Genetically engineered bacteria and construction method and use thereof

Abstract

This invention relates to the field of microbial technology, and in particular to a genetically engineered bacterium, its construction method, and its uses. The originating bacterium is *Bacillus belyssioides*, and the original promoter P of srfAA in the genome of the genetically engineered bacterium... srfA Replaced with P xylA This invention replaces the original promoter of srfAA in the Bacillus belyss genome with P... xylA To achieve coupled regulation of surfactant synthesis and xylose metabolism, a progressive metabolic engineering approach involving ptsG knockout, ccpA knockout, and xylAB overexpression was employed to overcome the glucose-xylose co-utilization barrier at the molecular level. Following continuous domestication with straw enzymatic hydrolysate, the strain's tolerance to hydrolysate inhibitors and product synthesis efficiency were further enhanced. In fed-batch fermentation using straw sugar as a carbon source in a 5 L fermenter, this genetically engineered bacterium achieved a surfactant yield of 29.5 g / L, comparable to that of grain sugar fermentation, realizing the high-value utilization of agricultural and forestry waste and demonstrating significant potential for industrial application.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a genetically engineered bacterium, its construction method, and its uses. Background Technology

[0002] Surfactins are a class of cyclic lipopeptide biosurfactants mainly produced by Bacillus. They consist of a heptapeptide structure composed of β-hydroxy fatty acids and amino acids such as glutamic acid, aspartic acid, leucine, and valine, linked by lactone bonds to form a cyclic molecule. Surfactins exhibit excellent surface activity, reducing the surface tension of water to below 27 mN / m and achieving a critical micelle concentration as low as 10–20 mg / L. They also possess antibacterial, antiviral, antitumor, and environmentally friendly properties, making them promising for applications in oil extraction, agricultural biological control, the food industry, and environmental remediation.

[0003] Surfactants are typically produced by fermentation of Bacillus bacteria, with Bacillus subtilis being the most widely used strain. Other Bacillus species closely related to Bacillus subtilis, such as Bacillus belyssae and Bacillus amyloliquefaciens, are also used in surfactant production. Surfactant biosynthesis is catalyzed by a non-ribosomal peptide synthase system, with the associated srfAABCD gene cluster exceeding 27 kb in length. This cluster includes genes such as srfAA, srfAB, srfAC, and srfAD, which participate in processes such as peptide chain elongation, modular assembly, and cyclization release. The natural promoter PsrfA of this gene cluster is regulated by multiple regulatory networks, including the ComX / ComP-ComA quorum sensing system and the DegS-DegU two-component system.

[0004] Currently, the production of most synthetic biology fermentation products, including surfactants, still relies on grain-based carbon sources such as glucose and sucrose. As biomanufacturing scales up, the ethical and resource conflicts arising from competition between biomanufacturing and food production are becoming increasingly prominent. Producing tens of thousands of tons of surfactants annually would require hundreds of thousands of tons of grain-based sugars. This large-scale use of grain-based sugars not only increases raw material costs but also creates resource constraints for the large-scale industrialization of surfactants. Therefore, developing widely available and lower-cost non-grain carbon sources to replace traditional grain-based sugars has become an important direction for reducing the production cost of surfactants.

[0005] my country's annual crop straw production is close to 1 billion tons, representing a rich renewable biomass resource. Straw is mainly composed of cellulose, hemicellulose, and lignin. After pretreatment and enzymatic or dilute acid hydrolysis, a mixed sugar solution containing glucose, xylose, and arabinose can be obtained. Glucose and xylose typically constitute the main fermentable sugar components in the straw hydrolysate. Therefore, using straw sugars as a carbon source for surfactant fermentation not only reduces dependence on grain-based sugars but also facilitates the high-value utilization of agricultural waste.

[0006] However, straw sugar differs significantly from single refined sugars such as glucose and sucrose, placing higher demands on the production strains when used directly for microbial fermentation. On one hand, pretreatment and hydrolysis of straw may generate inhibitory substances such as furfural and acetic acid, adversely affecting strain growth and product synthesis. Therefore, the production strains need to have good tolerance to straw hydrolysate. On the other hand, glucose and xylose coexist in straw sugar, and the carbon source utilization of Bacillus is regulated by carbon metabolism repression. In the presence of glucose, xylose uptake and metabolism are easily inhibited, leading to preferential glucose consumption and insufficient xylose utilization, thus affecting the overall utilization efficiency of the straw mixed sugar.

[0007] Therefore, to produce surfactants using straw sugar as a carbon source, the strains need to have strong adaptability to the straw sugar environment, good utilization of xylose and mixed sugars, and high surfactant synthesis capacity.

[0008] Examining the existing surfactant-producing strains based on the above requirements reveals significant shortcomings in their performance.

[0009] For naturally occurring wild Bacillus strains, insufficient xylose utilization, tolerance to straw hydrolysate, or surfactant synthesis capacity are common problems. Most reported wild Bacillus strains typically yield only 0.2–1 g / L of surfactant under shake-flask fermentation conditions, with yields usually below 10 g / L during scale-up production. Even some wild strains capable of utilizing xylose or adapting to complex plant biomass hydrolysate environments may not have surfactant synthesis levels sufficient for high yields; conversely, some strains with strong natural surfactant synthesis capabilities may not possess good xylose utilization and straw sugar tolerance. Therefore, current technology lacks wild Bacillus strains that naturally possess straw sugar tolerance, xylose and mixed sugar utilization capabilities, and high surfactant synthesis capacity.

[0010] For existing genetically engineered bacteria, the modification goals mainly focus on improving surfactant synthesis capacity, and the high-yield fermentation systems established still largely rely on readily available carbon sources such as glucose and sucrose. On the other hand, metabolic engineering modifications targeting xylose utilization in Bacillus mainly focus on improving xylose uptake and metabolism or reducing carbon metabolism repression, and their goal is usually not surfactant production. Therefore, existing high-yield surfactant production and xylose utilization modification are generally relatively independent technical directions, and there is a lack of strains that synergistically optimize the utilization of straw mixed sugars and the efficient synthesis of surfactants. Especially in straw mixed sugar systems where glucose and xylose coexist, simply increasing the expression of surfactant synthesis-related genes cannot solve the problem of insufficient xylose utilization; and simply improving xylose metabolism capacity cannot guarantee that the increased carbon metabolic flux can be effectively converted into surfactants.

[0011] In general, existing wild-type and genetically engineered strains struggle to simultaneously achieve both the properties of "using xylose or straw mixed sugars as carbon sources" and "high surfactant production." Therefore, it is necessary to obtain wild-type Bacillus strains that are naturally tolerant to straw sugars, capable of utilizing straw mixed sugars, and possess high surfactant synthesis capabilities to provide an excellent chassis suitable for non-grain carbon source fermentation. Furthermore, based on this, genetic modification can be used to enhance the utilization of xylose and straw mixed sugars and surfactant synthesis capabilities, thereby constructing genetically engineered strains more suitable for high surfactant production using straw sugars as carbon sources. Summary of the Invention

[0012] In view of the shortcomings of the prior art described above, and in order to solve the problem that both existing wild strains and genetically engineered strains are unable to simultaneously achieve the two properties of "using xylose or straw mixed sugar as a carbon source" and "high production of surfactants", the purpose of this application is to provide a strain of Bacillus belyssus, a genetically engineered bacterium, and its construction method and uses, to solve the problems in the prior art.

[0013] To achieve the above and other related objectives, this application first provides a genetically engineered bacterium, wherein the originating bacterium is *Bacillus belyssae*, and the original promoter P of srfAA in the genome of the genetically engineered bacterium is... srfA Replaced with P xylA .

[0014] This application also provides a strain of Bacillus velezensis, with accession number CCTCC NO: M 20251689.

[0015] This application subsequently provides the use of the above-mentioned genetically engineered bacteria or the above-mentioned Bacillus vesiculosus in the preparation of surfactants.

[0016] This application then provides a method for preparing a surfactant, comprising the following steps: inoculating the above-mentioned genetically engineered bacteria or the above-mentioned Bacillus belye into an initial fermentation medium for fermentation to obtain a surfactant; the fermentation of the genetically engineered bacteria is carried out under xylose induction.

[0017] Finally, this application provides a method for constructing genetically engineered bacteria, comprising the following steps: replacing the original promoter of srfAA in the genome of Bacillus belye with PxylA through homologous recombination.

[0018] Compared with the prior art, the beneficial effects of this application are as follows:

[0019] The wild-type Bacillus belyss strain provided in this invention (preservation number: CCTCC NO: M20251689) can produce 10.4 g / L of surfactant in shake flask culture and 22.3 g / L in fed-batch fermentation in a 5 L fermenter. Its yield and production intensity are far higher than the known fermentation levels of wild-type bacteria, showing great potential for industrial application. At the same time, this strain also has a strong natural ability to utilize straw sugars.

[0020] This invention replaces the original promoter of srfAA in the Bacillus belyss genome with P xylA To achieve coupled regulation of surfactant synthesis and xylose metabolism, a progressive metabolic engineering approach involving ptsG knockout, ccpA knockout, and P43-xylAB overexpression was employed to overcome the barrier to glucose-xylose co-utilization at the molecular level. Following continuous domestication with straw enzymatic hydrolysate, the strain's tolerance to hydrolysate inhibitors and product synthesis efficiency were further enhanced. In fed-batch fermentation using straw sugar as a carbon source in a 5 L fermenter, this genetically engineered bacterium achieved a surfactant yield of 29.5 g / L, comparable to that of grain sugar fermentation. This demonstrates the high-value utilization of agricultural and forestry waste and a closed-loop circular economy of "straw-sugar-surfactant-agricultural application," exhibiting significant potential for industrial application. Attached Figure Description

[0021] Figure 1 The colony morphology is shown as Bacillus belyssus Bv251.

[0022] Figure 2 The image shows the HPLC analysis results of the surfactant standard.

[0023] Figure 3 The image shows the LC-MS analysis results of the surfactant standard.

[0024] Figure 4 , Figure 6 , Figure 8 , Figure 10The following are HPLC analysis results of Bacillus belyss Bv251 fermentation broth from Examples 3 to 6, displayed sequentially.

[0025] Figure 5 , Figure 7 , Figure 9 , Figure 11 The following figures sequentially show the LC-MS analysis results of Bacillus belyssus Bv251 fermentation broth from Examples 3 to 6.

[0026] Figure 12 The graph shows a comparison of surfactant production during shake-flask fermentation of *Bacillus vesiculus* FZB42, *Bacillus vesiculus* Bv251, and *Bacillus vesiculus* 251Bsxyl in Examples 8, 1, and 9, respectively.

[0027] Figure 13 The graph shows the sugar consumption and surfactant production of Bacillus vesiculosus 251BsxylPCX and Bacillus vesiculosus 251Bsxyl in shake-flask fermentation using a glucose-xylose mixed sugar in Example 11 and Comparative Example 2.

[0028] Figure 14 This diagram shows key parameters during the fed-batch fermentation process of genetically engineered bacteria that produce surfactants using straw sugar in Example 13.

[0029] Figure 15 The image shown is a fed-batch fermentation result of the undomesticated carbon metabolism-modified strain 251BsxylPCX in Comparative Example 3. Detailed Implementation

[0030] To make the inventive objectives, technical solutions, and beneficial effects of this application clearer, the following description, in conjunction with embodiments, further illustrates this application. It should be understood that the embodiments described are for illustrative purposes only and are not intended to limit the scope of the application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this description.

[0031] The first aspect of this application provides a genetically engineered bacterium, the originating bacterium being *Bacillus belyssae*, wherein the genome of the genetically engineered bacterium contains the original promoter P of srfAA. srfA Replaced with P xylA .

[0032] In this application, "srfAA" refers to Bacillus belye ( Bacillus velezensisThe srfAA gene in the srfA operon, which is involved in the biosynthesis of surfactantin, is located at the 5′ end of the srfA operon. It encodes the nonribosomal peptide synthase SrfAA and, together with other genes in the srfA operon, participates in the biosynthesis of surfactantin.

[0033] In this application, "PsrfA" refers to the natural promoter of the srfA operon in Bacillus bereaves, which is located upstream of the srfAA gene and can initiate and regulate the transcription of the srfA operon, thereby regulating the expression of srfAA and other related genes in the operon. In this application, PsrfA is also referred to as the srfA primitive promoter, the srfAA primitive promoter, or the srfA natural promoter.

[0034] In some specific implementations, the P xylA It originates from Bacillus subtilis, Bacillus belye, or Priestella megaterium.

[0035] Preferably, the P xylA It originates from Bacillus subtilis.

[0036] More preferably, the P xylA Derived from Bacillus subtilis ATCC 6051a.

[0037] More preferably, the P xylA The nucleotide sequence contains the sequence shown in SEQ ID NO:1, or a sequence that has at least 85% sequence identity with the sequence shown in SEQ ID NO:1 and has the same function.

[0038] TTCATCCACTCCATTTGTTTAATCTTTAAATTAAGTATCAACATAGTACATAGCGAATCTTCCCTTTTATTATATCTAATGTGTTCATAAAAAACTAAAAAAAATATTGAAAATACTGACGAGGTTATATAAGATGAAAATAAGTTAGTTGTTTAAACAACAAACTAATAGGTGATGTACTTACTATATGAAATAAAATGCATCTGTATTTGAATGAATTTATTTTTAAGGGGGAAATCAC (SEQ ID NO:1).

[0039] This application utilizes the xylose-inducible promoter P xylA Replace the natural srfAABCD promoter P srfA This method couples and regulates surfactant synthesis with xylose metabolism. When xylose is present in the system, P... xylAThe promoter is activated, driving efficient expression of srfAABCD; expression automatically terminates when xylose is depleted. This regulatory mechanism is naturally adapted to the fermentation system of straw sugar, enabling self-induced production without the need for additional inducers.

[0040] In some specific embodiments, the Bacillus belyssus has the accession number CCTCC NO: M20251689.

[0041] In some specific embodiments, the genome of the genetically engineered bacteria also includes the following genetic modification: deletion or inactivation of the ptsG gene to reduce the efficiency of glucose phosphorylation transport.

[0042] Preferably, the nucleotide sequence of the ptsG gene comprises the sequence described in SEQ ID NO:2.

[0043]

[0044] In some specific embodiments, the genome of the genetically engineered bacteria also includes the following genetic modification: deletion or inactivation of the ccpA gene to relieve the inhibition of xylose metabolism by global carbon metabolism regulators.

[0045] Preferably, the nucleotide sequence of the ccpA gene comprises the sequence described in SEQ ID NO:3.

[0046]

[0047] In some specific embodiments, the genome of the genetically engineered bacteria also includes the following genetic modification: overexpression of the xylAB gene to enhance xylose metabolism efficiency.

[0048] Preferably, the nucleotide sequence of the xylAB gene comprises the sequence described in SEQ ID NO:4.

[0049]

[0050] The nucleotide sequence of the xylA gene in the xylAB gene includes the sequence described in SEQ ID NO:22.

[0051]

[0052] The nucleotide sequence of the xylB gene in the xylAB gene includes the sequence described in SEQ ID NO:23.

[0053]

[0054] In this application, "deletion or inactivation" refers to the complete or partial deletion of a target gene through genetic modification, or the loss or significant reduction in the expression and / or function of the target gene's encoded product to the point that it cannot perform its original biological function normally. "Deletion" includes the complete or partial deletion of the coding region of the target gene; "inactivation" includes the introduction of genetic alterations into the coding and / or regulatory sequences of the target gene that lead to loss of function. Methods for achieving the deletion or inactivation include, but are not limited to: deleting all or part of the nucleotide sequence of the target gene, inserting a foreign nucleotide sequence into the target gene, introducing frameshift mutations, nonsense mutations, or other loss-of-function mutations, disrupting the promoter, ribosome binding site, or other expression regulatory elements of the target gene, or employing other genetic modification methods that prevent the target gene from expressing a normally functioning encoded product. The genetic modification can be achieved through homologous recombination, CRISPR / Cas-mediated gene editing, or other genetic engineering methods known in the art.

[0055] In this application, "overexpression" refers to an increased expression level of a target gene compared to the corresponding unmodified parental strain and / or wild-type strain. This increased expression level can manifest as increased transcriptional levels of the target gene, increased expression levels of the protein encoded by the target gene, and / or enhanced biological function or activity of the product encoded by the target gene. Methods for achieving target gene overexpression include, but are not limited to: replacing the natural promoter of the target gene with a promoter of higher transcriptional activity, introducing a promoter or other regulatory element upstream of the target gene to enhance its expression, increasing the copy number of the target gene in the genome, optimizing the ribosome binding site or other expression regulatory sequences of the target gene, and / or employing other genetic modification methods capable of increasing the expression level of the target gene. In a specific embodiment of this application, overexpression of xylAB was achieved by introducing promoter P43 upstream of the xylAB gene.

[0056] In this application, "a nucleotide sequence comprising the sequence shown in SEQ ID NO. X" means that the nucleotide sequence comprises the complete nucleotide sequence shown in SEQ ID NO. X. This includes, but is not limited to, the following: (1) the nucleotide sequence is identical to the nucleotide sequence shown in SEQ ID NO. X; (2) one or a small number of nucleotides are added to the 5′ and / or 3′ ends of the nucleotide sequence shown in SEQ ID NO, and the added nucleotides do not change the biological function of the sequence as described in this application. In other words, as long as the complete sequence shown in SEQ ID NO. X is included in the nucleotide sequence, and the presence of the additional nucleotides does not affect its corresponding function, it falls under the definition of "comprising the sequence shown in SEQ ID NO. X" in this application. X is 1 to 24.

[0057] In this application, "a sequence having at least 85% sequence identity and the same function as the sequence shown in SEQ ID NO. X" means that after sequence alignment, the nucleotide sequence to be compared with the nucleotide sequence shown in SEQ ID NO. X has at least 85% nucleotide sequence identity, and the sequence to be compared can achieve the same function as the sequence shown in SEQ ID NO. X at the biological functional level involved in this application. The sequence may differ from the sequence shown in SEQ ID NO. X due to substitution, deletion, and / or insertion of one or more nucleotides, as long as it meets the above sequence identity requirement and maintains the same function. X is 1 to 24.

[0058] In some embodiments, the sequence has at least 85% sequence identity with the sequence shown in SEQ ID NO. X; preferably at least 90% sequence identity; more preferably at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, and has the same function as the sequence shown in SEQ ID NO. X. X is 1 to 24.

[0059] The second aspect of this invention provides a strain of Bacillus velezensis, deposited at the China Center for Type Culture Collection (CCTCC), with the strain name: Bacillus velezensis Bv251, accession number: CCTCC NO: M20251689, deposit date: July 24, 2025, and deposit address: Wuhan University, Wuhan, China.

[0060] The Bacillus velezensis described is a Gram-positive bacterium with a colony morphology typical of Bacillus velezensis, characterized by being round, smooth, opaque, milky white, viscous, and moist in texture; after culturing for more than 36 hours, obvious wrinkles and protrusions appear in the center of the colony.

[0061] The *Bacillus velezensis* species described herein is capable of producing surfactants. The surfactant production yield of *Bacillus velezensis* can reach up to 22 g / L or higher, for example, 22.3 g / L.

[0062] The Bacillus velezensis strain was obtained by screening high-surfactant-producing strains of Bacillus isolated from soil samples, cultured in test tubes and shake flasks, and analyzed by HPLC of the fermentation broth.

[0063] The third aspect of this application provides the use of the genetically engineered bacteria described in the first aspect or the Bacillus berleis described in the second aspect in the preparation of surfactants.

[0064] The fourth aspect of this application provides a method for preparing a surfactant, comprising the following steps: inoculating the genetically engineered bacteria described in the first aspect or the Bacillus berberis described in the second aspect into an initial fermentation medium for fermentation to obtain a surfactant; the fermentation of the genetically engineered bacteria is carried out under xylose induction.

[0065] In some specific embodiments, the initial fermentation medium contains a carbon source, a nitrogen source, and inorganic salts.

[0066] Preferably, the carbon source is selected from glucose, xylose, or a mixture of sugars containing xylose.

[0067] More preferably, when the carbon source of the initial fermentation medium is glucose, xylose is added during the fermentation process for induction.

[0068] More preferably, the xylose is added 6-12 hours after the start of fermentation. Even more preferably, the xylose is added 6-8 hours after the start of fermentation.

[0069] More preferably, the final concentration of xylose added is 5~20 g / L.

[0070] More preferably, when the carbon source of the initial fermentation medium is xylose or a mixed sugar containing xylose, the xylose in the carbon source is used for induction.

[0071] More preferably, the mixed sugar containing xylose is selected from straw sugar or straw hydrolysate.

[0072] More preferably, the straw sugar is a fermentable sugar solution that has undergone a single detoxification treatment, with a total reducing sugar concentration of 400-800 g / L. Specifically, the total reducing sugar concentration is 400-500 g / L, 500-600 g / L, 600-700 g / L, or 700-800 g / L.

[0073] More preferably, the straw enzymatic hydrolysate is the original hydrolysate that has not been detoxified and concentrated, and the total reducing sugar concentration is 10~150 g / L.

[0074] Specifically, the total reducing sugar concentration is 10~30g / L, 30~50g / L, 50~70g / L, 70~90g / L, 90~110g / L, 110~130g / L, or 130~150g / L.

[0075] More preferably, the straw sugar and straw enzymatic hydrolysate contain glucose, xylose and arabinose.

[0076] More preferably, the mass ratio of glucose to xylose is (1.5~2.5):1. Specifically, the mass ratio of glucose to xylose is 1.5:1, 2:1, or 2.5:1.

[0077] Preferably, the nitrogen source is selected from one or more of ammonium sulfate, yeast extract, peptone, corn steep liquor, urea, ammonium chloride, sodium nitrate, and potassium nitrate.

[0078] Preferably, the inorganic salt is selected from Ca. 2+ Fe 2+ Mn 2+ Mg 2+ It is a hydrochloride or sulfate, or a phosphate buffer system.

[0079] Preferably, the total concentration of the carbon source is 10-80 g / L based on the total volume of the fermentation medium. More preferably, the total concentration of the carbon source is 20-60 g / L based on the total volume of the fermentation medium. Specifically, the total concentration of the carbon source is 20-30 g / L, 30-40 g / L, 40-50 g / L, or 50-60 g / L based on the total volume of the fermentation medium.

[0080] Preferably, the total concentration of the nitrogen source is 5-30 g / L based on the total volume of the fermentation medium. More preferably, the total concentration of the nitrogen source is 5-20 g / L based on the total volume of the fermentation medium. Specifically, the total concentration of the nitrogen source is 5-8 g / L, 8-11 g / L, 11-14 g / L, 14-17 g / L, or 17-20 g / L based on the total volume of the fermentation medium.

[0081] Preferably, the total concentration of the inorganic salts is 0.01–20 g / L, based on the total volume of the fermentation medium. More preferably, the total concentration of the inorganic salts is 0.05–17 g / L, based on the total volume of the fermentation medium. Specifically, the total concentration of the inorganic salts is 0.05–3 g / L, 3–6 g / L, 6–9 g / L, 9–12 g / L, 12–15 g / L, or 15–17 g / L, based on the total volume of the fermentation medium.

[0082] Preferably, the initial fermentation medium further comprises an antifoaming agent, which is selected from one or more of polyether antifoaming agents, vegetable oil antifoaming agents, and organosilicon antifoaming agents.

[0083] More preferably, the volume fraction of the defoamer is 1-3‰ based on the total volume of the fermentation medium.

[0084] Preferably, the initial fermentation medium further comprises amino acids, wherein the amino acids are selected from one or more of leucine, isoleucine, glutamic acid, aspartic acid, and valine. More preferably, the amino acids are selected from leucine.

[0085] More preferably, the total concentration of the amino acids is 8-15 g / L based on the total volume of the fermentation medium. Even more preferably, the total concentration of the amino acids is 10-12 g / L based on the total volume of the fermentation medium.

[0086] In some specific embodiments, fed-batch fermentation is also included, which includes the following steps: adding fed-batch culture medium to the culture system.

[0087] Preferably, the total reducing sugar concentration in the supplemental culture medium is 500-1000 g / L. Specifically, the total reducing sugar concentration in the supplemental culture medium is 500-600 g / L, 600-700 g / L, 700-800 g / L, 800-900 g / L, or 900-1000 g / L.

[0088] Preferably, the total nitrogen source concentration in the supplemental culture medium is 100-200 g / L. Specifically, the total nitrogen source concentration in the supplemental culture medium is 100-150 g / L or 150-200 g / L.

[0089] Preferably, the feed fermentation speed is 200-800 rpm. More preferably, the feed fermentation speed is 200-500 rpm.

[0090] Preferably, the aeration rate of the fed-batch fermentation is 3-7 L / min. More preferably, the aeration rate of the fed-batch fermentation is 4-6 L / min.

[0091] Preferably, the dissolved oxygen level during fed-batch fermentation is maintained at 20% or higher. More preferably, the dissolved oxygen level during fed-batch fermentation is maintained at 30% or higher.

[0092] Preferably, the pH is maintained at 6.5 to 7.5. More preferably, the pH is maintained at 7.0.

[0093] The fifth aspect of this application provides a method for constructing genetically engineered bacteria, comprising the following steps: homologous recombination of the original promoter P of srfAA in the Bacillus belye genome. srfA Replace with P xylA .

[0094] In some specific implementations, one or more of the following operations are also included:

[0095] a) Knockout or inactivation of the ptsG gene via homologous recombination;

[0096] b) Knockout or inactivation of the ccpA gene via homologous recombination;

[0097] c) Overexpression of the xylAB gene is achieved by integrating the P43-xylAB expression cassette, which includes the P43 promoter and the xylAB gene, into the genome.

[0098] In this application, "homologous recombination" refers to the recombination of homologous sequences at both ends of the nucleic acid fragment to be introduced with the corresponding sequences of the target site in the host bacterium genome, thereby integrating the nucleic acid fragment to be introduced into the target site in the genome to achieve genetic modification such as gene replacement, gene knockout or inactivation, and gene overexpression.

[0099] Specifically, based on the location of the gene to be modified in the host bacterial genome, the nucleotide sequences of the upstream and downstream regions of the gene can be selected as upstream and downstream homologous arms, respectively. A nucleic acid fragment to be integrated, used to achieve the corresponding genetic modification, is then positioned between the upstream and downstream homologous arms. After the recombinant nucleic acid containing the sequence "upstream homologous arm—nucleic acid fragment to be integrated—downstream homologous arm" is introduced into the host bacterial genome, the upstream and downstream homologous arms undergo homologous recombination with their corresponding regions in the host bacterial genome. This integrates the nucleic acid fragment to be integrated between the two homologous arms into the target genomic location, replacing all or part of the original nucleotide sequence at that location.

[0100] Specifically, when the genetic modification is: to modify the original promoter P of srfAA in the Bacillus belyss genome... srfA Replace with P xylA At that time, the nucleic acid fragment to be integrated contains P xylA Genes and resistance genes, through homologous recombination mediated by upstream and downstream homologous arms, enable P xylA Genes and resistance genes replace P in the host bacterial genome srfA Gene.

[0101] Specifically, when the genetic modification is the knockout or inactivation of the ptsG gene or the ccpA gene, the nucleic acid fragment to be integrated contains a resistance gene. Through homologous recombination mediated by upstream and downstream homologous arms, the resistance gene replaces all or at least a portion of the ptsG gene or ccpA gene that can maintain the normal function of the target gene, thereby causing the ptsG gene or ccpA gene to be missing or lose its normal biological function.

[0102] Specifically, when the genetic modification is to overexpress the xylAB gene, the nucleic acid fragment to be integrated contains a promoter for enhancing xylAB gene expression, the xylAB gene, and a resistance gene. Through homologous recombination mediated by upstream and downstream homologous arms, the original xylAB gene in the host bacterial genome is replaced by a nucleic acid fragment containing the promoter, xylAB gene, and resistance gene, thereby allowing the recombinant xylAB gene to be regulated by the promoter, thus increasing the expression level of the target gene.

[0103] More specifically, the promoter for enhancing xylAB gene expression is P43, and the nucleotide sequence of promoter P43 includes the sequence shown in SEQ ID NO.24.

[0104] GTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTCACCGCCCATTTCTAAAAATGTAAAATAAATGTAAGAATTTTCAGCCA (SEQ ID NO. 24).

[0105] More specifically, the resistance gene is an erythromycin resistance gene.

[0106] In this application, the upstream homologous arm and the downstream homologous arm can be nucleic acid sequences that are identical to all or part of the nucleotide sequences of the upstream and downstream regions of the target genomic site, or have sufficient sequence homology to undergo homologous recombination. The homologous recombination is preferably a double-crossover homologous recombination in which recombination occurs through the upstream and downstream homologous arms respectively.

[0107] Preferably, it also includes eliminating resistance genes.

[0108] Preferably, the process further includes an acclimatization treatment, which comprises the following steps: based on the genetically modified strain, continuous subculturing is carried out for 10-15 rounds using a mixed sugar containing glucose and xylose as the carbon source, and the single colony with the highest surfactant production is selected in each round for the next round of acclimatization. More preferably, the mixed sugar containing glucose and xylose is a straw enzymatic hydrolysate.

[0109] The present invention will be further illustrated by the following examples, but these examples do not limit the scope of the invention.

[0110] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. All reagents or instruments whose manufacturers are not specified are conventional products that can be purchased commercially. In addition to the specific methods, equipment, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, equipment, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention may be used to implement this invention.

[0111] The materials used in the following embodiments are as follows:

[0112] Bacillus subtilis ATCC 6051a is the type strain of the American Type Culture Collection (ATCC), and 6051a is its collection number. It can be purchased from the American Type Culture Collection (ATCC).

[0113] Bacillus belye Bv251 was isolated and screened by our company in previous experiments and is deposited at the China Center for Type Culture Collection (Wuhan University) with accession number CCTCC M 20251689.

[0114] The DNA polymerase used in the PCR reaction was purchased from Nanjing Novizan Biotechnology Co., Ltd., product name 2×PhantaFlash Master Mix (Dye Plus). Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0115] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride. Add 20 g / L agar powder to prepare LB solid medium.

[0116] Straw sugar, model PM-60, purchased from Suzhou Rumi Biotechnology Co., Ltd.

[0117] Example 1: Isolation, screening and identification of Bacillus

[0118] 1.1 Isolation of Bacillus

[0119] 1) On February 5, 2025, a soil sample of about 2-3 g was taken from the roots of the lush vegetation in the green belt of Zhengbo Road, Fengxian District, Shanghai, at a depth of 5-10 cm, and sealed in a sterile 5 mL centrifuge tube.

[0120] 2) Take 1 g of soil sample and add 10 mL of sterile water, mix thoroughly, and allow to stand for separation. Take the supernatant and serially dilute to a concentration of 10. -1 ~10 -5 Soil leachate was heated in an 80°C metal bath for 20 minutes to kill vegetative cells and enrich dormant spores.

[0121] After cooling for 30 minutes, 10 samples were taken sequentially. -3 ~10 -5 100 μL of soil leachate was spread onto LB solid agar plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar powder, pH 7.0, sterilized at 121℃ for 20 min), and incubated at 37℃ for 24 h. Single colonies of Bacillus were picked up with a sterile pipette tip and streaked onto LB solid agar plates. After incubation at 37℃ for 24 h, the plates were stored at 4℃.

[0122] 1.2 Screening of Bacillus subtilis

[0123] 1) Initial screening in test tubes

[0124] On LB solid plates, pick single colonies with typical Bacillus colony morphology characteristics (nearly round, opaque, milky white or grayish white, with biofilm) and inoculate them into test tubes containing 3 mL of LB liquid medium. Incubate at 37°C and 200 rpm for 36 h.

[0125] After cultivation, 1 mL of fermentation broth was taken, centrifuged at 12000 rpm for 3 min, filtered through a 0.22 μm filter, and analyzed by high performance liquid chromatography to detect the content of surfactant in the fermentation broth.

[0126] The conditions for high-performance liquid chromatography (HPLC) analysis of surfactants were as follows: Agilent ZORBAX EclipseXDB-C18 column, column temperature 35℃, mobile phase of trifluoroacetic acid, methanol, and water in a ratio of 1:900:100, flow rate 1 mL / min, injection volume 10 μL, and detection wavelength 214 nm. Surfactant standards (brand: Adamas, original code: 112801A, purchased from Shanghai Titan Technology Co., Ltd., exploration code: 015138967) were also used.

[0127] HPLC analysis results are as follows Figure 2 As shown, the LC-MS analysis results are as follows: Figure 3 As shown. Figure 2 In the study, the retention time of surfactants with different configurations ranged from 7 to 35 minutes. Figure 3In the given equations, m / z values ​​of 994, 1008, 1022, 1036, and 1050 correspond to C12-surfactin, C13-surfactin, C14-surfactin, C15-surfactin, and C16-surfactin, respectively; and m / z values ​​of 1016, 1030, 1044, 1058, and 1072 correspond to the monosodium salt forms of C12-surfactin, C13-surfactin, C14-surfactin, C15-surfactin, and C16-surfactin ([M+Na)). + ).

[0128] Strains with surfactant content above 300 mg / L were subjected to shake-flask fermentation for secondary screening. In the initial screening using test tubes, *Bacillus belyssiensis* Bv251 showed a surfactant yield of 0.6 g / L.

[0129] 2) Shaking flask and re-sieving

[0130] The shake-flask rescreening medium consisted of: 50 g / L glucose, 20 g / L ammonium sulfate, 10 g / L corn steep liquor, 0.82 g / L potassium dihydrogen phosphate, and 2.49 g / L disodium hydrogen phosphate. The medium was streaked onto LB agar plates using an inoculation loop and incubated at 37°C for 16 h. A single colony of *Bacillus belye* Bv251 from an LB agar plate was picked and inoculated into a test tube containing 3 mL of LB medium. The culture was incubated overnight at 37°C and 200 rpm for 16 h to obtain the activated seed culture. 500 μL of the seed culture was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of the shake-flask rescreening medium and incubated at 37°C and 200 rpm for 72 h. After fermentation, 1 mL of the fermentation broth was centrifuged at 12000 rpm for 3 min, filtered through a 0.22 μm filter, diluted 20-fold with methanol, and analyzed by high-performance liquid chromatography (HPLC) to determine the surfactant content in the fermentation broth. Strains with a surfactant content of 1.5 g / L or higher were preserved.

[0131] The surfactant yield of Bacillus belye Bv251 was 2.6 g / L during shake-flask re-screening.

[0132] 1.3 Identification of Bacillus belyssus Bv251

[0133] 1) Colony morphology observation: After inoculating the isolated strains into LB liquid medium and activating for 24 h, the bacterial suspension was serially diluted to an appropriate concentration and plated onto LB solid agar plates. The plates were incubated at 37°C for 24 h, and colony morphology was observed. *Bacillus belyssiensis* Bv251 colonies exhibited typical *Bacillus belyssiensis* morphology, characterized by round, smooth, opaque, milky-white, viscous colonies with distinct folds and protrusions in the center, and a moist, viscous texture. Colony morphology is as follows: Figure 1 As shown, the bacteria, after Gram staining, appear blue-purple under an optical microscope, exhibiting the staining color of Gram-positive bacteria, and their morphology is rod-shaped.

[0134] 2) Molecular biological identification: The obtained *Bacillus belyssiensis* Bv251 was subjected to 16S rDNA sequence analysis. Using Bv251 colonies as DNA templates, PCR amplification was performed using universal primers 27F and 1492R, the primer sequences of which are shown in SEQ ID NO: 16-17. The DNA products obtained from PCR amplification were sequenced by Shanghai Sangon Biotech, and the sequencing results are shown in SEQ ID NO: 18. After NCBI BLAST alignment, the 16S rDNA sequence showed 99.93% homology with *Bacillus belyssiensis*.

[0135] Because Bacillus species are closely related, bacterial classification using 16S rDNA typically yields low resolution. Therefore, sequencing of the gyrB gene is necessary for accurate classification and identification. PCR amplification was performed using gyrBF and gyrBR primers, the primer sequences of which are shown in SEQ ID NO:19-20. The DNA products obtained from PCR amplification were sequenced by Shanghai Sangon Biotech, and the sequencing results are shown in SEQ ID NO:21. NCBI BLAST alignment showed that the gyrB gene sequence had 99.96% homology with Bacillus belyssus.

[0136] Based on its morphological characteristics and sequencing comparison results, the selected strain can be identified as Bacillus belyssus (B. belyssus). Bacillus velezensis ).

[0137] The above-mentioned Bacillus belye Bv251 was deposited at the China Center for Type Culture Collection, and the proposed classification name is Bacillus belye ( Bacillus velezensis ).

[0138] Example 2: Surfactant shake-flask fermentation

[0139] The fermentation medium consisted of: 60 g / L glucose, 20 g / L ammonium sulfate, 10 g / L corn steep liquor, 0.82 g / L potassium dihydrogen phosphate, 2.49 g / L disodium hydrogen phosphate, 0.1 g / L manganese chloride, 0.1 g / L calcium chloride, 0.2 g / L magnesium sulfate, and 0.2 g / L ferrous sulfate.

[0140] Bacillus belye Bv251, stored at -80℃, was streaked onto LB agar plates and incubated at 37℃ for 16 h. A single colony of Bacillus belye Bv251 from an LB agar plate was picked and inoculated into a test tube containing 3 mL of LB medium. The culture was incubated overnight at 37℃ and 200 rpm for 16 h to obtain activated seed culture. 500 μL of the seed culture was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of the above fermentation medium and incubated at 37℃ and 200 rpm for 72 h. After fermentation, 1 mL of fermentation broth was centrifuged at 12000 rpm for 3 min, filtered through a 0.22 μm filter, diluted 20-fold with methanol, and analyzed by high-performance liquid chromatography (HPLC) to determine the surfactant content in the fermentation broth. Three replicates were performed, and the average yield was calculated.

[0141] The surfactant yield was measured to be 3.2 g / L under the conditions described in Example 2.

[0142] Example 3: Surfactant shake-flask fermentation

[0143] The fermentation medium consisted of: 60 g / L glucose, 20 g / L tryptone, 10 g / L corn steep liquor, 0.82 g / L potassium dihydrogen phosphate, 2.49 g / L disodium hydrogen phosphate, 0.1 g / L manganese chloride, 0.1 g / L calcium chloride, 0.2 g / L magnesium sulfate, and 0.2 g / L ferrous sulfate. The remaining fermentation conditions were the same as in Example 2.

[0144] The surfactant yield was determined to be 4.8 g / L under the conditions described in Example 3. The HPLC analysis results of the product are as follows: Figure 4 As shown, the LC-MS analysis results are as follows: Figure 5 As shown. Figure 4 In this study, the retention time of surfactants ranged from 7 to 35 minutes, compared to... Figure 2 Consistent, Figure 5 In the middle, m / z and Figure 3 The consistency with the molecular weights of surfactants with different carbon chain lengths indicates that the product is a surfactant. Figure 4 Central main peak and Figure 2 The inconsistency is related to the isomerism of side chains and amino acids.

[0145] Example 4: Surfactant shake-flask fermentation

[0146] The fermentation medium consisted of: 60 g / L glucose, 20 g / L tryptone, 10 g / L corn steep liquor, 0.82 g / L potassium dihydrogen phosphate, 2.49 g / L disodium hydrogen phosphate, 0.1 g / L manganese chloride, 0.1 g / L calcium chloride, 0.2 g / L magnesium sulfate, 0.2 g / L ferrous sulfate, and 12 g / L leucine. The remaining fermentation conditions were the same as in Example 2.

[0147] The surfactant yield was determined to be 10.4 g / L under the conditions described in Example 4. The HPLC analysis of the product is as follows: Figure 6 As shown, the LC-MS analysis results are as follows: Figure 7 As shown. Figure 6 In this study, the retention time of surfactants ranged from 7 to 35 minutes, compared to... Figure 2 Consistent, Figure 7 In the middle, m / z and Figure 3 The consistency with the molecular weights of surfactants with different carbon chain lengths indicates that the product is a surfactant. Figure 6 Central main peak and Figure 2 The inconsistency is related to the isomerism of side chains and amino acids. (Comparison) Figure 6 and Figure 4 This indicates that the addition of leucine to the fermentation medium not only led to increased yield but also reduced the proportion of C14-surfactin and increased the proportion of C15-surfactin.

[0148] Example 5: Surfactant-fed fermentation

[0149] The initial culture medium consisted of: 20 g / L glucose, 20 g / L tryptone, 20 g / L corn steep liquor, 4.1 g / L potassium dihydrogen phosphate, 12.5 g / L disodium hydrogen phosphate, 1 g / L magnesium sulfate, 0.4 g / L ferrous sulfate, and 2‰ (v / v) polyether defoamer (Dow DOWFAX DF-103 defoamer).

[0150] The feed medium consisted of 800 g / L glucose and 150 g / L tryptone.

[0151] Bacillus belye Bv251 stored at -80℃ was streaked onto LB agar plates and incubated at 37℃ for 16 h. A single colony of Bacillus belye Bv251 from one loopful of LB agar plate was picked and inoculated into a test tube containing 3 mL of LB medium. The culture was then incubated at 37℃ and 200 rpm for 9 h to obtain the activated primary seed culture.

[0152] Take 500 μL of primary seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 100 mL of the above fermentation medium. Incubate at 37℃ and 200 rpm for 9 h to obtain secondary seed culture.

[0153] 100 mL of the secondary seed culture was inoculated into a 5 L bioreactor containing 2 L of initial culture medium. The initial fermentation speed was 200 rpm and the aeration rate was 4 L / min. After 4 hours of incubation, the speed was increased to 500 rpm and the aeration rate was 6 L / min, while simultaneously feeding culture medium was started for 36 hours. Dissolved oxygen was maintained above 30% during fermentation, and the pH was maintained at 7.0 using sodium hydroxide.

[0154] The surfactant yield was determined to be 17.3 g / L under the conditions described in Example 5. The HPLC analysis of the product is as follows: Figure 8 As shown, the LC-MS analysis results are as follows: Figure 9 As shown. Figure 8 In this study, the retention time of surfactants ranged from 7 to 35 minutes, compared to... Figure 2 Consistent, Figure 9 In the middle, m / z and Figure 3 The consistency with the molecular weights of surfactants with different carbon chain lengths indicates that the product is a surfactant. Figure 8 Central main peak and Figure 2 The inconsistency is related to the isomerism of side chains and amino acids.

[0155] Example 6: Surfactant-fed fermentation

[0156] The initial culture medium consisted of: 30 g / L glucose, 20 g / L tryptone, 20 g / L corn steep liquor, 4.1 g / L potassium dihydrogen phosphate, 12.5 g / L disodium hydrogen phosphate, 1 g / L magnesium sulfate, 0.4 g / L ferrous sulfate, and 2‰ defoamer.

[0157] The supplemental culture medium consisted of 800 g / L glucose, 150 g / L tryptone, and 10 g / L leucine.

[0158] Other fermentation conditions are the same as in Example 5.

[0159] The surfactant yield was determined to be 22.3 g / L under the conditions described in Example 6. The HPLC analysis of the product is as follows: Figure 10 As shown, the LC-MS analysis results are as follows: Figure 11 As shown. Figure 10 In this study, the retention time of surfactants ranged from 7 to 35 minutes, compared to... Figure 2 Consistent, Figure 11 In the middle, m / z and Figure 3 The consistency with the molecular weights of surfactants with different carbon chain lengths indicates that the product is a surfactant. Figure 10 Central main peak and Figure 2 The inconsistency is related to the isomerism of side chains and amino acids. (Comparison) Figure 10 and Figure 8 This indicates that the addition of leucine to the fermentation medium not only led to increased yield but also reduced the proportion of C14-surfactin and increased the proportion of C15-surfactin.

[0160] Example 7: Construction of a high-surfactant-producing Bacillus belye

[0161] 7.1 Constructing the BsPxylA-srfAA expression frame

[0162] The BsPxylA-srfAA expression cassette comprises four DNA fragments: the upstream homologous region (BvUHR fragment) upstream of the srfAA promoter region from Bacillus belyss Bv251, the erythromycin resistance gene expression cassette (BvErmC fragment) with lox66 and lox71 sites at both ends, the PxylA promoter fragment from Bacillus subtilis (BsPxylA fragment), and a partial sequence of srfAA from Bacillus belyss Bv251 as the downstream homologous region (BvDHR fragment).

[0163] The BvUHR fragment was obtained by PCR amplification using the Bv251 genome as a template and primers BvUHRF (SEQ ID NO: 5) and BvUHRR (SEQ ID NO: 6).

[0164] BvUHRF: CCGTATGAACACAAATATAATCAACACCGAG (SEQ ID NO: 5).

[0165] BvUHRR: TGCTTCTTTTTAGGATCCCTGCAGTCAAAAAGATTCCTTTATTGCAGTTT (SEQ ID NO: 6).

[0166] The BvErmC fragment was obtained by PCR amplification using the synthesized resistance gene ErmC as a template and primers BsErmCF (SEQ ID NO: 7) and BsErmCR (SEQ ID NO: 8).

[0167] BsErmCF: AAACTGCAATAAAGGAATCTTTTTGACTGCAGGGATCCTAAAAAGAAGCA (SEQ ID NO: 7).

[0168] BsErmCR: TTTAAAGATTAAACAAATGGAGTGGATGAAGAATTCGGTACCCCCGGGCA (SEQ ID NO: 8).

[0169] The BsPxylA fragment was obtained by PCR amplification using the Bacillus subtilis ATCC 6051a genome as a DNA template and primers BsxylF (SEQ ID NO: 9) and BsxylR (SEQ ID NO: 10).

[0170] BsxylF: CGGGGGTACCGAATTCTTCATCCACTCCATTTGTTTAATCTTTAAA (SEQ ID NO: 9).

[0171] BsxylR: GGATAAAAAGTTATTTCCATGTGATTTCCCCCTTAAAAATAAATTCATTCAAA (SEQ ID NO: 10).

[0172] The BvDHR fragment was obtained by PCR amplification using the ATCC 6051a genome as a template and primers BvDHRF (SEQ ID NO: 11) and BvDHRR (SEQ ID NO: 12).

[0173] BvDHRF: ATTTATTTTTAAGGGGGAAATCACATGGAAATAACTTTTTATCCTTTAACAAATGCTCA (SEQ ID NO: 11).

[0174] BvDHRR: TGACAAGCAGGTTATACGGATACTTTT (SEQ ID NO: 12).

[0175] The PCR reaction system is shown in Table 1, and the PCR procedure and process are shown in Table 2.

[0176] Table 1 PCR reaction system

[0177]

[0178] Table 2 PCR reaction procedure

[0179]

[0180] Note: Repeat the denaturation, annealing, and extension (72℃, 25 s) steps 30 times.

[0181] After the PCR-obtained system was verified by agarose gel electrophoresis, it was purified using the SanPrep column PCR product purification kit (Sangon Biotech) to obtain purified DNA fragments.

[0182] The four fragments obtained in the above steps were fused using fusion PCR. The fusion PCR method is as follows:

[0183] Reaction system: 1 μL of upstream amplification primer BvUHRF, 1 μL of downstream amplification primer BvDHRR, 0.5 μL each of purified DNA solutions containing the above 4 fragments, 10 μL of 2×Phanta Flash Master Mix (Dye Plus), and 5.5 μL of ddH2O.

[0184] The reaction system was subjected to fusion PCR, with the annealing temperature set to 60℃, the extension time set to 40s, and other parameters set according to Table 2.

[0185] After the fusion PCR product was verified to be correct by agarose gel electrophoresis, it was purified using the SanPrep column PCR product purification kit (Sangon Biotech). The obtained DNA fragment was the fusion fragment of BvUHR-BvErmC-BsPxylA-BvDHR, namely the BsPxylA-srfAA expression cassette.

[0186] 7.2 Transformation of BsPxylA-srfAA expression cassette into Bacillus belyssaeus Bv251

[0187] Transformation of Bacillus belyceta var. breviosis Bv251 uses electroporation to perforate the cell membrane, allowing the uptake of exogenous DNA fragments. These fragments then undergo double crossover via endogenous recombinases, with the UHR and DHR regions as homologous regions. The fragment located between the UHR and DHR regions, ErmC-PxylA, integrates into the genome, replacing the srfAA promoter region. Because it contains a resistance gene, the recombinant strain exhibits erythromycin resistance and can be screened using erythromycin-resistant plates.

[0188] The entire electroconvulsive therapy process must be carried out in a dark room, and the steps are as follows:

[0189] 1) Preparation of electroporation culture medium solution:

[0190] Hypertonic culture medium: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 90 g / L sorbitol.

[0191] Electroporation buffer: 90 g / L sorbitol, 92.5 g / L mannitol, 10% glycerol.

[0192] Resuscitation medium: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 90 g / L sorbitol, 70 g / L mannitol.

[0193] 2) Preparation of electrocompetent cells of Bacillus belesi

[0194] A single colony of Bacillus belye was cultured in LB liquid medium for 4 hours to obtain a seed culture. The seed culture was inoculated at 5% onto 50 mL of hypertonic medium and cultured until OD=1.0. The culture was then placed in ice water for 15 min, centrifuged at 4000 rpm for 10 min, and the bacterial cells were collected. The bacterial cells were resuspended in 30 mL of electroporation buffer, centrifuged at 4000 rpm for 10 min, and the supernatant was collected. The washing was repeated 3 times. Finally, the bacterial cells were resuspended in 1 mL of electroporation buffer. Each sample was aliquoted into 100 μL and stored at -80℃.

[0195] 3) Electrocution

[0196] Add 100 ng of the linear DNA fragment of the PxylA-srfAA expression cassette obtained in step 1 to 100 μL of *Bacillus belyssae* competent cells. Incubate on ice for 10 min, then transfer to a 1 mm electroporation cuvette and set the electroporation conditions to 25 μF, 200 Ω, and 1.8 kV, repeating the electroporation twice. Quickly add 2 mL of resuscitation medium and incubate at 37°C on a shaker at 200 rpm for 2–4 h. After centrifugation at 4000 rpm for 10 min, discard the supernatant, resuspend the cells in 100 μL of physiological saline, spread on LB agar plates containing 20 μg / mL erythromycin, and incubate overnight at 37°C to obtain transformants.

[0197] Transformants were identified by colony PCR. Positive transformants were colonies in which the PxylA-srfAA expression cassette was integrated into the genome of *Bacillus belyssiensis* Bv251. Single colonies of transformants were selected as templates, and the integrated fragment was amplified using 2×Phanta Master Mix. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Transformants whose sequencing results were verified to be correct were named *Bacillus belyssiensis* 251BsxylEm.

[0198] 4) Eliminate the resistance gene ErmC

[0199] Elimination was performed using the Cre-LoxP recombinase system. The ErmC fragment contains lox66 and lox71 sites, which the Cre enzyme can specifically recognize and delete the resistance gene in the middle. This step was achieved by transforming the pMK4-Cre plasmid, as detailed in the reference (Ji M et al. De novo synthesis of 2'-fucosyllactose in engineered Bacillus subtilis ATCC 6051a[J]. Process biochemistry, 2022.DOI:10.1016 / j.procbio.2022.06.007).

[0200] Prepare Bacillus belyss 251BsxylEm competent cells as described in step 2).

[0201] 100 ng of pMK4-Cre plasmid was added to 200 μL of Bacillus bereaves competent cells 251BsxylEm.

[0202] The mixture of competent cells and plasmids was incubated at 37°C on a shaker at 200 rpm for 6 h. After incubation, the cells were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in 100 μL of physiological saline. The cells were then spread on LB agar plates containing 25 μg / mL chloramphenicol and incubated at 37°C for 36 h to obtain transformants.

[0203] Transformants were identified using the photocopy plate method. Single colonies that grew on LB plates but not on photocopy plates containing 10 μg / mL erythromycin were selected and sequenced for verification. The positive transformants whose original promoter PsrfA of srfAA had been replaced by BsPxylA and whose erythromycin resistance gene ErmC had been eliminated were named B. berylloides 251Bsxylcre.

[0204] Single colonies of 251Bsxylcre were picked and inoculated into antibiotic-free LB tubes and cultured at 45°C and 200 rpm for 16 h. 30 μL of the bacterial culture was transferred to a new antibiotic-free LB tube and cultured at 45°C and 200 rpm for 16 h. This transfer and culture were repeated twice. 30 μL of the bacterial culture was streaked onto antibiotic-free LB plates, and the recombinant strains with plasmid loss were identified using the replica plate method. Single colonies that grew on LB plates but not on replica plates containing 25 μg / mL chloramphenicol were named *Bacillus belyssiensis* 251Bsxyl and preserved.

[0205] Example 8: Shake-flask fermentation of Bacillus belye Bv251

[0206] The composition of the straw sugar fermentation medium is as follows: straw sugar final concentration 50 g / L, tryptone 20 g / L, corn steep liquor 10 g / L, potassium dihydrogen phosphate 1 g / L, and disodium hydrogen phosphate 3 g / L.

[0207] The glucose fermentation medium consisted of: 50 g / L glucose, 20 g / L tryptone, 10 g / L corn steep liquor, 1 g / L potassium dihydrogen phosphate, and 3 g / L disodium hydrogen phosphate.

[0208] Bacillus belye Bv251, stored at -80℃, was streaked onto LB agar plates and incubated at 37℃ for 16 h. A single colony of Bacillus belye Bv251 from an LB agar plate was picked and inoculated into a test tube containing 3 mL of LB medium. The culture was incubated overnight at 37℃ and 200 rpm for 16 h to obtain activated seed culture. 500 μL of the seed culture was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of the above fermentation medium and incubated at 37℃ and 200 rpm for 72 h. After fermentation, 1 mL of fermentation broth was centrifuged at 12000 rpm for 3 min, filtered through a 0.22 μm filter, diluted 20-fold with methanol, and analyzed by high-performance liquid chromatography (HPLC) to determine the surfactant content in the fermentation broth. Three replicates were performed, and the average yield was calculated.

[0209] The surfactant yield of Bv251 was determined to be 2.9 g / L in straw sugar fermentation medium and 3.7 g / L in glucose fermentation medium under the conditions described in Example 8. Figure 12 As shown.

[0210] Comparative Example 1: Shake-flask fermentation of Bacillus belye model strain FZB42

[0211] The bacterial strain in Example 8 was changed to Bacillus belyssus model strain FZB42, while other conditions remained unchanged. The surfactant yield of FZB42 in straw sugar fermentation medium was 48.6 mg / L, and the surfactant yield in glucose fermentation medium was 179.3 mg / L. Figure 12 As shown.

[0212] In combination with Example 8 and Comparative Example 1, Bacillus vesicles Bv251 can more efficiently utilize straw sugar to produce surfactants compared to the Bacillus vesicles model strain FZB42.

[0213] Example 9: Shake-flask fermentation of Bacillus belye, a high-yield surfactant-producing bacterium.

[0214] The composition of the straw sugar fermentation medium is as follows: straw sugar final concentration 50 g / L, tryptone 20 g / L, corn steep liquor 10 g / L, potassium dihydrogen phosphate 1 g / L, and disodium hydrogen phosphate 3 g / L.

[0215] The glucose fermentation medium consisted of: 40 g / L glucose, 10 g / L xylose (added after 6 h of fermentation for induction), 20 g / L tryptone, 10 g / L corn steep liquor, 1 g / L potassium dihydrogen phosphate, and 3 g / L disodium hydrogen phosphate.

[0216] 1) Take Bacillus belye 251Bsxyl stored at -80℃, streak it on an LB agar plate, and incubate it at 37℃ for 16 h.

[0217] 2) Pick a single colony from a loop of LB agarose plate and inoculate it into a test tube containing 3 mL of LB medium. Incubate overnight at 37°C and 200 rpm for 16 h to obtain the activated seed culture.

[0218] 3) Take 500 μL of seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium. Incubate at 37℃ and 200 rpm for 72 h.

[0219] 4) After fermentation, take 1 mL of fermentation broth, centrifuge at 12000 rpm for 3 min, filter through a 0.22 μm filter, dilute 20 times with water, and perform high-performance liquid chromatography (HPLC) to detect the surfactant content in the fermentation broth. Perform three replicates and calculate the average yield.

[0220] The conditions for high-performance liquid chromatography (HPLC) analysis of surfactants were as follows: Agilent ZORBAX EclipseXDB-C18 column, column temperature 35℃, mobile phase of trifluoroacetic acid, methanol, and water in a ratio of 1:900:100, flow rate 1 mL / min, injection volume 10 μL, and detection wavelength 214 nm. Surfactant standards were purchased from Shanghai Titan Technology Co., Ltd., brand: Adamas, original code: 112801A, exploration code: 015138967. Standard curves were prepared with concentrations of 0 g / L, 0.5 g / L, 1 g / L, and 5 g / L. A standard curve was then plotted, y = 2.1843x, R0. 2 =0.9999.

[0221] Under the conditions described in Example 9, the surfactant yield of 251Bsxyl in the straw sugar fermentation medium was 6.3 g / L, and the surfactant yield in the glucose fermentation medium was 7.9 g / L. Figure 12 As shown.

[0222] Combining Examples 8 and 9, the present invention, Bacillus belye, can produce surfactants using straw sugars, and its surfactant production is significantly increased after integrating the BsPxylA-srfAA expression cassette.

[0223] Example 10: Carbon metabolism engineering of Bacillus belyeis using glucose and xylose

[0224] Based on Bacillus belyss 251Bsxyl, metabolic engineering was gradually introduced to remove the carbon repression effect of glucose on xylose metabolism, thereby achieving efficient co-utilization of glucose and xylose.

[0225] 10.1 Knock out ptsG

[0226] The ΔptsG expression cassette was constructed via fusion PCR and includes the upstream and downstream homologous arms of ptsG derived from Bacillus belyssus Bv251, as well as the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends. The nucleotide sequence of the fusion fragment is shown in SEQ ID NO: 13.

[0227]

[0228] The linear fragment of the ΔptsG expression cassette was transformed into *Bacillus belyssiensis* 251Bsxyl, as described in Example 7. Transformants were identified by colony PCR; positive transformants were colonies with the ptsG coding region deleted. Transformants whose sequencing results were verified were named *Bacillus belyssiensis* 251BsxylPE.

[0229] The resistance genes ErmC and pMK4-Cre plasmid in 251BsxylPE were eliminated as described in Example 7. The resulting positive transformant was a strain lacking ptsG and without the resistance gene, named Bacillus bereaves 251BsxylP.

[0230] 10.2 Knockout of CCPA

[0231] The ΔccpA expression cassette was constructed via fusion PCR and includes the upstream and downstream homologous arms of ccpA derived from Bacillus belyssus Bv251, as well as the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends. The nucleotide sequence of the fusion fragment is shown in SEQ ID NO: 14.

[0232]

[0233] The linear fragment of the ΔccpA expression cassette was transformed into *Bacillus belyssiensis* 251BsxylP, as described in Example 7. Transformants were identified by colony PCR; positive transformants were colonies with the ccpA coding region deleted. Transformants whose sequencing results were verified were named *Bacillus belyssiensis* 251BsxylPCE.

[0234] The resistance genes ErmC and pMK4-Cre plasmid in 251BsxylPCE were eliminated as described in Example 7. The resulting positive transformant, a strain with double deletion of ptsG and ccpA and no resistance genes, was named Bacillus bereaves 251BsxylPC.

[0235] 10.3 Overexpression of xylAB

[0236] The P43-xylAB expression cassette was constructed via fusion PCR and includes the upstream homologous arm of the xylA promoter region from Bacillus belyssus Bv251, the xylAB coding sequence, and the downstream homologous arm; the constitutive strong promoter P43 fragment from Bacillus subtilis; and the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends. The nucleotide sequence of the fusion fragment is shown in SEQ ID NO: 15.

[0237]

[0238] The linear fragment of the P43-xylAB expression cassette was transformed into *Bacillus belyssiensis* 251BsxylPC, as described in Example 7. Transformants were identified by colony PCR; positive transformants were colonies in which the P43-xylAB expression cassette was integrated into the genome. Transformants whose sequencing results were verified were named *Bacillus belyssiensis* 251BsxylPCXE.

[0239] The resistance genes ErmC and pMK4-Cre plasmid in 251BsxylPCXE were eliminated as described in Example 7. The obtained positive transformant was a strain with double deletion of ptsG and ccpA and overexpression of P43-xylAB, and without resistance genes, named Bacillus bereaves 251BsxylPCX.

[0240] Example 11: Carbon metabolism-optimized Bacillus belye 251BsxylPCX fermented in shake flasks using glucoxatin mixtures

[0241] The fermentation medium consisted of: a mixture of glucose and xylose with a final sugar concentration of 50 g / L (glucose:xylose = 2:1), ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, disodium hydrogen phosphate 3 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 0.1 g / L, and manganese chloride 0.05 g / L.

[0242] 1) Take Bacillus belye 251BsxylPCX stored at -80℃, streak it on an LB agar plate, and incubate it at 37℃ for 16 h.

[0243] 2) Pick a single colony from a loop of LB agarose plate and inoculate it into a test tube containing 3 mL of LB medium. Incubate overnight at 37°C and 200 rpm for 16 h to obtain the activated seed culture.

[0244] 3) Take 500 μL of seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium. Incubate at 37℃ and 200 rpm for 48 h.

[0245] 4) Samples were taken every 6 hours during fermentation to detect the concentrations of glucose and xylose in the culture medium and the yield of surfactant. After fermentation, 1 mL of fermentation broth was centrifuged at 12,000 rpm for 3 min, filtered through a 0.22 μm filter, and analyzed by high-performance liquid chromatography (HPLC) to detect the surfactant content and residual sugar concentration in the fermentation broth. Three replicates were performed, and the average yield was calculated.

[0246] The conditions for high-performance liquid chromatography analysis and determination of surfactants are as described in Example 9.

[0247] Under the conditions described in Example 10, 251BsxylPCX showed simultaneous depletion of glucose and xylose, with no xylose accumulation, and a surfactant yield of 7.45 g / L. Figure 13 As shown.

[0248] Comparative Example 2: Shake-flask fermentation of Bacillus belye without carbon metabolism optimization using xylan mixed sugars

[0249] The bacterial strain in Example 11 was changed to Bacillus belyssus 251Bsxyl, while other conditions remained unchanged.

[0250] In a glucose-xyl mixed sugar fermentation medium, 251Bsxyl was preferentially consumed by glucose, while xylose began to be significantly utilized after 24 hours, with a surfactant yield of 6.7 g / L. Figure 13 As shown.

[0251] Combining Example 11 and Comparative Example 2, the Bacillus berleis 251BsxylPCX modified by carbon metabolism engineering can simultaneously and efficiently utilize glucose and xylose, with a consumption rate significantly faster than the unmodified strain, no xylose accumulation, and a slight increase in surfactant yield and production efficiency.

[0252] Example 12: Tolerance Acclimation of Antibacterial Substances in Straw Enzymatic Hydrolysate

[0253] Using straw enzymatic hydrolysate as a carbon source, Bacillus belye 251BsxylPCX was continuously passaged and cultured. Single colonies with higher yields were isolated and the experiment was repeated 15 times until the yield no longer showed a significant increase.

[0254] The acclimatization culture medium consisted of: straw enzymatic hydrolysate with a final concentration of 15 g / L (total reducing sugar), ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, disodium hydrogen phosphate 3 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 0.1 g / L, and manganese chloride 0.05 g / L.

[0255] The domestication steps are as follows:

[0256] 1) Take Bacillus belye 251BsxylPCX stored at -80℃, streak it on an LB agar plate, and incubate it at 37℃ for 16 h.

[0257] 2) Pick a single colony from a loop of LB agarose plate and inoculate it into a test tube containing 3 mL of LB medium. Incubate overnight at 37°C and 200 rpm for 16 h to obtain the activated seed culture.

[0258] 3) Take 500 μL of seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of acclimatization medium. Incubate at 37℃ and 200 rpm for 48 h.

[0259] 4) After fermentation, 1 mL of fermentation broth was taken, centrifuged at 12000 rpm for 3 min, filtered through a 0.22 μm filter, and analyzed by high-performance liquid chromatography (HPLC) to determine the surfactant content in the fermentation broth. OD was also measured simultaneously. 600 The single colony with the highest yield was selected as the seed for the next round of domestication.

[0260] 5) Repeat steps 2)-4) for 15 consecutive rounds of acclimatization. Set up three parallels for each round and record the OD (Original Displacement) for each round. 600 And the production of surfactants.

[0261] The results of each round of domestication are shown in Table 3.

[0262] Table 3. Results of acclimatization with Bacillus belysin 251BsxylPCX straw enzymatic hydrolysate

[0263]

[0264] The production of surfactants from straw enzymatic hydrolysate by Bacillus belyss 251BsxylPCX showed a relatively obvious increasing trend in the first 10 rounds of domestication, except for significant deviations in yield levels in the 8th and 10th rounds due to contamination / growth limitation. The yield stabilized in the 11th to 15th rounds, reaching a level comparable to glucose production.

[0265] The highest-yielding single colony in the 15th round (yield 2.16 g / L, OD) was... 600 14.31) was named Bacillus belyss 251BsxylPCX-15.

[0266] Example 13: Fed-feed fermentation of genetically engineered bacteria for producing surfactants from straw sugar

[0267] The initial culture medium consisted of: 20.0 g / L straw sugar, 20.0 g / L tryptone, 20.0 g / L corn steep liquor, 3.0 g / L potassium dihydrogen phosphate, 10.0 g / L disodium hydrogen phosphate, 1.0 g / L magnesium sulfate, 0.5 g / L ferrous sulfate, and 2‰ (v / v) polyether defoamer (Dow DOWFAX DF-103 defoamer).

[0268] The supplemental culture medium consisted of 800 g / L straw sugar (total reducing sugar), 150 g / L tryptone, and 50 g / L ammonium sulfate.

[0269] The supplementary fermentation steps are as follows:

[0270] 1) Take Bacillus belye 251BsxylPCX-15 stored at -80℃, streak it on LB solid plates, and incubate it in a 37℃ incubator for 16 h.

[0271] 2) Pick a single colony from a loop of LB agarose plate and inoculate it into a test tube containing 3 mL of LB medium. Incubate at 37°C and 200 rpm for 9 h to obtain the activated primary seed culture.

[0272] 3) Take 2 mL of primary seed culture and inoculate it into a 1 L Erlenmeyer flask containing 200 mL of fermentation medium. Incubate at 37℃ and 200 rpm for 9 h to obtain secondary seed culture.

[0273] 4) Inoculate 100 mL of the secondary seed culture into a 5 L bioreactor containing 2 L of initial culture medium. The initial stirring speed is 200 rpm and the aeration rate is 4 L / min. Adjust the stirring speed and aeration rate according to the dissolved oxygen level. After about 4 hours of incubation, increase the stirring speed to 500 rpm and the aeration rate to 6 L / min, and start feeding the culture medium simultaneously.

[0274] During the feeding process, the total sugar concentration in the bioreactor reaction system was maintained at 1-10 g / L, dissolved oxygen was maintained above 30%, and pH was adjusted to 7.0 using sodium hydroxide. Fermentation was terminated when the production of surfactant ceased to increase within three consecutive sampling points.

[0275] Key parameters in the fermentation process, such as Figure 14 As shown.

[0276] The fermentation broth treatment and high-performance liquid chromatography analysis methods are as described in Example 9.

[0277] According to the measurements, in this Example 13, the surfactant yield of the genetically engineered bacterium 251BsxylPCX-15 was 29.5 g / L, and the fermentation period was 48 h.

[0278] Comparative Example 3: Feed-and-fed fermentation of undomesticated carbon metabolism-modified strain 251BsxylPCX

[0279] The bacterial strain in Example 13 was changed to Bacillus belyssus 251BsxylPCX, while other conditions remained unchanged.

[0280] In straw-based sugar-fed fermentation, 251BsxylPCX produced a surfactant yield of 21.35 g / L over a fermentation period of 48 h. Figure 15 As shown.

[0281] Compared with 251BsxylPCX-15 in Example 13, the yield of unacclimated 251BsxylPCX was significantly reduced, demonstrating that straw enzymatic hydrolysate acclimation treatment plays an important role in enhancing the surfactant synthesis ability of the strain in the straw sugar fermentation system.

[0282] Comparative Example 4: Fed-feed fermentation of starting strain Bacillus belye Bv251

[0283] The bacterial strain in Example 13 was changed to the starting strain Bacillus belyssae Bv251, while other conditions remained unchanged.

[0284] In straw-saccharide fed fermentation, Bv251 produced 16.33 g / L of surfactant, with a fermentation period of 48 h.

[0285] Compared with 251BsxylPCX-15 in Example 13, the starting strain had a lower yield, demonstrating that the combined strategy of PxylA promoter replacement, carbon metabolism engineering, and straw enzymatic hydrolysate domestication plays a key role in achieving high-yield surfactant production from straw sugar.

[0286] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit this application. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of this application. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in this invention should still be covered by the claims of this application.

Claims

1. A genetically engineered bacterium, wherein the originating bacterium is *Bacillus belyssae*, and the original promoter P of srfAA in the genome of the genetically engineered bacterium is... srfA Replaced with P xylA .

2. The genetically engineered bacteria as described in claim 1, characterized in that, The P xylA Derived from Bacillus subtilis, Bacillus belye, or Priestella megaterium; preferably, the P xylA Derived from Bacillus subtilis; more preferably, the P xylA The nucleotide sequence contains the sequence shown in SEQ ID NO:1, or a sequence that has at least 85% sequence identity with the sequence shown in SEQ ID NO:1 and has the same function.

3. The genetically engineered bacteria as described in claim 1, characterized in that, The preservation number of the Bacillus belyssus is CCTCC NO: M 20251689.

4. The genetically engineered bacteria as described in claim 1, characterized in that, The genome of the genetically engineered bacteria also contains one or more of the following genetic modifications: a) ptsG gene deletion or inactivation; b) Deletion or inactivation of the ccpA gene; c) xylAB gene overexpression.

5. A strain of Bacillus belye ( Bacillus velezensis The accession number is: CCTCC NO: M 20251689.

6. The use of the genetically engineered bacteria as described in any one of claims 1 to 4 or the Bacillus berleis as described in claim 5 in the preparation of surfactants.

7. A method for preparing a surfactant, comprising the following steps: inoculating the genetically engineered bacteria according to any one of claims 1 to 4 or the Bacillus berleis according to claim 5 into an initial fermentation medium for fermentation to obtain a surfactant; wherein the fermentation of the genetically engineered bacteria is carried out under xylose induction.

8. The preparation method according to claim 7, characterized in that, The initial fermentation medium contains a carbon source, a nitrogen source, and inorganic salts; Preferably, the carbon source is selected from glucose, xylose, or a mixture of sugars containing xylose; And / or, the nitrogen source is selected from one or more of ammonium sulfate, yeast extract, peptone, corn steep liquor, urea, ammonium chloride, sodium nitrate, and potassium nitrate; And / or, the inorganic salt is selected from Ca 2+ Fe 2+ Mn 2+ Mg 2+ It is a hydrochloride or sulfate, or a phosphate buffer system.

9. The preparation method according to claim 8, characterized in that, When the initial fermentation medium has glucose as its carbon source, xylose is added during fermentation to induce fermentation; preferably, the xylose is added 6 to 12 hours after the start of fermentation; and / or, the final concentration of the added xylose is 5 to 20 g / L. When the carbon source of the initial fermentation medium is xylose or a mixed sugar containing xylose, induction is performed using the xylose in the carbon source.

10. The preparation method according to claim 8, characterized in that, Based on the total volume of the fermentation medium, the total concentration of the carbon source is 10~80 g / L; And / or, based on the total volume of the fermentation medium, the total concentration of the nitrogen source is 5~30 g / L; And / or, based on the total volume of the fermentation medium, the total concentration of the inorganic salts is 0.01~20 g / L; And / or, the initial fermentation medium further comprises an antifoaming agent, which is selected from one or more of polyether antifoaming agents, vegetable oil antifoaming agents, and organosilicon antifoaming agents; preferably, the volume fraction of the antifoaming agent is 1 to 3‰ based on the total volume of the fermentation medium. And / or, the initial fermentation medium further contains amino acids, which are selected from one or more of leucine, isoleucine, glutamic acid, aspartic acid and valine; preferably, the total concentration of the amino acids is 8-15 g / L based on the total volume of the fermentation medium. And / or, the mixed sugar containing xylose is selected from straw sugar or straw hydrolysate.

11. The preparation method according to claim 7, characterized in that, It also includes fed-batch fermentation, which includes the following steps: adding fed-batch culture medium to the culture system; Preferably, the total reducing sugar concentration in the fed culture medium is 500-1000 g / L, the total nitrogen source concentration in the fed culture medium is 100-200 g / L, the feeding fermentation speed is 200-800 rpm, the aeration rate is 3-7 L / min, the dissolved oxygen is maintained above 20%, and the pH is maintained at 6.5-7.

5.

12. A method for constructing a genetically engineered bacterium, comprising the following steps: The original promoter P of srfAA in the Bacillus belysinus genome was obtained through homologous recombination. srfA Replace with P xylA ; Preferably, it further includes one or more of the following operations: a) Knockout or inactivation of the ptsG gene via homologous recombination; b) Knockout or inactivation of the ccpA gene via homologous recombination; c) Overexpression of the xylAB gene is achieved by integrating the P43-xylAB expression cassette, which contains the P43 promoter and the xylAB gene, into the genome; Preferably, the process further includes an acclimatization treatment, which includes the following steps: based on the genetically modified strain, the strain is continuously passaged for 10 to 15 rounds using a mixed sugar containing glucose and xylose as a carbon source, and the single colony with the highest surfactant production is selected in each round for the next round of acclimatization.

Images