Method for constructing bovine primary ovarian interstitial cell hypoxia model

Abstract

This invention provides a method for constructing a hypoxia model of bovine primary ovarian stromal cells, belonging to the field of cell model construction technology. This invention utilizes enzymatic digestion combined with tissue adhesion to obtain bovine ovarian stromal cells effectively. Immunofluorescence analysis shows positive Vimentin expression and no CK18 expression, consistent with the characteristics of ovarian stromal cells. Hypoxia responses show upregulation of HIF-1α, apoptosis gene BAX, autophagy gene LC3B, mitochondrial autophagy genes BNIP3 and NIX, and glycolysis-related genes PDK1 and GLUT1, while apoptosis gene BCL2 and autophagy gene p62 are significantly downregulated. Decreased mitochondrial membrane potential and increased ROS production indicate significant oxidative stress damage and metabolic reprogramming in bovine ovarian stromal cells, making this a reliable in vitro model for subsequent research on the mechanisms of hypoxia damage in bovine ovarian stromal cells and drug intervention.

Description

Technical Field

[0001] This invention relates to the field of cell model construction technology, specifically to a method for constructing a hypoxia model of bovine primary ovarian stromal cells. Background Technology

[0002] Ovarian interstitial cells are the main components of the ovary. Their main functions are to secrete androgens, provide the necessary source of support for the synthesis of steroid hormones in granulosa cells, maintain the integrity of follicular structure and promote the formation of follicular capillaries, provide nutrition for follicular growth and development, and affect follicular development and atresia.

[0003] Prolonged hypoxia exposure has a significant adverse effect on bovine reproductive performance. Under high-altitude hypoxic conditions, ovarian tissue, as a highly metabolically active organ, is extremely susceptible to hypoxic stress damage, manifesting as oxidative stress, mitochondrial dysfunction, apoptosis, and metabolic reprogramming in ovarian stromal cells. This disrupts the ovarian microenvironment homeostasis, leading to delayed follicle development, abnormal ovulation, and luteal insufficiency, ultimately causing reproductive problems such as reduced estrus rate, decreased conception rate, and prolonged reproductive cycles in cows. Furthermore, hypoxia can also regulate glycolytic metabolic reprogramming in ovarian stromal cells through the HIF-1α signaling pathway, affecting steroid hormone synthesis and follicle development. Therefore, establishing a stable and reliable bovine ovarian stromal cell hypoxia model is of great significance for in-depth analysis of the molecular mechanisms of high-altitude hypoxia-induced ovarian function damage, screening for anti-hypoxia drugs and functional feed additives, and improving the reproductive efficiency of cattle in high-altitude areas.

[0004] Currently, the construction of cellular hypoxia models mostly employs chemical induction methods such as cobalt chloride. For example, Chinese invention patent application number 2024104455372 uses simulated hypoxic conditions, the mechanism of which relies on the competitive binding of cobalt ions to oxygen molecules. However, chemical methods cannot achieve dynamic monitoring and precise control of oxygen concentration, leading to unstable and uncontrollable experimental conditions. Furthermore, regarding hypoxia treatment of ovarian cells, only related research exists. For instance, Chinese invention patent application number CN117305236A discloses a method for culturing adipose-derived mesenchymal stem cells under a constant 5% hypoxia environment, utilizing the hypoxic environment to promote stem cell proliferation and maintain their stemness, for use in preparing drugs to treat premature ovarian failure. Chinese invention patent application number CN120944815A further proposes an intermittent gradient hypoxia-noroxic alternating pretreatment scheme, aiming to simulate the "hypoxia-reoxygenation" pathological characteristics of ovarian tissue, activate the HIF-1α signaling pathway in stem cells, thereby improving their homing and repair efficiency in the treatment of premature ovarian failure. No methods for constructing a hypoxia model of bovine ovarian mesenchymal cells have been reported. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing a hypoxia model of bovine primary ovarian stromal cells, so as to solve at least one of the technical problems existing in the background art.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention provides a method for constructing a hypoxia model of bovine ovarian stromal cells, comprising:

[0008] Step 1: Isolation and primary culture of bovine ovarian stromal cells: Ovarian tissue from cattle is taken, digested and loosened with an enzyme solution, and the digested tissue blocks are cultured in an adherent culture. After the cells migrate from the tissue blocks, primary ovarian stromal cells are obtained.

[0009] Step 2: The obtained primary ovarian stromal cells were seeded in DMEM / F12 medium containing 10% fetal bovine serum and cultured in an incubator at 37°C and 5% CO2 for continued adherence.

[0010] Step 3: After the primary ovarian stromal cells successfully adhered to the culture vessel, they were randomly divided into a control group and a hypoxia group. The control group cells were cultured routinely in a 37°C, 5% CO2 incubator; while the hypoxia group cells were cultured in a tri-gas incubator in a hypoxic environment of 1% O2, 5% CO2 and 94% N2.

[0011] Step 4: The hypoxia group cells were placed in a three-gas incubator and cultured for 72 h. After identification by multiple indicators such as cell morphology, cell viability, gene expression changes, and oxidative stress, an in vitro hypoxia model of bovine primary ovarian stromal cells was obtained.

[0012] Furthermore, the specific procedures for enzyme digestion and tissue adherence culture described in step (1) are as follows: after washing the ovarian tissue with pre-cooled 1×PBS containing antibiotics, the tissue is cut into 1-3 mm pieces. 3 Small tissue pieces were prepared; these were digested with 0.25% trypsin-0.04% EDTA solution for 15-30 min. After removing the digestive solution, 0.5% type II collagenase solution was added and digestion continued for 3 h until the tissue became honeycomb-like. The digestion temperature was 37℃. After digestion, the tissue pieces were collected and resuspended in DMEM / F12 medium containing 10% fetal bovine serum. The tissue pieces were evenly attached to the bottom of a culture dish, a small amount of culture medium was added, and the dish was incubated statically at 37℃ and 5% CO2. When the cells migrated from around the tissue pieces and adhered to the wall to a confluence of approximately 50%-70%, the tissue pieces were removed, and the culture continued until 80%-90% confluence. Primary ovarian stromal cells were obtained by digestion with 0.25% trypsin-0.04% EDTA. The culture medium contained 100 U / mL penicillin and 100 μg / mL streptomycin.

[0013] Furthermore, step (2) involves selecting representative second-generation cells as follows:

[0014] Second generation (P2) cells were seeded in 6-well plates. When the cells reached 60%-70% confluence, they were washed with 1×PBS, fixed with 4% paraformaldehyde, permeated with 0.2% Triton X-100 ice-cold methanol solution, and then incubated at room temperature with blocking solution.

[0015] After discarding the blocking solution, Vimentin primary antibody (SC-373717, Santa Cruz) and Cytokeratin 18 Polyclonal antibody primary antibody (Cat No. 10830-1-AP, Wuhan Sanying) diluted 1:50 with 1×PBS were added and incubated overnight at 4°C. The next day, FITC-conjugated Goat anti-Mouse IgG (H+L) (AS001, ABclonal) and Dylight 594, RabbitAnti-Goat IgG (A23430, Yakein) labeled secondary antibodies diluted 1:200 with 1×PBS were added and incubated at room temperature in the dark for 1 h.

[0016] Counterstain cell nuclei with DAPI, observe and photograph under a fluorescence microscope.

[0017] Furthermore, the low-oxygen incubator mentioned in step (3) is a three-gas incubator (HCP-168, Haier Biomedical).

[0018] Furthermore, the specific operation of the MTT assay for cell viability detection in step (4) is as follows: add 10 μL of 5 mg / mL MTT solution to each well, incubate at 37°C in the dark for 4 h, discard the supernatant, add 150 μL of DMSO to dissolve the formazan crystals, and detect the absorbance at 492 nm using an ELISA reader.

[0019] Furthermore, in step (4), RT-qPCR was performed using a reverse transcription kit (Tiangen FastKing cDNA first-strand synthesis kit) and a FastFire rapid real-time PCR premix kit (SYBR Green, FP007) after total RNA was extracted from cells using the Trizol method. The primer sequences used are shown in Table 1 below:

[0020] Table 1

[0021]

[0022] Furthermore, in step (4), the mitochondrial membrane potential was detected using the JC-1 membrane potential detection kit (C0006, Beyotime). 5 μg / mL of JC-1 probe was added to the cells, and the cells were incubated at 37°C in the dark for 20 min. ROS detection was performed using a ROS detection kit (YEASEN). 10 μM DCFH-DA probe was added to the cells, and the cells were incubated at 37°C in the dark for 30 min. Both assays were observed using a fluorescence microscope and quantitatively analyzed using ImageJ software.

[0023] Furthermore, the criteria for determining the hypoxia model are as follows: compared with the normoxic control group, after 72 h of 1% O2 treatment, bovine ovarian mesenchymal cells met all of the following indicators: (1) cell viability decreased significantly; (2) the expression of hypoxia-related gene HIF-1α was significantly upregulated; (3) the expression of apoptosis-related gene BAX was significantly upregulated (P < 0.05), and the expression of BCL2 was significantly downregulated; (4) the expression of autophagy-related gene p62 was significantly downregulated, and the expression of LC3B was significantly upregulated; (5) the expression of mitochondrial autophagy genes BNIP3 and NIX was significantly upregulated; (6) the expression of glycolysis-related genes PDK1 and GLUT1 was significantly upregulated; (7) JC-1 green fluorescence increased, red fluorescence decreased, and mitochondrial membrane potential decreased; (8) intracellular ROS fluorescence intensity increased significantly, and ROS production increased.

[0024] The beneficial effects of this invention are as follows: It establishes a complete and systematic hypoxia model of bovine ovarian stromal cells for the first time, filling a gap in this field; the purity of the target cells (Vimentin + CK18) is ensured through immunofluorescence dual-labeling identification, eliminating interference from epithelial cells. A multi-index comprehensive evaluation system is adopted, using seven detection indicators—cell morphology, cell viability, gene expression, mitochondrial function, and oxidative stress—to comprehensively evaluate hypoxia injury, improving the scientific rigor and reliability of the model evaluation; the optimal hypoxia modeling parameters are determined: 1% O2 concentration treatment for 72 h, using P2 generation bovine ovarian stromal cells; the three-gas hypoxia incubator used is standard laboratory equipment, requiring no special instruments, and the operating procedure is standardized, demonstrating good laboratory scalability and reproducibility.

[0025] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and will become apparent from the description or may be learned by practice of the invention. Attached Figure Description

[0026] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0027] Figure 1 This is a flowchart illustrating the method for constructing a hypoxia model of bovine primary ovarian stromal cells according to an embodiment of the present invention.

[0028] Figure 2 This is a schematic diagram of immunofluorescence identification (20×) of P2 generation cells using Vimentin and CK18 as described in an embodiment of the present invention.

[0029] Figure 3 This is a schematic diagram (10×) showing the comparison of cell morphology between the hypoxic state after 72 h of cell culture and the control cell, as described in this embodiment of the invention.

[0030] Figure 4 This is a schematic diagram illustrating the results of cell viability detection after 72 h of culture with 1% O2 and 21% O2 as described in the embodiments of the present invention. *P < 0.05, **P < 0.01, ***P < 0.001.

[0031] Figure 5 This is a schematic diagram illustrating the changes in the expression levels of mRNA related genes for hypoxia response, apoptosis, autophagy, mitophagy, and glycolysis in bovine ovarian stromal cells after 72 h of culture at 1% O2, as described in this embodiment of the invention, detected by RT-qPCR.

[0032] Figure 6 This is a schematic diagram (20×) showing the results of detecting changes in mitochondrial membrane potential in cells after culturing in 1% O2 for 72 h using the JC-1 kit, as described in this embodiment of the invention.

[0033] Figure 7 This is a schematic diagram of the ROS detection results (20 ×) of cells cultured at 1% O2 for 72 h according to an embodiment of the present invention. Detailed Implementation

[0034] Embodiments of the present invention are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0035] It will be understood by those skilled in the art that, unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0036] It should also be understood that terms such as those defined in general dictionaries should be understood to have meanings consistent with their meanings in the context of the prior art, and should not be interpreted in an idealized or overly formal sense unless defined as here.

[0037] Those skilled in the art will understand that, unless specifically stated otherwise, the singular forms “a,” “an,” “the,” and “the” used herein may also include the plural forms. It should be further understood that the term “comprising” as used in this specification means the presence of the stated features, integers, steps, operations, elements, and / or components, but does not exclude the presence or addition of one or more other features, integers, steps, operations, elements, and / or groups thereof.

[0038] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of those different embodiments or examples.

[0039] To facilitate understanding of the present invention, the present invention will be further explained and described below with reference to the accompanying drawings and specific embodiments. However, the specific embodiments do not constitute a limitation on the embodiments of the present invention.

[0040] Those skilled in the art should understand that the accompanying drawings are merely schematic diagrams of embodiments, and the components in the drawings are not necessarily essential for implementing the present invention.

[0041] This invention provides a method for constructing a hypoxia model of bovine ovarian stromal cells. This method is characterized by its simplicity, good reproducibility, and comprehensive evaluation system. By establishing a hypoxia model of primary bovine ovarian stromal cells, a pathological hypoxic environment can be accurately simulated, which can be effectively used for research on the hypoxic injury mechanism of bovine ovarian stromal cells and for screening key molecules.

[0042] The method for constructing a hypoxia model of bovine ovarian stromal cells according to the present invention specifically includes the following steps:

[0043] Step 1: Obtain primary ovarian stromal cells using enzymatic digestion combined with tissue adhesion method: Ovarian tissue was taken and cut into 1-3 mm pieces. 3Small tissue pieces were digested with 0.25% trypsin-0.04% EDTA for 15-30 min to loosen the tissue, followed by digestion with 0.5% type II collagenase for 3 h. After digestion, the tissue pieces were collected, evenly attached to the bottom of a culture dish, and a small amount of DMEM / F12 medium containing 10% fetal bovine serum was added. The cells were then incubated statically at 37°C and 5% CO2 for 2 h, followed by the addition of sufficient medium. After the cells migrated from around the tissue pieces and adhered to the culture dish, the tissue pieces were removed, and the cells were digested and passaged to obtain primary ovarian stromal cells.

[0044] The obtained cells were identified as ovarian stromal cells by Vimentin and CK18.

[0045] Step 2: Passage the primary ovarian stromal cells obtained in step (1) for further culture.

[0046] Step 3: After successful adhesion of the passaged ovarian stromal cells, they were randomly divided into a control group and a hypoxia group. Control group cells were cultured using standard methods. The hypoxia environment parameters of a commonly used three-gas incubator were set to 1% O2, 5% CO2, and 94% N2. The hypoxia group cells were cultured in this incubator for 72 h. After evaluation using multiple indicators including cell morphology, cell viability, gene expression, mitochondrial function, and oxidative stress, an in vitro hypoxia model of bovine primary ovarian stromal cells was obtained.

[0047] To ensure the stability of the isolated cells, representative P2 cells were selected for immunofluorescence staining identification during cell passaging. The specific experimental procedure included:

[0048] When adherent cells reach 50%-70% confluence, wash with 1 × PBS, fix with 4% paraformaldehyde, permeabilize with 0.2% Triton in ice-cold methanol solution (pre-cooled at -20℃), and then incubate at room temperature with blocking solution.

[0049] After discarding the blocking solution, Vimentin and CK18 primary antibody working solutions were added separately and incubated overnight at 4°C in a humidified chamber. After washing three times with 1×PBS, FITC-conjugated Goat anti-Mouse IgG (H+L) and Dylight 594, Rabbit Anti-Goat IgG (A23430, Yake Yin) secondary antibodies were added and incubated at 37°C in the dark for 30 min.

[0050] Add DAPI staining solution and observe and photograph under a fluorescence microscope.

[0051] To ensure the successful construction of a hypoxic in vitro model of bovine primary ovarian stromal cells, five methods were used, including the following steps:

[0052] Primary ovarian stromal cells were randomly divided into a normoxic control group and a hypoxic treatment group. The control group was cultured routinely at 37℃, 21% O2, and 5% CO2. After cell adhesion, the cells in the hypoxic group were transferred to a hypoxic incubator for culture. The hypoxic conditions in the incubator were set at 37℃, 1% O2, 5% CO2, and 94% N2.

[0053] Morphological observation, cell viability detection, gene expression detection, and hypoxia stress level determination were performed on cells cultured under hypoxia to further confirm the successful construction of an in vitro hypoxia model of bovine primary ovarian stromal cells.

[0054] The preferred specific procedure for the enzyme digestion combined with tissue adhesion method described in step (1) is as follows: after washing the ovarian tissue with 1×PBS containing antibiotics and pre-cooled, the tissue is cut into pieces of 1-3 mm. 3 Small tissue pieces were digested with 0.25% trypsin-0.04% EDTA solution for 15-30 min. After removing the digestive solution, 0.5% type II collagenase solution was added and digestion continued for 3 h at 37℃. After digestion, the tissue pieces were collected and resuspended in DMEM / F12 medium containing 10% fetal bovine serum. The tissue pieces were evenly attached to the bottom of a culture dish, a small amount of culture medium was added, and the cells were incubated statically in a 37℃, 5% CO2 incubator. Sufficient culture medium was added after 2 h. After the cells migrated from the tissue pieces, the tissue pieces were removed and cultured until 80%-90% confluence was achieved. Primary ovarian stromal cells were obtained by digestion and passage.

[0055] The preferred Vimentin antibody is Vimentin (SC-373717, Santa Cruz), and the preferred CK18 antibody is Cytokeratin 18 Polyclonal antibody primary antibody (Cat No. 10830-1-AP, Wuhan Sanying). The preferred dilution ratio for Vimentin is 1:50 (v / v) using 1×PBS, and the preferred dilution ratio for CK18 is 1:400 (v / v) using 1×PBS. The preferred secondary antibodies are FITC-conjugated Goat anti-Mouse IgG (H+L) (AS001, ABclonal) and Dylight 594, Rabbit Anti-Goat IgG (A23430, Yake Yin), and the preferred dilution ratio is 1:200 (v / v) using 1×PBS.

[0056] The DAPI staining solution used is preferably an anti-fluorescence quenching mounting solution (containing DAPI) (P0131, Beyotime); the hypoxic incubator is preferably a conventional three-gas incubator (HCP-168, Haier Biomedical).

[0057] The preferred method for detecting cell viability is MTT assay; the preferred method for gene expression is RT-qPCR to detect the expression of hypoxia response gene HIF-1α, apoptosis-related genes BAX and BCL2, autophagy-related genes LC3B and p62, mitochondrial autophagy-related genes BNIP3 and NIX, and glycolysis-related genes PDK1 and GLUT1 in bovine ovarian stromal cells; the preferred method for detecting hypoxia stress is to use the JC-1 fluorescent probe method to detect the dynamic changes in mitochondrial membrane potential and the DCFH-DA probe method to detect ROS levels.

[0058] Example 1

[0059] Example 1 provides a protocol for the isolation and identification of primary ovarian stromal cells. For example... Figure 1 As shown, an efficient and convenient method for isolating bovine primary ovarian stromal cells is provided, which specifically includes the following steps:

[0060] Step 1: Take one pair of fresh bovine ovaries, cut them lengthwise with ophthalmic scissors, remove the ovarian cortical tissue, and cut the tissue into 1-3 mm pieces. 3 Small pieces of tissue were collected; the tissue fragments were washed three times with 1× PBS, and the loose tissue was digested with 0.25% trypsin-0.04% EDTA for 15-30 min. After removing the digestion solution, 0.5% type II collagenase was added and digestion continued for 3 h. After digestion, the tissue pieces were collected and resuspended in DMEM / F12 medium containing 10% fetal bovine serum. The tissue pieces were evenly attached to the bottom of the culture dish, a small amount of culture medium was added, and the cells were incubated statically in a 37℃, 5% CO2 incubator. After the cells migrated from around the tissue pieces and adhered to the wall, the tissue pieces were removed and cultured until 80%-90% confluence was achieved.

[0061] Step 2: After digesting the primary ovarian stromal cells obtained in step (1), centrifuge at 800 rpm / min for 5 min and discard the supernatant. Resuspend the cells in DMEM / F12 medium with 10% fetal bovine serum and 1% penicillin and antibiotics, and seed them in a cell culture dish with a diameter of 6 cm. Place the dish in a cell culture incubator with 5% CO2 and 37℃ to culture the cells. Continue to culture the primary ovarian stromal cells obtained after cell adhesion.

[0062] Step 3: After successful adhesion of passaged ovarian stromal cells, they were randomly divided into a control group and a hypoxia group. Control group cells were cultured routinely. A commonly used three-gas incubator was set with hypoxia parameters of 1% O2, 5% CO2, and 94% N2. After evaluation using multiple indicators including cell morphology, cell viability, and hypoxia stress, an in vitro hypoxia model of bovine primary ovarian stromal cells was obtained.

[0063] To ensure the stability of the isolated cells, this embodiment selects representative P2 generation cells for immunofluorescence staining identification during cell passage culture. The specific experimental procedure includes:

[0064] Step A. Seed the cells from step (3) into 12-well plates, using 8 × 10⁸ cells per well. 5 When cells / mL reach a confluence of 50%-70%, wash with 1×PBS, fix with 4% paraformaldehyde, permeate with 0.2% Triton in ice-cold methanol solution (pre-cooled at -20℃), and incubate at room temperature with blocking solution.

[0065] Step B. After discarding the blocking solution, add Vimentin (SC-373717, Santa Cruz) and CK18 primary antibody (Cat No. 10830-1-AP, Wuhan Sanying) antibody working solutions diluted 1:50 with 1×PBS and incubate overnight at 4°C in a humidified chamber. After washing 3 times with 1×PBS, add FITC-conjugated Goat anti-Mouse IgG (H+L) (AS001, ABclonal) and Dylight 594, RabbitAnti-Goat IgG (A23430, Yake Yin) secondary antibodies diluted 1:200 with 1×PBS and incubate at 37°C in the dark for 30 min.

[0066] Add anti-fluorescence quenching mounting solution (containing DAPI) (P0131, Beyotime), and observe and photograph under a fluorescence microscope.

[0067] The P2 generation cells were identified using Vimentin and CK18, and Vimentin was positive while CK18 was negative. Figure 2 As shown, this embodiment successfully isolated bovine primary ovarian stromal cells.

[0068] Example 2

[0069] In Example 2, a hypoxia model of bovine primary ovarian stromal cells was constructed. To address the challenges of precisely controlling O2 concentration when using chemical drugs, as well as the difficulty in procuring and the toxicity of precursor chemicals, this example utilizes a three-gas incubator with precisely adjustable O2 concentration, resulting in a precise and convenient experiment. The specific process is as follows:

[0070] Step 1: Seed the primary ovarian stromal cells obtained in Example 1 into a cell culture dish with a diameter of 10 cm. When the cells reach 80%-90% confluence, they are digested and centrifuged. The cells are then resuspended in DMEM / F12 medium containing 10% fetal bovine serum and 1% penicillin antibiotics.

[0071] Step 2: Seed the cell suspension at a density of 6 × 10⁶ cells / h for 72 hours. 4 Cells / mL were seeded into 6-well plates and then randomly divided into a control group and a hypoxia group. The control group cells were cultured in a 5% CO2, 37°C normoxic incubator, while the hypoxia group cells were cultured in a tri-gas incubator with 1% O2, 5% CO2, 94% N2, and 37°C.

[0072] Experimental results: At 72 h, 90% of the cells in the control group (NC) were fully grown and arranged regularly, while the proliferation of cells in the hypoxia group (HY) was affected, and the cell density was lower than that of the control group. This demonstrates that the hypoxic environment has an inhibitory effect on cell growth. Figure 3 As shown.

[0073] Example 3

[0074] Example 3 provides the following experimental procedure for detecting the proliferation activity of ovarian stromal cells using the MTT assay, with 1% O2 concentration and a control group:

[0075] Step 1: Same as step 1 in Example 2;

[0076] Step 2: Prepare the cell suspension at a concentration of 1×10⁻⁶. 4 After seeding the cells at a density of cells / mL into 96-well plates, the cells were randomly divided into a control group and a hypoxia group, with 10 replicates in each group. The control group cells were placed in a 5% CO2 incubator at 37°C for routine culture, while the hypoxia group cells were placed in a tri-gas incubator with 1% O2, 5% CO2, and 94% N2 at 37°C for hypoxia culture.

[0077] Step 3: After 72 hours, remove the cells, add 10 μL of MTT solution (5 mg / mL) to each well, and incubate in a 5% CO2, 37℃ cell culture incubator for 4 hours. Discard the liquid and add 150 μL of DMSO solution. After incubation for 10 minutes, detect the OD value (492 nm) using a microplate reader.

[0078] Experimental results: Cell viability after 72 h of hypoxic culture was detected using the MTT assay. Figure 4 As shown, culturing under 1% O2 conditions for 72 h significantly inhibited cell proliferation.

[0079] Example 4

[0080] This embodiment demonstrates the use of RT-qPCR to detect the expression levels of mRNA-related genes concerning hypoxia response, apoptosis, autophagy, and glycolysis in bovine primary ovarian stromal cells. In this embodiment, total RNA was extracted from cells using the Trizol method, and real-time quantitative PCR (qPCR) was performed using a reverse transcription kit (Tiangen FastKing cDNA First-Strand Synthesis Kit) and a FastFire rapid quantitative PCR premix kit (SYBR Green, FP007) to detect the mRNA-level gene expression of ovarian stromal cells after 72 h of culture at 1% O2. The specific procedure is as follows:

[0081] Step 1: Seed the cell suspension at a density of 6 × 10⁶ cells / h for 72 hours. 4 Cells / mL were seeded into 6-well plates and then randomly divided into a control group and a hypoxia group. The control group cells were cultured in a cell culture incubator with a volume fraction of 5% CO2 and a temperature of 37°C for routine culture, while the hypoxia group cells were cultured in a three-gas incubator with a volume fraction of 1% O2, 5% CO2, and 94% N2 and a temperature of 37°C for hypoxia culture.

[0082] Step 2: After 72 hours, RNA was extracted using the Trizol method;

[0083] Step 3: Reverse transcribe the DNA into cDNA according to the instructions of the reverse transcription kit (Tiangen FastKing cDNA First Strand Synthesis Kit);

[0084] Step 4: Perform real-time PCR using the FastFire Premixed PCR Kit (SYBR Green, FP007).

[0085] Experimental results:

[0086] Hypoxia response-related genes: HIF-1α expression was significantly upregulated in the 72 h hypoxia treatment group;

[0087] Apoptosis-related genes: Compared with the normoxic control group, the expression of BAX and BCL2 was significantly upregulated in the 1% O2 hypoxia treatment group for 72 h, indicating that hypoxia induced significant activation of the mitochondrial apoptosis pathway in bovine ovarian stromal cells.

[0088] Autophagy-related genes: LC3B expression was significantly upregulated and p62 expression was significantly downregulated in the 72 h hypoxia treatment group, indicating that hypoxia treatment led to significant activation of autophagic flux in bovine ovarian stromal cells.

[0089] Mitochondrial autophagy-related genes: The expression of BNIP3 and NIX was significantly upregulated in the hypoxia treatment group for 72 h, indicating that hypoxia induced significant activation of the mitochondrial apoptosis pathway in bovine ovarian mesenchymal cells.

[0090] Glycolysis-related genes: The expression of PDK1 and GLUT1 was significantly upregulated in the 72 h hypoxia treatment group; the results indicate that hypoxia treatment induced glycolytic metabolic reprogramming in bovine ovarian stromal cells.

[0091] Example 5

[0092] In this embodiment, the JC-1 immunofluorescence assay is used to detect changes in mitochondrial membrane potential in ovarian stromal cells. To further detect whether mitochondria in ovarian stromal cells are damaged under hypoxic conditions and the extent of such damage, this embodiment uses an immunofluorescence assay with a mitochondrial membrane potential detection kit (JC-1) (C0006, Beyotime) to detect changes in mitochondrial membrane potential in ovarian stromal cells cultured at 1% O2 for 72 h. Changes in mitochondrial membrane potential can indicate whether mitochondrial function is impaired. The specific process is as follows:

[0093] Step 1: Same as step 2 in Example 2;

[0094] Step 2: Seed the cell suspension at a density of 6 × 10⁶ cells / h for 72 hours. 4 Cells at a density of 100 cells / mL were seeded into 3.5 cm diameter cell culture dishes and randomly divided into a control group (NC) and a hypoxia group (HY). The control group cells were cultured in a cell culture incubator with a volume fraction of 5% CO2 and a temperature of 37°C for routine culture, while the hypoxia group cells were cultured in a tri-gas incubator with a volume fraction of 1% O2, 5% CO2, and 94% N2 and a temperature of 37°C for hypoxia culture.

[0095] Step 3: After 72 hours, remove the cells, wash them with 1×PBS, add 1 mL of JC-1 staining working solution prepared according to the instructions, and incubate in a cell culture incubator at 37°C in the dark for 20 min.

[0096] Step 4: During incubation, prepare JC-1 staining buffer (1×) according to the instructions, then incubate at 37°C on ice. After incubation, discard the supernatant and wash with JC-1 staining buffer (1×).

[0097] Step 5: Add 1 mL of cell culture medium and observe and photograph it under a fluorescence microscope.

[0098] Experimental results: Mitochondrial membrane potential was detected using JC-1 staining at 72 h, such as... Figure 6As shown, under hypoxia treatment, the green fluorescence of JC-1 monomer increased while the red fluorescence of polymer decreased, indicating that the decrease in mitochondrial membrane potential and functional damage were more significant under hypoxia treatment conditions.

[0099] Example 6

[0100] In this embodiment, immunofluorescence is used to detect the ROS content of bovine primary ovarian stromal cells. To further detect the ROS content produced by ovarian stromal cells under hypoxic conditions, this embodiment uses an immunofluorescence assay with a YEASEN ROS kit to detect the ROS content of ovarian stromal cells after culturing at 1% O2 for 72 h. The specific procedure is as follows:

[0101] Step 1: Same as step 1 in Example 2;

[0102] Step 2: Same as step 2 in Example 5;

[0103] Step 3: After 72 h, remove the cells, wash them with 1 × PBS, add 1 mL of DCFH-DA working solution diluted with serum-free DMEM / F12 medium to a final concentration of 10 μM, and incubate in a cell culture incubator at 37°C in the dark for 30 min.

[0104] Step 4: Wash the cells with serum-free DMEM / F12 medium and observe and photograph them under a fluorescence microscope.

[0105] Experimental results: ROS detection after 72 h was as follows Figure 7 As shown, ROS production levels were low in the control group (NC), with almost no visible fluorescence signal. In the hypoxia intervention group (HY), ROS production was significantly increased, exhibiting strong green fluorescence.

[0106] In summary, the method for constructing a hypoxia model of bovine ovarian stromal cells described in this embodiment of the invention belongs to the field of cell model construction technology. The method includes the following steps: (1) isolation and primary culture of bovine ovarian stromal cells using enzymatic digestion combined with tissue adhesion method; (2) identification of bovine ovarian stromal cells using immunofluorescence method to detect the expression of Vimentin and CK18; (3) establishment of hypoxia model: bovine ovarian stromal cells in logarithmic growth phase are placed in a hypoxia incubator at 37℃, 1% O2, 5% CO2, and 94% N2 for 72 h, with 37℃, 21% O2, and 5% CO2 as normoxic control; (4) model evaluation: cell morphology is observed under a light microscope, cell viability is detected by MTT assay, expression of genes related to apoptosis, autophagy, glycolysis, and hypoxia response is detected by RT-qPCR, mitochondrial membrane potential is detected by JC-1 staining, and intracellular reactive oxygen species (ROS) levels are detected by DCFH-DA probe method. The results showed that primary bovine ovarian stromal cells (BSSCs) could be obtained well using enzymatic digestion combined with tissue adhesion, and were successfully passaged to the 11th generation. Immunofluorescence analysis showed positive Vimentin expression, but no CK18 expression, consistent with the characteristics of BSSCs. After 72 h of 1% O2 hypoxia, cell proliferation was significantly inhibited. The expression of hypoxia response genes HIF-1α, apoptosis genes BAX, autophagy genes LC3B, mitochondrial autophagy genes BNIP3 and NIX, and glycolysis-related genes PDK1 and GLUT1 were all upregulated, while apoptosis genes BCL2 and autophagy genes p62 were significantly downregulated. Mitochondrial membrane potential decreased, and ROS production increased, indicating significant oxidative stress damage and metabolic reprogramming in bovine BSSCs. This model can serve as a reliable in vitro model for further research on the mechanism of hypoxia damage in bovine BSSCs and drug intervention. The construction method of this invention is simple, reproducible, and low-cost, providing an effective cell model for studying the pathogenesis of bovine ovarian hypoxia stress-related diseases and drug screening.

[0107] While the specific embodiments of the present invention have been described above in conjunction with the accompanying drawings, this is not intended to limit the scope of protection of the present invention. Those skilled in the art should understand that, based on the technical solutions disclosed in the present invention, various modifications or variations that can be made by those skilled in the art without creative effort should be included within the scope of protection of the present invention.

Claims

1. A method for constructing a hypoxia model of bovine ovarian stromal cells, characterized in that, include: Isolation and primary culture of bovine ovarian stromal cells: Ovarian tissue from cattle was digested and loosened with an enzyme solution, and the digested tissue blocks were cultured in an adherent culture medium. After the cells migrated from the tissue blocks, primary ovarian stromal cells were obtained. The obtained primary ovarian stromal cells were seeded in DMEM / F12 medium containing 10% fetal bovine serum and continued to adhere to the culture vessel in a 37°C, 5% CO2 incubator. After the primary ovarian stromal cells successfully adhered to the culture vessel, they were randomly divided into a control group and a hypoxia group. The cells in the control group were cultured using standard methods. The hypoxia environment parameters of the commonly used three-gas incubator were set as 1% O2, 5% CO2 and 94% N2. The hypoxic cells were cultured in a three-gas incubator for 72 h. After identification by multiple indicators such as cell morphology, cell viability, gene expression changes, and oxidative stress, an in vitro hypoxia model of bovine primary ovarian stromal cells was obtained.

2. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 1, characterized in that, The specific procedures for enzyme solution digestion and tissue adherence culture are as follows: After cleaning the ovarian tissue, cut it into small pieces; digest it until the tissue becomes honeycomb-like; after digestion, collect the tissue blocks, resuspend them in culture medium, evenly attach the tissue blocks to the bottom of the culture dish, add culture medium, and incubate them statically in an incubator; when the cells migrate from around the tissue blocks and adhere to the wall to grow to a confluence of about 50%-70%, remove the tissue blocks and continue culturing to 80%-90% confluence, then digest to obtain primary ovarian stromal cells.

3. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 2, characterized in that, The culture medium contains 100 U / mL penicillin and 100 μg / mL streptomycin.

4. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 1, characterized in that, The procedure for selecting representative second-generation cells was as follows: P2 generation cells were seeded into 6-well plates. When the cells reached 60%-70% confluence, they were washed, fixed with paraformaldehyde, permeated with Triton X-100 ice-cold methanol solution, and then incubated at room temperature with blocking solution. After discarding the blocking solution, add Vimentin primary antibody diluted with 1×PBS and Cytokeratin 18 Polyclonal antibody primary antibody, and incubate overnight at 4°C. The next day, add FITC-conjugated Goat anti-Mouse IgG and Dylight 594, Rabbit Anti-Goat IgG labeled secondary antibody diluted with 1×PBS, and incubate at room temperature in the dark for 1 h. Counterstain cell nuclei with DAPI, observe and photograph under a fluorescence microscope.

5. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 4, characterized in that, Vimentin primary antibody and Cytokeratin 18 Polyclonal antibody primary antibody, diluted 1:50 with 1×PBS, were added respectively.

6. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 5, characterized in that, The following day, secondary antibodies labeled with FITC-conjugated Goat anti-Mouse IgG and Dylight 594, Rabbit Anti-Goat IgG, were added using 1 × PBS at a volume ratio of 1:

200.

7. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 1, characterized in that, The low-oxygen incubator is a three-gas incubator.

8. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 1, characterized in that, The specific procedure for detecting cell viability using the MTT assay is as follows: Add 10 μL of 5 mg / mL MTT solution to each well, incubate at 37°C in the dark for 4 h, discard the supernatant, add 150 μL of DMSO to dissolve the formazan crystals, and detect the absorbance at 492 nm using a microplate reader.

9. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 1, characterized in that, RT-qPCR was performed using total RNA extracted from cells via the Trizol method, followed by real-time quantitative PCR using a reverse transcription kit and a FastFire premixed PCR kit. The primer sequences used are as follows: BAX, upstream primer: CCAGCAAACTGGTGCTCAAGG; downstream primer: AGCCGCTCTCGAAGGAAGTC; BCL2, upstream primer: AGCATCGCCCTGTGGATGAC; downstream primer: CAGCCTCCGTTGTCCTGGAT; LC3B, upstream primer: CCGACTTATCCGAGAGCAGC; downstream primer: TGAGCTGTAAGCGCCTTCTT; p62, upstream primer: ATTGAGCCAGCTCAGGCTGT; downstream primer: CTGGCTGGAAGTCAGGCTGT; BNIP3, upstream primer: GAAGAACAGCTCCCAGTCCGA; downstream primer: CCGACTGGACCAATCCCAA; NIX, upstream primer: ACTTAGAACAGCCGCCG; downstream primer: CCACCCAGGAACTGTTGAGG; HIF-1α, upstream primer: GGCGCGAACGACAAGAAAAA; downstream primer: GTGGCAACTGATGAGCAAGC; PDK1, upstream primer: TGCTAGGCGTCTGTGTGATTT; downstream primer: CGTTGCTCTCATTGCATTCTTG; GLUT1, upstream primer: ATCCTCATCGCCCAGGTGTT; downstream primer: GGTTCTCCTCGTTGCGGTTA; 18sRNA, upstream primer: GTAACCCGTTGAACCCCATT; downstream primer: CCATCCAATCGGTAGTAGCG.

10. The method for constructing a hypoxia model of bovine ovarian stromal cells according to claim 1, characterized in that, Mitochondrial membrane potential was detected using a 5 μg / mL JC-1 probe, incubated at 37°C in the dark for 20 min. ROS was detected using a 10 μM DCFH-DA probe, incubated at 37°C in the dark for 30 min.

Images