Pseudomonas elliipcia BGB10 and application thereof in preventing and treating li-chi mildew

Abstract

This invention discloses *Pseudomonas eucalyptica* BGB10 and its application in controlling downy mildew of litchi, belonging to the field of biological control technology for plant diseases. This invention isolates a strain of *Pseudomonas eucalyptica* (BGB10) from the pericarp of infected young litchi fruits. Pseudomonas eucalypticola BGB10, strain BGB10, was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on June 3, 2026, with accession number GDMCC NO. 68399. The fermentation broth and suspension of BGB10 showed inhibition rates of 81.20% and 78.30% against the mycelial growth of *Phytophthora lichei*, respectively. The control efficacy against detached fruit at 48 h and 60 h was 77.89% and 73.95%, respectively, and the inhibition rates against sporangium germination were 97.51% and 97.76%, respectively. The control efficacy against detached fruit at 48 h was 77.89% and 60 h was 73.95%. This strain has simple culture conditions and significant antibacterial activity, providing a new strain resource and technical solution for the green control of *Phytophthora lichei*, the development of biological pesticides, and field application. It also has the potential to reduce the use of chemical fungicides.

Description

Technical Field

[0001] This invention belongs to the field of biological control technology for plant diseases, specifically involving a strain of Eucalyptus Pseudomonas bacillus BGB10 and its application in controlling lychee downy mildew. Background Technology

[0002] litchi( Litchi chinensis Sonn. As a subtropical evergreen fruit tree native to China, litchi is widely cultivated in southern my country and is an important economic crop and a strategically valuable germplasm resource. However, litchi downy mildew, caused by Phytophthora licheniformis, has become one of the most serious diseases affecting litchi production and storage in my country. This disease can infect young leaves, branches, flower spikes, and fruits, causing extensive rotting of flower spikes and fruits, resulting in reduced litchi yields and posing a serious threat to the healthy development of the litchi industry.

[0003] Currently, the control of litchi diseases relies on chemical and agricultural methods. Chemical control, with its long-term use of fungicides, is not only costly but also leads to drug resistance in pathogens, resulting in pesticide residues, environmental pollution, and health risks. The misuse and abuse of pesticides are prominent, and pesticide residues are a serious problem. Therefore, developing green, efficient, and safe biological control strategies has become a research hotspot in the field of litchi downy mildew control.

[0004] Pseudomonas ( Pseudomonas Pseudomonas is a Gram-negative bacterium widely distributed in nature, known for its strong environmental adaptability and metabolic diversity, and has outstanding potential in the biocontrol of plant diseases. Currently, several Pseudomonas species have been reported for use in plant disease control. Chinese patent application (CN118638698B) discloses a rhizophilic Pseudomonas strain and its application in the control of bacterial canker in kiwifruit. Chinese patent application (publication number CN 117568207 A) discloses that the Pseudomonas aeruginosa CWD-D strain has a highly effective inhibitory effect on Phytophthora downy mildew of litchi. These studies indicate that Pseudomonas is an important strain resource for screening biocontrol strains for litchi downy mildew.

[0005] Eucalyptus Pseudomonas ( Pseudomonas eucalypticola This is a new species of Pseudomonas that was only formally described and reported in 2021. It was first identified from *Alternaria dunnii* (…). Eucalyptus dunnii Isolated from leaves, *Pseudomonas eucalyptus* exhibits antagonistic activity against various plant pathogenic fungi. Existing research indicates that *Pseudomonas eucalyptus* NP-1 has biocontrol effects against eucalyptus gray mold, and *Pseudomonas eucalyptus* DF15 has significant control effects against *Aspergillus flavus* contamination of walnuts. The closely related strain 1021Bp can control *Fusarium wilt* in boxwood. However, research on this new species of *Pseudomonas eucalyptus* in the field of litchi disease control remains incomplete.

[0006] In summary, there are no existing reports on the use of Pseudomonas eucalyptus to control lychee downy mildew. There is an urgent need to develop a novel biological control agent with Pseudomonas eucalyptus as the active ingredient to fill the gap in the field of lychee downy mildew control. Summary of the Invention

[0007] Current methods for controlling litchi downy mildew primarily rely on chemical fungicides, which easily lead to pathogen resistance, pesticide residues, and environmental pollution. Furthermore, existing biocontrol strains are limited, lacking *Pseudomonas eucalyptolus* strains with both high antibacterial activity and stable control efficacy. This invention aims to provide a *Pseudomonas eucalyptolus* strain BGB10 and its application in controlling litchi downy mildew. This strain can significantly inhibit the mycelial growth and sporangium germination of *Pseudomonas eucalyptolus*, and can be used to prepare microbial agents, providing new strain resources and technical means for the green control of litchi downy mildew.

[0008] To achieve the above objectives, the present invention employs the following technical solution: In a first aspect, the present invention provides a strain of Eucalyptus Pseudomonas ( Pseudomonas eucalypticola The *Pseudomonas eucalyptolus* BGB10 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) with accession number GDMCCNO:68399 and deposit date of June 3, 2026.

[0009] This invention isolated a biocontrol bacterium from the pericarp of diseased young litchi fruits. Through morphological observation, Gram staining, 16S rRNA and gyrB gene sequence analysis, and phylogenetic tree construction, it was identified as *Pseudomonas eucalyptica* (C. eucalyptica). Pseudomonas eucalypticola ), named BGB10.

[0010] The colonies formed by this strain on LB agar were round, smooth, moist, with regular edges, and ranged in color from pale yellow to milky white, indicating it was a Gram-negative bacterium. BLAST alignment of the 16S rRNA and gyrB gene sequences showed that strain BGB10 shared 100% homology with the *Pseudomonas eucalyptolus* type strain (accession number CP056030.1) in GenBank. Phylogenetic analysis showed that BGB10 and the *Pseudomonas eucalyptolus* type strain belonged to the same evolutionary branch.

[0011] This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on June 3, 2026, with accession number GDMCC NO. 68399.

[0012] Secondly, the present invention provides a biocontrol agent containing the aforementioned Pseudomonas eucalyptolus BGB10.

[0013] The biocontrol agent is any one or more of the fermentation broth, bacterial suspension, or sterile fermentation filtrate of *Pseudomonas eucalyptolus* BGB10.

[0014] Plate confrontation experiments showed that the fermentation broth inhibited the growth of Phytophthora litchii mycelium by 81.20%, and the mycelial suspension by 78.30%, both of which had significant direct antibacterial effects. Sporangium germination inhibition experiments showed that the inhibition rates of the fermentation broth and mycelial suspension were as high as 97.51% and 97.76%, respectively, and the inhibition rate of the supernatant was also 85.57%. This proves that BGB10 not only exerts its antibacterial effect through the mycelium itself, but its extracellular metabolites also have strong antibacterial activity, especially its inhibitory effect on sporangium germination.

[0015] The biocontrol agent also includes agriculturally acceptable carriers or adjuvants.

[0016] Thirdly, the present invention provides a method for preparing a biocontrol agent of Pseudomonas eucalyptolus BGB10, comprising the following steps: inoculating the Pseudomonas eucalyptolus BGB10 into a liquid culture medium for fermentation culture, and collecting the fermentation broth.

[0017] The fermentation culture was carried out at a temperature of 25 ℃ to 30 ℃, with an oscillation speed of 150 r / min to 220 r / min, and a culture time of 2 d to 5 d.

[0018] Fourthly, the present invention provides the application of the aforementioned Eucalyptus Pseudomonas BGB10 or the aforementioned biocontrol agent in the preparation of drugs or fungal agents for the prevention and control of lychee downy mildew.

[0019] The prevention and control of lychee frost blight includes any one or more of the following: inhibiting the mycelial growth of *Phytophthora lycheeis*, inhibiting the germination of *Phytophthora lycheeis* sporangia, reducing the incidence of frost blight in detached lychee fruits, or reducing the incidence of frost blight in detached lychee leaves.

[0020] Inhibition of mycelial growth can exert a therapeutic effect after the pathogen has invaded the host tissue; in vitro fruit and leaf efficacy experiments have demonstrated the actual protective effect of BGB10 on different target tissues, providing a basis for the formulation of integrated field control strategies.

[0021] Fifthly, the present invention provides a method for preventing and controlling lychee downy mildew by applying the biocontrol agent to the surface of lychee plants or lychee fruits.

[0022] The biocontrol agent is applied by spraying.

[0023] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a strain of Eucalyptus Pseudomonas ( Pseudomonas eucalypticolaBGB10 was the first strain of *Pseudomonas eucalyptolus* isolated from the pericarp of infected young litchi. Pseudomonas eucalypticola Strain BGB10 was accurately identified as *Pseudomonas eucalyptolus* through morphological observation, Gram staining, 16S rDNA and gyrB gene sequence analysis, and phylogenetic tree construction. Furthermore, the 16S rRNA and gyrB gene sequences showed 100% homology with the *Pseudomonas eucalyptolus* type strain (CP056030.1). This strain provides a new strain resource for the biological control of litchi downy mildew, filling a gap in the *Pseudomonas eucalyptolus* strain for litchi disease control and providing a novel native biological control strain for the green control of litchi downy mildew.

[0024] This invention prepares *Pseudomonas eucalyptolus* BGB10 as a biocontrol agent. This agent uses BGB10 as the sole active ingredient, utilizing the strain's own metabolic activities and antibacterial substances to exert its effects. It eliminates the need for added chemical fungicides, fundamentally avoiding problems such as resistance development in pathogens due to long-term use of chemical pesticides, excessive pesticide residues in fruits, and environmental pollution. BGB10 is derived from the peel of infected young litchi fruits and has a natural mutually beneficial symbiotic relationship with litchi. After application, it can maintain the stability of the microecological environment on the surface of the peel, demonstrating the technical advantages of safe, efficient, low-toxicity, and pollution-free biological control. This invention solves the technical problem of the lack of existing biocontrol agents for litchi downy mildew with *Pseudomonas eucalyptolus* as the active ingredient.

[0025] The method for preparing fermentation broth of Pseudomonas eucalyptus BGB10 provided by this invention only requires inoculating BGB10 into a liquid culture medium for fermentation to obtain the fermentation broth, without the need for complex induction expression or special culture conditions. This preparation method is simple in steps, requires low equipment, and is suitable for large-scale production, providing a technological foundation for the industrial development of BGB10 biocontrol agents and demonstrating good economic and technical feasibility.

[0026] The application provided by this invention is the first to apply Pseudomonas eucalyptus BGB10 to the prevention and control of lychee downy mildew, solving the technical problem of the lack of application of this new species of Pseudomonas eucalyptus in the field of lychee disease control in the prior art.

[0027] In vitro activity experiments showed that the fermentation broth of *Pseudomonas eucalyptus* BGB10 inhibited the mycelial growth of *Phytophthora indicum* by 81.20%. In the sporangium germination inhibition experiment, the inhibition rates of BGB10 fermentation broth and bacterial suspension were as high as 97.51% and 97.76%, respectively, effectively blocking the source of infection of the pathogen. In the in vitro fruit control experiment, the biocontrol effect of BGB10 bacterial suspension on in vitro litchi fruit downy mildew reached 77.89% and 73.95% at 48 h and 60 h, respectively, and the control effect on in vitro leaves reached 53.43% at 72 h. These results systematically demonstrated the control effect of BGB10 on litchi downy mildew from three dimensions: mycelial growth, sporangium germination, and in vitro tissue control. Furthermore, the sporangium germination inhibition effect is at a leading level among existing *Pseudomonas* biocontrol agents.

[0028] This invention relates to a method for controlling litchi downy mildew by applying the biocontrol agent *Pseudomonas eucalyptus* BGB10 to the surface of litchi plants or fruits. This method solves the methodological problem of effectively applying the BGB10 strain to control litchi downy mildew in actual production. The method utilizes the natural mutualistic symbiotic relationship between the BGB10 strain and litchi. Through external application, the biocontrol bacteria colonize the surfaces of litchi leaves, inflorescences, and fruits, occupying favorable ecological sites and competing with pathogens for living space and nutrients. Simultaneously, it directly inhibits or kills the pathogens by secreting antibacterial active substances. This method covers both litchi plants and fruits, and can be used for field control during the growing season as well as for post-harvest fruit storage and preservation, demonstrating broad applicability. Attached Figure Description

[0029] Figure 1 A single colony morphology diagram of Pseudomonas eucalyptolus BGB10 on LB medium provided in an embodiment of the present invention; Figure 2 This is a Gram staining result of Pseudomonas eucalyptolus BGB10 provided in an embodiment of the present invention; Figure 3 This is a phylogenetic tree constructed based on the 16S rDNA gene sequence provided in an embodiment of the present invention; Figure 4 This is a phylogenetic tree constructed based on the gyrB gene sequence provided in an embodiment of the present invention; Figure 5 The Eucalyptus Pseudomonas provided in the embodiments of the present invention; Figure 6 The figure shows the plate confrontation experiment results of mycelial growth of Pseudomonas eucalypticola BGB10 against Phytophthora litchii provided in the embodiments of the present invention, wherein CK (blank control group), fermentation broth treatment group, bacterial suspension treatment group and supernatant treatment group. Figure 7The effect of Pseudomonas eucalyptolus BGB10 biocontrol agent on the hyphal morphology of Phytophthora lichei under an optical microscope provided in this embodiment of the invention, wherein A is a photomicrograph and B is the germination rate statistics; Figure 8 The effect of Pseudomonas eucalyptolus BGB10 biocontrol agent on the mycelial morphology of Phytophthora lichee under an electron microscope provided in this embodiment of the invention, wherein CK (blank control group) and BGB10 (fermentation broth treatment group). Figure 9 The diagram shows the inhibitory effect of Eucalyptus Pseudomonas BGB10 on sporangium germination of Phytophthora litchii provided in this embodiment of the invention. In this diagram, A is a schematic diagram of sporangium germination, and B is the effect of BGB10 biocontrol agent on sporangium germination of Phytophthora litchii. Figure 10 The diagram shows the biocontrol effect of Pseudomonas eucalyptolus BGB10 on downy mildew of detached litchi fruit at 48h and 60h, as provided in this embodiment of the invention. Figure 11 The diagram shows the biocontrol effect of Eucalyptus Pseudomonas BGB10 on downy mildew of detached litchi leaves after 72 hours, provided in this embodiment of the invention. In this diagram, A is the biocontrol effect of BGB10 biocontrol agent on litchi leaves, and B is the biocontrol effect of BGB10 biocontrol agent on litchi leaves. Figure 12 The diagram shows a comparative experiment between Pseudomonas eucalyptolus BGB10 provided by this invention and the existing biocontrol bacterium Pseudomonas aeruginosa. In the diagram, CK is the blank control group, A is the Pseudomonas eucalyptolus BGB10 treatment group, and B is the Pseudomonas aeruginosa treatment group. Detailed Implementation

[0030] To enable those skilled in the art to better understand the present invention, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are merely some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0031] In the description of this invention, "Pseudomonas eucalyptolus BGB10" refers to the strain of Pseudomonas eucalyptolus BGB10 isolated from the pericarp of infected young litchi fruits. "Fermentation broth" refers to the entire culture obtained after fermentation of the BGB10 strain in a liquid culture medium. "Bacterial suspension" refers to the bacterial suspension obtained by resuspending the collected bacterial cells in sterile water after centrifuging the fermentation broth. "Sterile fermentation filtrate" refers to the sterile filtrate obtained by filtering the supernatant collected after centrifuging the fermentation broth through a filter membrane to remove the bacterial cells (denoted as BGB10 supernatant). "Phytophthora litchii" refers to Peronophythora litchii (Chenex Ko et al.), the pathogen causing litchi downy mildew. "Plate confrontation" refers to co-culturing the biocontrol bacteria and the pathogen on the same plate culture medium, and evaluating the antibacterial effect of the biocontrol bacteria by measuring the change in the growth area of ​​the pathogen. "Inhibition rate" refers to the percentage reduction in the pathogen growth area of ​​the treatment group compared to the pathogen growth area of ​​the control group. The calculation formula is: Inhibition rate (%) = (Pathogen area of ​​control group - Pathogen area of ​​treatment group) / Pathogen area of ​​control group × 100%. "Sporangium germination inhibition rate" refers to the percentage reduction in the sporangium germination rate of the treatment group compared to the sporangium germination rate of the control group. "Disease index" refers to a comprehensive index reflecting the severity of disease outbreaks in a population, calculated according to the disease severity grading standard. "Biocontrol effect" refers to the percentage reduction in the disease index of the treatment group compared to the disease index of the control group. The calculation formula is: Biocontrol effect (%) = (Disease index of control group - Disease index of treatment group) / Disease index of control group × 100%.

[0032] Eucalyptus Pseudomonas of the present invention Pseudomonas eucalypticola BGB10 was deposited on June 3, 2026, at the Guangdong Microbial Culture Collection Center (GDMCC), located at: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Postcode: 510070, Tel: 020-87137633; Accession number: GDMCC NO: 68399. The proposed taxonomic name for this strain is: Pseudomonas eucalypticola The biological material is preserved in a viable state and is guaranteed to be available to the public under specified conditions for thirty years from the date of preservation.

[0033] Example 1: Isolation, purification and identification of Pseudomonas eucalyptolus BGB10 (1) Culture medium preparation LB solid culture medium formula: 10g sodium chloride, 10g tryptone, 5g yeast powder, 20g agar powder, bring the volume to 1L with distilled water, adjust the pH to ≈7.2, sterilize at 121℃ for 20min, and set aside. R2A solid culture medium formula: yeast extract 0.5 g / L, casein peptone 0.25 g / L, meat peptone 0.25 g / L, hydrolyzed casein 0.5 g / L, glucose 0.5 g / L, starch 0.5 g / L, pyruvate 0.3 g (pH = 7.2), sterilized at 121℃ for 20 min, ready for use.

[0034] (2) Isolation and purification of Pseudomonas eucalyptolus BGB10 Take the peel of young litchi fruits at the early stage of lychee downy mildew infection and rinse them under running water for 20 minutes. In a sterile operating table, cut the tissue blocks into 2-3 mm pieces from the junction of diseased and healthy tissue. Soak the tissue blocks in 75% alcohol for 30 seconds to sterilize, then in 2.5% sodium hypochlorite for 30 seconds, and finally in sterile water for 30 seconds. Repeat the sterile water soaking process three times. Transfer the treated tissue blocks to R2A solid medium plates and incubate at 25 ºC. Observe the colony growth daily. After bacteria appear around the tissue blocks, pick single colonies using an inoculation loop based on colony morphology, color, and other characteristics, and streak them onto LB solid medium plates for purification. Repeat streak purification 2-3 times until a pure culture is obtained. Name the purified strain BGB10.

[0035] (3) Morphological observation and Gram staining of Pseudomonas eucalyptolus BGB10 Strawberry strain BGB10 was streaked onto LB medium and incubated at 28°C for 3 days. The colony shape, size, color, and other characteristics were observed and recorded. Figure 1 .

[0036] Under aseptic conditions, a small amount of BGB10 bacteria cultured for 48 hours was picked and placed on a clean glass slide. The slide was heated over an alcohol lamp flame to kill the bacteria and allow them to adhere and fix. After staining with crystal violet for 1 min, the slide was rinsed with tap water to remove excess stain. The slide was then mordanted with potassium iodide solution for 1 min, and excess solution was discarded. The slide was decolorized with 95% ethanol for 30 s, counterstained with safranin for 30 s, rinsed with water, and dried. The staining results were observed under an optical microscope. Gram-positive bacteria remained purple, while Gram-negative bacteria appeared red. Figure 2 .

[0037] (4) Molecular biological identification of Pseudomonas eucalyptolus BGB10 Genomic DNA extraction and PCR amplification: Genomic DNA was extracted from strain BGB10 using a bacterial genomic DNA extraction kit, following the kit's instructions. Using the extracted genomic DNA as a template, universal primers for the bacterial 16S rRNA gene, 27F: 5'-AGAGTTTGATCCTGGCTCA-3' (as shown in SEQ ID NO.1) and 1492R 5'-GGTTACCTTGTTACGACTT-3' (as shown in SEQ ID NO.2), were used. The PCR reaction system (50 μL) consisted of: 1 μL template DNA, 5 μL 10× PCR buffer, 4 μL dNTP Mixture (2.5 mM each), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 0.5 μL Taq DNA polymerase (5 U / μL), and sterile double-distilled water to a final volume of 50 μL. PCR reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, for a total of 30 cycles; 72℃ final extension for 10 min.

[0038] PCR amplification was performed using primers F: 5'-GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA-3' (as shown in SEQ ID NO.5) and R: 5'-AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT-3' (as shown in SEQ ID NO.6) for the gyrB gene. The PCR reaction system and procedure were the same as above, with the annealing temperature adjusted to 58℃.

[0039] Primer synthesis was performed by Shanghai Sangon Biotech Co., Ltd. The amplified PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing, and the sequencing results were submitted to the NCBI nucleic acid database for BLAST alignment. The 16S rDNA and gyrB gene sequences of closely related strains were selected. The nucleotide sequence of the 16S rDNA of *Pseudomonas eucalyptolus* BGB10 is shown in SEQ ID NO.3, and the nucleotide sequence of gyrB is shown in SEQ ID NO.4. Multiple sequence alignment was performed using MEGA software, and a molecular phylogenetic tree was constructed using the neighbor-joining method. The bootstrap value was set to 1000 replicates (see [link to documentation]). Figure 3 and Figure 4 (As shown).

[0040] The nucleotide sequence of 16S rDNA of Pseudomonas eucalypti BGB10 is as follows: GCTTGCTCTCTGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGTTGTAGATTAATACTCTGCAATTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAAGCTAGAGTATGGTAGAGGGTAGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACTACCTGGACTGATACTGACACTGAGGTGCGAAAGCGT (SEQ ID NO.3).

[0041] The nucleotide sequence of gyrB from Pseudomonas eucalyptus BGB10 is as follows: (SEQ ID NO.4).

[0042] (5) Result of the appraisal Colonies formed by strain BGB10 on LB agar were round, smooth, moist, with regular edges, and pale yellow to milky white in color. Gram staining showed a red color, confirming it as a Gram-negative bacterium. BLAST alignment of the 16S rRNA and gyrB gene sequences showed that strain BGB10 was similar to *Pseudomonas eucalyptolus* (accession number CP056030.1) in GenBank. Pseudomonas eucalypticola The homology between BGB10 and the type strain reached 100.00%. Phylogenetic analysis showed that BGB10 and the Pseudomonas eucalyptus type strain belong to the same evolutionary branch (e.g., Figure 3 , Figure 4 (As shown). Based on comprehensive morphological observation, Gram staining results, and molecular phylogenetic analysis, the taxonomic name of strain BGB10 was determined as follows: Pseudomonas eucalypticolaFurther named: *Pseudomonas eucalyptolus* Pseudomonas eucalypticola BGB10 strain was deposited at the Guangdong Microbial Culture Collection Center (GDMCC) on June 3, 2026, with accession number GDMCC NO. 68399.

[0043] The selective functional plate assay was used to qualitatively determine four plant growth-promoting physiological and biochemical characteristics of strain BGB10: inorganic phosphorus solubility, organic phosphorus solubility, biological nitrogen fixation, and ferroptosis production. The results are as follows: Figure 5 As shown, after the strain was inoculated into inorganic phosphorus and organic phosphorus solid media, a clearly defined transparent phosphorus-solubilizing zone was formed around the colony, indicating that BGB10 can simultaneously dissolve both insoluble inorganic and organic phosphorus in the environment; the strain can grow normally on nitrogen-free selective medium, proving that it has the potential for autonomous biological nitrogen fixation; on the CAS ferophile detection plate, a large area of ​​orange-yellow halo appeared in the medium near the colony, indicating that the strain can secrete a large amount of ferophile.

[0044] Example 2: Preparation of Pseudomonas eucalyptolus BGB10 biocontrol agent (1) Activation of microbial strains Remove the BGB10 glycerol tubes of *Pseudomonas eucalyptolus* stored at -80℃ and thaw them in a clean bench. Use an inoculation loop to take a small amount of bacterial suspension, streak it on an LB agar plate, and incubate at 28℃ for 24-48 hours until single colonies appear.

[0045] (2) Preparation of seed liquid Use a sterile inoculation loop to pick a single colony of BGB10 from an LB solid medium plate and inoculate it into a sterile test tube containing 2 mL of LB liquid medium. Incubate the tube in a constant temperature shaker at 30°C and 180 rpm for 12 h to obtain the seed culture.

[0046] (3) Preparation of fermentation broth Take 1 mL of seed culture and inoculate it into a 250 mL Erlenmeyer flask containing 29 mL of LB liquid medium. Incubate in a constant temperature shaker at 30 °C and 200 r / min for 3 days to obtain BGB10 fermentation broth.

[0047] (4) Preparation of bacterial suspension The fermentation broth was aliquoted into 50 mL centrifuge tubes and centrifuged at 8000 rpm for 10 min at 4 °C. After centrifugation, the supernatant was transferred to new sterile centrifuge tubes for later use. The precipitated wet bacterial cells were resuspended in sterile water, and the bacterial suspension concentration was adjusted to OD0.05. 600 =0.9~1.1, to obtain BGB10 bacterial suspension.

[0048] (5) Preparation of supernatant Take the supernatant obtained after centrifugation and centrifuge it again at 8000 r / min for 5 min. Take the supernatant and filter it through a 0.22 μm sterile filter membrane to remove bacteria, and obtain BGB10 supernatant (sterile fermentation filtrate).

[0049] Example 3: Inhibitory effect of Eucalyptus Pseudomonas BGB10 on the mycelial growth of Phytophthora lichei. (1) Experimental materials Test pathogen: Phytophthora lichee ( Peronophythora litchii Chen ex Ko et al. was isolated from the "Guiwei" lychee fruit in our laboratory in 2025 from the litchi orchard of South China Agricultural University (23°9′39″N, 113°21′13″E).

[0050] Test inoculum: BGB10 fermentation broth (OD) prepared according to the method in Example 2. 600 ≈1) BGB10 bacterial suspension (OD) 600 ≈1), BGB10 supernatant (sterilized by 0.22μm filter membrane).

[0051] Culture medium: CA medium (carrot 200g / L, chopped and juiced with water, filtered through double gauze, agar powder 20g / L, pH adjusted to 7.0-7.2, sterilized at 121℃ for 20min).

[0052] (2) Activation of pathogens Take a plate containing the litchi frost blight strain that has been cultured in the dark at 26℃, and use the top of a sterilized yellow nozzle to take the fresh mycelial cake from the outermost layer of the plate. Inoculate it into the center of the CA medium plate, place it in an incubator, and culture it in the dark at 26℃ with alternating light and dark conditions for 5 days to allow the pathogen to grow all over the plate.

[0053] (3) Flat plate confrontation experiment The inhibitory effect of BGB10 on the mycelial growth of Phytophthora downycium on litchi was determined using the plate confrontation method. The specific procedure is as follows: Using a sterile punch (6 mm diameter), collect mycelial cakes from the edge of activated *Phytophthora lichrysum* colonies and inoculate them into the center of a fresh CA agar plate (90 mm diameter). Place sterile filter paper discs (6 mm diameter) at three symmetrical points approximately 27 mm from the pathogenic mycelial cake. Using a pipette, add 5 μL of BGB10 fermentation broth, 5 μL of BGB10 bacterial suspension, and 5 μL of BGB10 supernatant to the three sterile filter paper discs, respectively. Use a control (CK) without any inoculum. Each treatment has three replicates. Incubate the plates in the dark at 26°C for 5 days. After incubation, measure the diameter of *Phytophthora lichrysum* colonies on each plate and calculate the pathogen's growth area and inhibition rate.

[0054] The formula for calculating the inhibition rate is as follows: Inhibition rate (%) = (Pathogen area in control group - Pathogen area in treatment group) / Pathogen area in control group × 100%.

[0055] (4) Experimental results The results of the flat plate confrontation experiment are as follows Figure 6 As shown in the figure. Measurements and calculations showed that the BGB10 fermentation broth inhibited the growth of *Phytophthora lichei* mycelia by 81.20%, the BGB10 bacterial suspension by 78.30%, while the BGB10 supernatant showed no significant inhibitory effect. The results indicate that both the BGB10 fermentation broth and bacterial suspension significantly inhibited the growth of *Phytophthora lichei* mycelia, with the fermentation broth showing a slightly better inhibitory effect than the bacterial suspension. However, the BGB10 supernatant did not show a significant inhibitory effect on mycelial growth under these experimental conditions, suggesting that the main antibacterial active substances of BGB10 are cell wall-related components or intracellular products, rather than extracellular metabolic products.

[0056] Example 4: Effects of biocontrol agents on the morphological characteristics of Phytophthora downyensis mycelium in litchi The morphology of mycelia and sporangia of the pathogen in the control and treatment groups was observed using an optical microscope (Nikon, Nikon Seiki (Shanghai) Co., Ltd.). The microscopic morphology of the mycelia was observed using a scanning electron microscope. Mycelial edge tissue blocks measuring 5×2×1 mm were cut from the blank control group (CK) and fermentation broth treatment group, as well as from *Phytophthora lichee* plates cultured at constant temperature for 5 days, as described in Example 3. These were then fixed with 2.5% (v / v) glutaraldehyde for 24 hours at 4°C. After discarding the fixative, the samples were rinsed with 0.1M phosphate buffer (pH 7.2) for 15 minutes (3 times). Subsequently, the samples were exposed to ethanol gradients of 30%, 50%, 70%, 80%, 90%, and 100% (20 minutes for each gradient). The dehydrated mycelia were then critically dried with CO2, sputter-coated with gold, and the samples were observed and images acquired using a scanning electron microscope.

[0057] Assess the morphological differences between untreated and treated Phytophthora downyensis mycelia ( Figure 7 , Figure 8 In the control group, the hyphae were slender, smooth, and orderly branched. After treatment with BGB10 fermentation broth, bacterial suspension, and supernatant, the distribution of hyphal contents was uneven, hyphal branching increased, and deposits of contents were visible at hyphal nodes. The sporangia in the control group were plump and oval. After treatment with BGB10 fermentation broth, bacterial suspension, and supernatant, the distribution of hyphal contents was uneven, hyphal branching increased, and the number of sporangia decreased significantly, with uneven morphology, size, and color. Figure 9 ).

[0058] like Figure 8 As shown, the mycelial surface of the control group (CK) was intact without shrinkage or depression, and the thickness was uniform; the mycelial surface morphology of the group treated with BGB10 fermentation broth was abnormal, accompanied by collapse, shrinkage and mycelial breakage.

[0059] Example 5: Inhibitory effect of Eucalyptus Pseudomonas BGB10 on sporangium germination of Phytophthora lichei (1) Preparation of sporangium suspension of Phytophthora blight of litchi Take a plate of *Phytophthora lichee* that has been cultured in the dark at 26°C for 5-7 days on CA medium. Add 5 mL of sterile water to the plate containing confluent mycelia. Elute the sporangia using a disposable spreader. Filter the suspension containing sporangia and impurities through a sterile tea strainer into a 50 mL sterile centrifuge tube. Shake well. Add 10 μL of the sporangia suspension to a glass slide and observe and count the sporangia under an optical microscope. Based on the counting results, adjust the concentration to 5 × 10⁻⁶ with sterile water and shake well. 4 sporangia / mL.

[0060] (2) Sporangium germination inhibition experiment Experimental group: Use a pipette to take 0.5 mL of 5×10 4 A suspension of sporangia was mixed with 0.5 mL of BGB10 fermentation broth (OD200). 600 =1), BGB10 bacterial suspension (OD 600 =1) Mix the BGB10 supernatant (filtered through a sterile 0.22μm filter membrane) thoroughly in a 50.0 mL centrifuge tube; Control group: 0.5 mL of sporangium suspension (5 × 10⁻⁶) was taken using a pipette. 4 Mix 10 μL of sporangium suspension / mL with 0.5 mL of sterile water in a 10 mL centrifuge tube; each treatment was performed in triplicate, and each centrifuge tube was incubated at 30 °C and 180 rpm for 3 h. After 3 h of incubation, 10 μL of the mixture was aspirated from each centrifuge tube and added to a glass slide, covered with a coverslip, and observed under an optical microscope. Every 200 sporangia were counted as one replicate, and the number of germinated sporangia and the number of non-germinated sporangia were counted separately. Figure 9 Sporangium germination is determined by the germ tube length exceeding half the sporangium diameter. The formulas for calculating sporangium germination rate and inhibition rate are as follows: Germination rate (%) = Number of germinated germinations / Total number of germinations × 100%; Inhibition rate (%) = (Germination rate of control group - Germination rate of treatment group) / Germination rate of control group × 100% Experimental results showed that, compared with the control group, the fermentation broth, bacterial suspension, and supernatant of BGB10 all exhibited significant inhibitory effects on the sporangium germination of *Phytophthora lichei*. Among them, the fermentation broth and bacterial suspension of BGB10 showed the most prominent inhibitory effects, with sporangium germination rates of only 1.67% and 1.50%, respectively, and inhibition rates as high as 97.51% and 97.76%, respectively. The supernatant of BGB10 also showed a strong inhibitory effect, with an inhibition rate reaching 85.57%. These results indicate that BGB10 has a very strong inhibitory effect on the sporangium germination of *Phytophthora lichei*, and can effectively block the source of infection of the pathogen.

[0061] Example 6: Control effect of Pseudomonas eucalyptolus BGB10 on downy mildew of detached litchi fruits and leaves This study investigated the biocontrol effect of BGB10 bacterial suspension on litchi downy mildew by simulating field efficacy tests.

[0062] (1) Experimental materials Test fruits and leaves: Select fresh litchi fruits and healthy litchi leaves that are uniform in size, free from pests and diseases and mechanical damage, rinse them with tap water, and let them dry for later use.

[0063] Test bacterial agent: BGB10 bacterial suspension (OD) prepared according to the method in Example 2. 600 ≈1).

[0064] Test pathogen: a suspension of sporangia of Phytophthora lichee prepared according to the method in Example 4 (5 × 10⁻⁶). 4 (spongina / mL).

[0065] (2) Experiment on the efficacy of detached fruit for disease control Fresh lychee fruits were randomly divided into a treatment group and a control group, with 15 fruits in each group and 3 replicates for each treatment (i.e., 15 fruits per replicate). The fruits were placed in a food storage container.

[0066] Treatment group: Use a sprayer to spray the BGB10 bacterial suspension (OD) 600 ≈1) Spray evenly onto the surface of lychee fruit, with a total spray volume of 50 mL for each replicate. Control group: Spray with an equal volume of sterile water.

[0067] After spraying, allow the fungal agent to fully colonize for 24 hours. After 24 hours, use a sprayer to spray the sporangia suspension of *Phytophthora lychee* (5 × 10⁻⁶). 4 The inoculation solution (1 sporangia / mL) was evenly sprayed onto the surface of litchi fruits in both the treatment and control groups. After inoculation, the containers were placed in a preservation box and incubated under 26°C and humid conditions.

[0068] Disease incidence on fruits in both treatment groups and the control group was investigated at 48 h and 60 h post-inoculation. The investigation was conducted according to the following disease severity grading criteria: According to the disease severity investigation method: Level 1: Slight lesions at the inoculation point, with necrosis area less than 5%; Level 3: Necrosis area 5%-10%; Level 5: Necrosis area 10%-25%; Level 7: Necrosis area 25%-50%; Level 9: Necrosis area exceeding 50% or complete browning.

[0069] Statistical calculation methods for disease index and biocontrol efficacy: Disease index (%) = [∑(disease grade number × number of fruits at that disease grade) / (highest disease grade × total number of fruits)] × 100; Biological control effect (%) = [(Control disease index - Treatment disease index) / Control disease index] × 100.

[0070] (3) Experiment on the efficacy of detached leaf Fresh lychee leaves were randomly divided into a treatment group and a control group, with 18 leaves in each group and 3 replicates for each treatment (i.e., 18 leaves per replicate). The leaves were placed in a food storage container.

[0071] Treatment group: Use a sprayer to spray the BGB10 bacterial suspension (OD) 600 ≈1) Spray evenly onto the surface of litchi leaves, with a total spray volume of 50 mL per replicate. Control group: Spray with an equal volume of sterile water.

[0072] Leave the solution for 24 hours after spraying. After 24 hours, spray the sporangia suspension of Phytophthora lychee using a sprayer (5×10⁻⁶). 4 The inoculation solution (1 sporangia / mL) was evenly sprayed onto the surface of litchi leaves in both the treatment and control groups. After inoculation, the containers were placed in a preservation box and incubated under 26°C and humid conditions.

[0073] Leaf disease incidence was assessed 72 hours after inoculation in both treatment and control groups, following the same disease severity grading standards as for fruit. The disease index and biocontrol efficacy calculation formulas were the same as those used in the fruit experiment.

[0074] (4) Experimental results Results of the experiment on the efficacy of detached fruit as follows Figure 10 As shown, 48 hours after inoculation of detached litchi fruits, the disease index of litchi fruits treated with BGB10 bacterial suspension was 15.56%, while the disease index of the control group was 73.37%, indicating that the control efficacy of BGB10 bacterial suspension against litchi fruits reached 77.89%. 60 hours after inoculation, the disease index of litchi fruits in the treated group was 22.96%, while the disease index of the control group was 88.15%, with a control efficacy of 73.95%. This demonstrates that BGB10 bacterial suspension has a significant and long-lasting control effect against downy mildew of detached litchi fruits.

[0075] Results of the detached blade control efficacy experiment are as follows Figure 11As shown, 72 hours after inoculation of detached litchi leaves, the disease index of litchi leaves treated with BGB10 bacterial suspension was 34.03%, while the disease index of the control group was 71.53%, indicating that the control efficacy of BGB10 bacterial suspension on litchi leaves reached 53.43%. This demonstrates that BGB10 bacterial suspension also has a good control effect on downy mildew of detached litchi leaves.

[0076] Example 7: Application method of Pseudomonas eucalyptolus BGB10 biocontrol agent This embodiment provides a specific application method for the biocontrol agent BGB10 of Pseudomonas eucalyptus in the prevention and control of lychee downy mildew.

[0077] (1) Preparation of microbial agents BGB10 bacterial suspension (OD) was prepared according to the method in Example 2. 600 =0.9~1.1) or BGB10 fermentation broth, used as a biocontrol agent.

[0078] (2) Application period Spraying can be carried out during the flowering, young fruit, and fruit enlargement stages of litchi, or before or at the early stage of litchi downy mildew. Preventive spraying is preferred during the peak season for litchi downy mildew (such as before the rainy season).

[0079] (3) Application method Apply the prepared BGB10 biocontrol agent evenly to the leaves, flower spikes, and fruit surfaces of the litchi plants. The application rate should be such that the agent evenly covers the plant surface without forming noticeable droplets running down. The recommended application rate is 50-100 L of agent per acre (adjust appropriately according to plant size and density).

[0080] (4) Frequency of application It is recommended to spray once every 7-10 days, for 2-3 consecutive applications. During rainy seasons or periods of high disease incidence, the application interval can be appropriately shortened.

[0081] Comparative Example 1: A comparative experiment between *Pseudomonas eucalyptolus* BGB10 and existing biocontrol bacteria. To verify the superiority of the Eucalyptus Pseudomonas BGB10 of the present invention over the biocontrol bacteria in the prior art, a comparative experiment was set up in this control example.

[0082] (1) Test strains Experimental group: Eucalyptus Pseudomonas of the present invention ( Pseudomonas eucalypticola BGB10 bacterial suspension (OD) 600 ≈1), prepared according to the method of Example 2.

[0083] Control group: Pseudomonas aeruginosa CWD-D bacterial suspension (OD) disclosed in the prior art. 600≈1) As a control bacterial agent (CK).

[0084] (2) Experimental methods Following the plate confrontation method of Example 3, the inhibition rates of BGB10 and CWD-D on the mycelial growth of Phytophthora lichee were determined. Each treatment was performed in triplicate.

[0085] (3) Experimental results Experimental results showed that, under the same experimental conditions, the BGB10 bacterial suspension of this invention inhibited the growth of *Phytophthora licheniformis* mycelium by 78.30%, while the control strain CWD-D bacterial suspension inhibited the growth of *Phytophthora licheniformis* mycelium by 67.83%. Figure 12 BGB10 exhibits superior antibacterial effects compared to CWD-D. BGB10 belongs to a different species of *Pseudomonas eucalyptolus*, derived from the pericarp of infected young litchi fruits. It has a natural mutualistic symbiotic relationship with litchi, giving it a unique advantage in terms of ecological safety. Furthermore, BGB10 showed an inhibition rate of up to 97.76% on the sporangium germination of *Phytophthora downyensis* (bacterial suspension).

[0086] The above results indicate that this invention is the first to apply Pseudomonas eucalyptus to the biological control of lychee downy mildew, providing a novel biocontrol strain resource and filling the gap in the field of Pseudomonas eucalyptus in the control of lychee diseases.

[0087] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. A strain of Eucalyptus Pseudomonas ( Pseudomonas eucalypticola BGB10, characterized in that, The *Pseudomonas eucalyptolus* BGB10 strain is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC NO:68399 and deposit date of June 3, 2026.

2. A biocontrol agent, characterized in that, Contains the Eucalyptus Pseudomonas BGB10 as described in claim 1.

3. The biocontrol agent according to claim 2, characterized in that, The biocontrol agent is any one or more of the fermentation broth, bacterial suspension, or sterile fermentation filtrate of *Pseudomonas eucalyptolus* BGB10.

4. The biocontrol agent according to claim 2, characterized in that, The biocontrol agent also includes agriculturally acceptable carriers or adjuvants.

5. The use of the Eucalyptus Pseudomonas BGB10 according to claim 1 or the biocontrol agent according to any one of claims 2-4 in the preparation of drugs or fungal agents for the prevention and control of lychee downy mildew.

6. The application according to claim 5, characterized in that, The prevention and control of lychee frost blight includes any one or more of the following: inhibiting the mycelial growth of Phytophthora lycheeis, inhibiting the germination of Phytophthora lycheeis sporangia, reducing the incidence of frost blight in detached lychee fruits, or reducing the incidence of frost blight in detached lychee leaves.

7. A method for preventing and controlling lychee downy mildew, characterized in that, The biocontrol agent according to any one of claims 2-4 is applied to the surface of litchi plants or litchi fruits.

8. The method according to claim 7, characterized in that, The biocontrol agent is applied by spraying.

9. A method for preparing fermentation broth of *Pseudomonas eucalyptolus* BGB10, characterized in that, The process includes the following steps: inoculating the Eucalyptus Pseudomonas BGB10 of claim 1 into a liquid culture medium for fermentation culture, and collecting the fermentation broth.

10. The preparation method according to claim 9, characterized in that, The fermentation culture was carried out at a temperature of 25 ℃ to 30 ℃, with an oscillation speed of 150 r / min to 220 r / min, and a culture time of 2 d to 5 d.

Images