGATGAAATACCCGATAAATGTAAACTAAATATAGCTAAATCTACAGAAGGACCAGAGTGTGCTTGAACACTTGATAAAGGAGGATACACAGTCCAACCAGTACCAGC ACCTGATTCAACTATAGCTGATGATACTAATAATAATAACGAAGGTGGTAATAACCAAACTAATATTATTCATTCTAGGAAAAGCCATATCTGGTGCACCAATCATTAAAGGAACAAACCAGTTACCGAAACCACCTATTAATACAGGCATAACCATGAAGAAAATCATAATAAAAGCATG TGCTGTAACAACAACATTATATAAATGATGATTTCCCATAAAAATTTGATTACCAGGTTGTGCTAATTCCATTCTAATTAAAACTGATAAAGTTGTACCAACAACACCTGAAAAAGCACCGAAAATTAAATATAAAGTACCAATCCGTTTGTGGTTTGTTGAAAAAAGCATCCCTAGAATGAAA

[0100] SEQ ID NO:3

[0101] 。

Claims

1. A strain of *Pythium oligandrum*, YN-26-3-11, possessing growth-promoting, broad-spectrum antibacterial, and disease-resistant activities, characterized in that... The preservation number of the Oligandromyces strain YN-26-3-11 is CGMCC No. 42858.

2. The use of the Oligandromyces strain YN-26-3-11 according to claim 1 in at least one of the following (a1)-(a3): (a1) Promoting tomato growth or preparing microbial preparations for promoting tomato growth; (a2) Inhibiting plant pathogens or preparing microbial antimicrobial agents for inhibiting plant pathogens; wherein the plant pathogens are at least one of Phytophthora soybeani, Phytophthora pathogenica, Phytophthora capsici, Pyrrosia lingua, Rhizoctonia solani, and Fusarium graminearum; (a3) Controlling late blight of tomatoes or preparing microbial agents for controlling late blight of tomatoes.

3. A microbial preparation, characterized in that, The active ingredient of this microbial preparation comprises at least one of the hyphae, spores and fermentation broth of the Oligocytophyte strain YN-26-3-11 as described in claim 1.

4. The application of the microbial preparation according to claim 3 in at least one of promoting crop growth, inhibiting plant pathogens, and controlling crop diseases, characterized in that, The crop is tomato; the plant pathogen is at least one of Phytophthora soybeani, Phytophthora virosa, Phytophthora capsici, Pyridobacterium oryzae, Rhizoctonia solani, and Fusarium graminearum; the crop disease is tomato late blight.

5. A method for promoting tomato growth and / or controlling tomato late blight, characterized in that, The Oligopyrophyte strain YN-26-3-11 of claim 1 or the microbial preparation of claim 3 is applied to crops or crop growth environment.

6. The method according to claim 5, characterized in that, The application methods include root irrigation or spraying.

Images