Mutant t6 of thermostable lipase pfhl and application thereof

Abstract

This invention provides a thermostable lipase PFHL mutant T6 and its applications, belonging to the field of bioengineering technology. Based on consensus sequence analysis, computer-aided prediction, and disulfide bond introduction strategies, this invention molecularly modifies the lipase PFHL derived from *Pseudomonas fluorescens* HK44 to obtain a mutant T6 with significantly improved thermostability. The optimal reaction temperature for mutant T6 is 60℃, and after reacting at 60℃ for 1 hour, its residual enzyme activity remains at 98.05%, exhibiting excellent thermostability and catalytic persistence. Mutant T6 can be used for oil hydrolysis and catalytic synthesis of biodiesel, with a wide range of applications and excellent practicality.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a mutant T6 of the thermostable lipase PFHL and its applications. Background Technology

[0002] Lipase (EC 3.1.1.3) is a specialized ester hydrolase widely distributed in nature, capable of catalyzing the cleavage of ester bonds in triglycerides. Lipases can catalyze reactions at the oil-water interface and undergo reverse reactions such as esterification and transesterification in non-aqueous media. Due to this catalytic property, lipase has become the third largest commercially available enzyme after carbohydrate enzymes and proteases, and is widely used in food processing, bioenergy development, environmental remediation, and pharmaceutical synthesis.

[0003] Based on their origin, lipases can be divided into three main categories: animal-derived, plant-derived, and microbial-derived lipases. Animal and plant lipases are limited in industrial application due to high extraction costs, complex extraction processes, low enzyme yields, and difficulties in large-scale production. In contrast, microbial production offers numerous significant advantages, including high yields, ease of genetic engineering modification, short growth cycles, independence from seasonal variations, stable supply capabilities, and good safety during production and application. These advantages have made microbial production the primary source of industrial lipases, accounting for over 90% of total industrial lipase production.

[0004] Although various lipases are currently used in various fields, their poor substrate adaptability, insufficient environmental tolerance, and limited catalytic performance make it difficult to fully meet the diverse enzymatic performance requirements of complex industrial reaction systems. In recent years, with the rapid development of biotechnology and the continuous advancement of the global carbon neutrality strategy, the development of novel lipases with high catalytic activity, excellent thermal stability, and good substrate specificity has gradually become a research focus. On the other hand, while natural lipases exhibit excellent catalytic properties under mild conditions, they are generally sensitive to high temperatures, and their catalytic activity tends to decrease rapidly with increasing temperature. This seriously affects their application in high-temperature industries (such as high-temperature esterification, biodiesel production, and organic solvent systems).

[0005] Rational protein design relies on a deep understanding of protein structure and function, focusing on heat-sensitive regions or conformationally unstable sites to implement precise site-directed mutagenesis strategies, thereby enhancing the overall conformational stability of the molecule. Common strategies include introducing disulfide bonds at appropriate positions to enhance molecular rigidity, constructing new salt bridges or hydrogen bond networks to stabilize the internal or surface structure of enzyme molecules, and increasing the hydrophobic core by adding hydrophobic residues or optimizing the distribution of hydrophobic cores to improve the hydrophobic interactions of the protein core. Stability prediction software (such as FoldX, Hotspot, and Rosetta) and artificial intelligence structure prediction tools (such as AlphaFold and SWISS-MODEL) are also widely used to predict sites related to thermal stability. This method has clear mutation sites, high modification efficiency, and can effectively reduce the pressure of mutation screening. In addition, molecular dynamics simulations can be used to assess changes in protein conformational flexibility and stability before and after mutation, assisting in the screening of mutation sites. Rational modification of lipases can be used to obtain positive mutants with significantly improved thermal stability and catalytic performance, replacing the original wild-type lipases and expanding their application range as a class of highly efficient and multifunctional biocatalysts.

[0006] To meet the performance requirements of enzymes in high-temperature applications, it is necessary to screen natural heat-resistant lipases using various methods or to engineer existing lipases to develop lipases with good thermal stability. Therefore, combining structural biology and computational-aided design techniques to further improve the adaptability of lipases in high-temperature environments will greatly expand their applications in the industrial field and enhance the greenness, safety, and sustainability of enzyme catalysis processes. Summary of the Invention

[0007] To address some shortcomings in existing technologies, this invention provides a thermostable lipase PFHL mutant T6 and its applications. Based on consensus sequence analysis, computer-aided prediction, and disulfide bond introduction strategies, this invention molecularly modifies the lipase PFHL derived from *Pseudomonas fluorescens* HK44 to obtain a mutant T6 with significantly improved thermostability. The optimal reaction temperature for mutant T6 is 60℃, and after reacting at 60℃ for 1 hour, its residual enzyme activity remains at 98.05%, exhibiting excellent thermostability and catalytic persistence. Mutant T6 can be used for oil hydrolysis and catalytic synthesis of biodiesel, with a wide range of applications and excellent practicality.

[0008] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0009] This invention first provides a mutant T6 of the thermostable lipase PFHL, wherein the mutant T6 is a site-directed mutation based on the wild-type lipase PFHL with the amino acid sequence shown in SEQ ID NO:1; the site-directed mutation includes:

[0010] (1) Mutate amino acid P at position 86 to G; and / or

[0011] (2) Mutate the 120th amino acid H to A.

[0012] Preferably, the amino acid sequence of the mutant T6 is shown in SEQ ID NO:2.

[0013] The present invention also provides biomaterials comprising genes, expression cassettes, recombinant expression vectors, recombinant engineered bacteria or cells;

[0014] The gene encodes the mutant T6;

[0015] The expression cassette contains the gene;

[0016] The recombinant expression vector contains the gene or the expression cassette;

[0017] The recombinant engineered bacteria or cells contain any one of the gene, expression cassette, and expression vector, or express the mutant T6.

[0018] Preferably, the nucleotide sequence of the gene is SEQ ID NO:3 or its degenerate sequence.

[0019] This invention also provides the application of the mutant T6 of the above-mentioned thermostable lipase PFHL in the catalytic hydrolysis of oils and fats.

[0020] The present invention also provides a method for catalytic hydrolysis of fats and oils, the method comprising: using mutant T6 as a catalyst for the hydrolysis reaction of fats and oils.

[0021] This invention also provides the application of the mutant T6 of the above-mentioned high-temperature resistant lipase PFHL in the catalytic synthesis of biodiesel.

[0022] Preferably, in the application, waste cooking oil is catalyzed to synthesize biodiesel.

[0023] This invention also provides a method for synthesizing biodiesel from catalytic waste cooking oil, the method comprising:

[0024] The purified mutant T6 was mixed with pretreated kitchen waste oil, then methanol was added, and the mixture was reacted in a shaker. After the reaction was completed, the mixture was filtered to obtain biodiesel.

[0025] Preferably, the mass ratio of the purified mutant T6 to the pretreated kitchen waste oil is 1:666.7;

[0026] The total amount of methanol added is in a molar ratio of 3:1 to the waste cooking oil, and is added in three portions.

[0027] The reaction conditions were: 45°C, 240 rpm in a shaker for 48 h.

[0028] Preferably, the pretreatment step of the waste cooking oil includes:

[0029] The waste cooking oil is centrifuged to collect the upper layer of grease, then hydrogen peroxide is added and heated and stirred in a water bath. The upper layer of grease is retained after centrifugation. Activated carbon and activated clay are then added and heated in a water bath to react. After the reaction is completed, the mixture is cooled, centrifuged to collect the supernatant, and heated to remove water, thus obtaining the pretreated waste cooking oil.

[0030] Preferably, the concentration of the hydrogen peroxide is 30%, and the amount used is 5% of the mass of the upper layer of oil;

[0031] The conditions for water bath heating and stirring are 60℃ for 40 minutes;

[0032] The activated carbon and activated clay each account for 5% of the mass of waste cooking oil.

[0033] The conditions for the water bath heating reaction are 70°C and 15 min.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] (1) This invention combines consensus sequence analysis, computer-aided prediction, and disulfide bond introduction to construct a multi-strategy combined rational modification method system for the thermostability of lipases. Through the screening and modification of the above system, a series of lipase mutants with significantly improved thermostability were obtained, among which mutant T6 showed excellent performance in both catalytic activity and thermostability. This further verifies the effectiveness of the multi-strategy design method and provides an example for the rational modification of other lipases and hydrolases.

[0036] (2) The optimal catalytic reaction temperature of the mutant T6 described in this invention is 60℃, and after reacting at 60℃ for 1 h, its residual enzyme activity remains at 98.05%, which is higher than the optimal reaction temperature (35℃-45℃) of the natural lipase and the enzyme activity after incubation (the residual enzyme activity is less than 50% after incubation at temperatures above 50℃ for 2 h). The half-life of the thermostable lipase PFHL mutant T6 described in this invention at 60℃ is extended from 2.52 h of the wild type to 10.98 h, and its catalytic efficiency (k... cat / K m It increased by 8.14 times compared to the wild type, reaching 753.76 mM. -1 ·min -1 Furthermore, the optimal reaction pH has been increased from 7.0 to 8.0, making it more suitable for alkaline industrial environments. The T6 mutant of the high-temperature resistant lipase PFHL described in this invention exhibits excellent thermal stability and catalytic performance, better meeting production needs and possessing enormous market potential in various industrial fields.

[0037] (3) This invention is not limited to using the mutant T6 of lipase PFHL to catalyze the artificial substrate p-nitrophenyl palmitate (p-NPP), but also applies it to core industrial applications such as natural oil hydrolysis and biodiesel synthesis:

[0038] Hydrolysis experiments using olive oil as a substrate at 60℃ showed that the mutant T6 of the thermostable lipase PFHL exhibited significantly better catalytic efficiency and thermal stability than the wild type: after 60 min of reaction, the degree of hydrolysis of mutant T6 (18.76%) was 3.04 times that of the wild type (6.17%), demonstrating extremely strong initial hydrolysis ability; after 180 min of reaction, the degree of hydrolysis of mutant T6 reached 54.62%, while that of the wild type was only 39.63%. Furthermore, unlike the wild type, which showed signs of decreased degree of hydrolysis and activity decay in the later stages of the reaction (150-180 min), the degree of hydrolysis of mutant T6 continued to rise steadily throughout the entire reaction process, fully demonstrating its better thermal stability and catalytic persistence under prolonged high-temperature reaction conditions.

[0039] In biodiesel synthesis, when the mass ratio of lipase to waste cooking oil in the reaction is 1:666.7, characteristic signal peaks of fatty acid methyl esters, such as methyl stearate, methyl palmitate, and methyl oleate, which are core components of biodiesel, can be detected in the reaction system catalyzed by mutant T6. The total conversion rate of biodiesel from waste cooking oil catalyzed by this mutant T6 can reach 60% to 80%. In contrast, the total conversion rate of fatty acid methyl esters in the reaction system using wild-type lipase as a catalyst is only 15% to 25%, indicating that the mutant T6 of the heat-resistant lipase PFHL may also have the potential to meet the diverse enzymatic performance requirements of lipases in the complex industrial reaction system of biodiesel synthesis. Attached Figure Description

[0040] Figure 1 The figures show the protein expression and enzymatic properties of single-point mutants of PFHL; in the figure, a is the SDS-PAGE image of some single-point mutants after purification, b is the enzyme activity of single-point mutants, and c is the thermostability of wild-type WT and single-point mutants.

[0041] Figure 2 The figures show the protein expression and enzymatic properties of PFHL multi-point hybrid mutants. In the figure, a represents the iteration process of the hybrid mutants, b represents the SDS-PAGE images of the two-point and three-point hybrid mutants after purification, c represents the relative enzyme activity of the two-point mutants, d represents the thermostability of wild-type WT and 15 two-point mutants, e represents the relative enzyme activity of the three-point and four-point mutants, and f represents the thermostability of wild-type WT and 20 multi-point mutants.

[0042] Figure 3The parameters represent the enzymatic properties of the effective mutants; in the figure, a represents the optimal temperature and temperature stability of the superior mutants, and b represents the optimal pH and pH stability of the superior mutants.

[0043] Figure 4 The degree of hydrolysis of olive oil by PFHL wild-type WT and mutant T6. Detailed Implementation

[0044] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. In the following embodiments, various processes and methods not described in detail are conventional methods known in the art. The source, trade name, and components of the reagents used, if necessary, are indicated upon their first appearance. Unless otherwise specified, subsequent use of the same reagents will be based on the same information as initially indicated.

[0045] Primer synthesis and sequencing for the following examples were performed by Suzhou Genewiz Biotechnology Co., Ltd. The cloning vector used was pET-28a(+), and the cloning host E. coli DH5α and expression host E. coli BL21 were purchased from Shanghai Sangon Biotech Co., Ltd.

[0046] Example 1. Homology modeling and mutant library construction of lipase PFHL

[0047] This embodiment utilizes three methods—consensus sequence analysis, computer-aided prediction, and disulfide bond introduction—to rationally modify the lipase PFHL (SEQ ID NO:1) in order to obtain a mutant with superior thermal stability, laying the foundation for its application in high-temperature industrial systems. The rational modification steps are as follows:

[0048] (1) Establishment of a mutation library based on consensus sequences:

[0049] Using the PFHL protein sequence as a template, the BLAST function in the NCBI database was used to search for approximately 50 amino acid sequences with 30-99% homology to PFHL. Sequence alignment was performed using MEGA7 software, and the natural evolutionary trend of non-conserved sites in PFHL was deduced based on the frequency of each base in the sequence alignment. To avoid adverse effects of mutations on the enzyme's catalytic core structure, only amino acid residues located outside the 4 Å region but within the 8 Å region of the PFHL catalytic triplet were screened.

[0050] Taking into account the structural position and conservation of residues, 12 single-point mutants were finally selected, including T22K, K33E, Y38R, R42Q, Q64H, Y96H, F132L, K152E, Q155V, E171A, P210L and D232H.

[0051] (2) Establishment of mutation libraries based on computer-aided prediction:

[0052] FireProt was used to comprehensively assess the energy contribution of amino acid residues, and mutation sites were selected based on the folding free energy after protein amino acid residue mutations. These sites included D259V, G53D, D259C, D259A, P129D, T268G, A45M, A45L, H120M, and Q158L. Using HotSpot Wizard 3.0, based on protein functional site annotation and multiple sequence alignment, thermally stable hotspots in flexible regions suitable for site-directed mutagenesis were screened. These sites included G53H, K60Q, V77F, L79M, P86G, V103C, T104S, C108G, T196Q, F207T, A94F, Y96D, I115F, L119F, and H120A.

[0053] (3) Construction of mutant libraries based on disulfide bond introduction strategy:

[0054] By using Discovery Studio software to predict potential disulfide bonds in PFHL, combinations of mutation sites with an overall score of 85 or higher were selected, ultimately yielding 15 pairs of candidate disulfide bond mutation sites.

[0055] The disulfide bond prediction of the PFHL structure was performed using the online tool Disulfide by Design, and 15 pairs of mutation sites with the top five scores in each parameter were selected.

[0056] By comparing the prediction results of the two methods, mutation combinations that may interfere with the conformation of the catalytic active center were excluded, and finally 5 pairs of disulfide bond mutation sites were retained, including: G185C / Y241C, F18C / I147C, N54C / L87C, L36C / A41C and A116C / L164C.

[0057] Example 2. Single-point mutation of PFHL and screening of single-point lipase mutants

[0058] (1) Construction, expression and purification of single-point mutants:

[0059] Using pET-28a(+)-Pfhl plasmid as a template, reverse PCR was performed using the corresponding primers to introduce the following mutations into PFHL: A94F, Y96D, C108G, I115F, L119F, H120A, P157L, F207T, Y38R, Q64H, K152E, Q155V, G53D, P129D, Q158L, D259V, T268G, T22K, E171A, D232H, R42Q, P210L, F132L, G185C / Y241C, F18C / I147C, and A116C / L164C. Recombinant plasmids containing mutant genes encoding mutations at different sites were obtained.

[0060] The primers involved are as follows:

[0061] A94F-F: AGGGCCCGCTGGCCGCCCGTTATGTGGCTTTTCTGTATCCGGAA (SEQ ID NO: 4);

[0062] A94F-R: TAACGGGCGGCCAGCGGGCCCTGGCTATG (SEQ ID NO: 5);

[0063] Y96D-F: GCCCGTTATGTGGCTGCACTGGATCCGGAAAA (SEQ ID NO: 6);

[0064] Y96D-R: AGTGCAGCCACATAACGGGCGGCCAGC (SEQ ID NO: 7);

[0065] C108G-F: AGTTGCCAGCGTTACCAGTGTGAGTGGTCCGAATCATGGTAGC (SEQ ID NO: 8);

[0066] C108G-R: CACACTGGTAACGCTGGCAACTTTTTCCGGAT (SEQ ID NO: 9);

[0067] I115F-F: GAGTTGTCCGAATCATGGTAGCGAATTTGCAGATCAGCTG (SEQ ID NO: 10);

[0068] I115F-R: CGCTACCATGATTCGGGACAACTCACACTGGTAACG (SEQ ID NO: 11);

[0069] L119F-F:

[0070] CGAATCATGGTAGCGAAATTGCAGATCAGTTTCATAAAGCCCTGACCC(SEQ ID NO:12);

[0071] L119F-R:TCTGCAATTTCGCTACCATGATTCGGACAACTCACACT(SEQ ID NO:13);

[0072] H120A-F:GAAATTGCAGATCAGCTGGCCAAAGCCCTGACCCCG(SEQ ID NO:14);

[0073] H120A-R:GCTACCATGATTCGGACAACTCAC(SEQ ID NO:15);

[0074] P157L-F:TCATCCGAAAAATCCGCAGGATCTGCAGGCAG(SEQ ID NO:16);

[0075] P157L-R:TCCTGCGGATTTTTCGGATGACCACTAATCAGGCT(SEQ ID NO:17);

[0076] F207T-F:

[0077] ACTACAGCTGGAGCGGCATTCTGCAGAATACCCAGACCCCGCAGATTC(SEQ ID NO:18);

[0078] F207T-R:GCAGAATGCCGCTCCAGCTGTAGTAGTAAACACCATTTTCAA(SEQ ID NO:19);

[0079] Y38R-F:TTTTTTGATATTAAAGAGGCGCTGGAAGGTGCAGGTGCAC(SEQ ID NO:20);

[0080] Y38R-R:TCCAGCGCCTCTTTAATATCAAAAAAATACGGATAACCGGCAATGG(SEQ ID NO:21);

[0081] Q64H-F:AACGTGGTGAAAAACTGCTGGAAGATGTGAATCGCATTCT(SEQ ID NO:22);

[0082] Q64H-R:TCCAGCAGTTTTTCACCACGTTCTTCATTACCA(SEQ ID NO:23);

[0083] K152E-F: TATTAGCCTGATTAGTGGTCATCCGGAAATCCGCAGGAT(SEQ ID NO:24);

[0084] K152E-R:GGATGACCACTAATCAGGCTAATAAAGGTACCCACGG(SEQ ID NO:25);

[0085] Q155V-F:CTGATTAGTGGTCATCCGAAAAATCCGGTGGATCCGCAGGC(SEQ ID NO:26);

[0086] Q155V-R:ATTTTTCGGATGACCACTAATCAGGCTAATAAAGGTACCC(SEQ ID NO:27);

[0087] G53D-F:TGTTTGCAGTTAATATTCCGGCAGTGAATGATAATGAAGAACGTGG(SEQ ID NO:28);

[0088] G53D-R: TTCACTGCCGGAATATTAACTGCAAACACACGTGCACCT(SEQ ID NO:29);

[0089] P129D-F:ATAAAGCCCTGACCCCGGGTGAACTGGATGAAGCCTTTGCCCT(SEQ ID NO:30);

[0090] P129D-R:GTTCACCCGGGGTCAGGGCTTTATGCAGCTGATCTGC(SEQ ID NO:31);

[0091] Q158L-F:AAAAATCCGCAGGATCCGCTGGCAGCCTTTG(SEQ ID NO:32);

[0092] Q158L-R:GCGGATCCTGCGGATTTTTCGGATGACCACT(SEQ ID NO:33);

[0093] D259V-F:

[0094] ATTCGCAGTGATTATCCGATGGATCATTTGTGGCCGTGAATCAGATGG(SEQ ID NO:34);

[0095] D259V-R:AAAATGATCCATCGGATAATCACTGCGAATAACTTTGCCCAGA(SEQ ID NO:35);

[0096] T268G-F:TTGATGCCGTGAATCAGATGGCCGGCATTGGCAGCTGGAATGTGA(SEQ ID NO:36);

[0097] T268G-R:AATGCCGGCCATCTGATTCACGGCATCAAAATGATCCATC(SEQ ID NO:37);

[0098] T22K-F:TGCTGGTGCATGGCCTGTTTGGCTTTGATAAAATTCCGGTTATCCG(SEQ ID NO:38);

[0099] T22K-R:AAAGCCAAACAGGCCATGCACAGCACAATCGGAT(SEQ ID NO:39);

[0100] E171A-F:GTCTGACCAGTGCCGGTCTGGCCGCATTTAATCGCAAT(SEQ ID NO:40);

[0101] E171A-R:GGCCAGACCGGCACTGGTCAGACTTTCAAAGGCTG(SEQ ID NO:41);

[0102] D232H-F:TGAGCAAACTGTTTAAAGAAAAAGGCGCAAACGATGGCCTG(SEQ ID NO:42);

[0103] D232H-R:TTTCTTTATAAAACAGTTGCTCAGCACAATGCA(SEQ ID NO:43);

[0104] R42Q-F:AGGCGCTGGAATATGCAGGTGCACAGGTGTTTGCAGTTAAT(SEQ ID NO:44);

[0105] R42Q-R:TGCACCTGCATATTCCAGCCGCCTCTTTAATATCA(SEQ ID NO:45);

[0106] P210L-F:GGCATTCTGCAGAATTTTCAGACCCTGCAGATTCTGGAT(SEQ ID NO:46);

[0107] P210L-R:TCTGAAAATTCTGCAGAATGCCGCTCCAGC(SEQ ID NO:47);

[0108] F132L-F:CGGGTGAACTGCCGGAAGCCCTGGCCCTGGCACT(SEQ ID NO:48);

[0109] F132L-R:GGCTTCCGGCAGTTCACCCGGGGTCAGG(SEQ ID NO:49);

[0110] G185C-F:GCAGGGCGTTCCGAAAGTGTGGTGCGGTGAAGGTAA(SEQ ID NO:50);

[0111] Y241C-R: AGCGGCCAACCAGGCCATCGTTTGCGTC (SEQ ID NO:51)

[0112] G185C-R:CACACTTTCGGAACCGCCCTGCGGATATTTGC(SEQ ID NO:52);

[0113] Y241C-F:CGATGGCCTGGTTGGCCGCTGTAGTAGTCATCTGGG(SEQ ID NO:53);

[0114] F18C-F:ATTGTGCTGGTGCATGGCCTGTGTGGCTTTGATACC(SEQ ID NO:54);

[0115] I147C-R: ATAAAGGTACCCACGGCGCTCAGCAGTGCCA (SEQ ID NO:55);

[0116] F18C-R:ACAGGCCATGCACCAGCACAATCGGATACTGG(SEQ ID NO:56);

[0117] I147C-F:

[0118] GCTGAGCCGCCGTGGGTACCTTTATTAGCCTGTGCAGTGGTCATCCGAAAAATC (SEQ ID NO: 57);

[0119] A116C-F: GAATCATGGTAGCGAAATTTGCGATCAGCTGCATAAAGCCCTG (SEQ ID NO: 58);

[0120] L164C-R: CTGCGGATTCCTGCGGATTT (SEQ ID NO: 59);

[0121] A116C-R: GGACAACTCACACTGGTAACGCT (SEQ ID NO: 60);

[0122] L164C-F: GCAGCCTTTGAAAGTTGTACCAGTGCCGGTCTG (SEQ ID NO: 61);

[0123] Recombinant plasmids containing mutant genes encoding mutations at different sites were transformed into E. coli BL21 after verification. The strain was cultured to induce the expression of mutant enzymes, and further purification was performed to obtain pure enzymes of each mutant. The purification results of the mutants are shown below. Figure 1 As shown in (a), the mutant purified enzymes were named A94F, Y96D, C108G, I115F, L119F, H120A, P157L, F207T, Y38R, Q64H, K152E, Q155V, G53D, P129D, Q158L, D259V, T268G, T22K, E171A, D232H, R42Q, P210L, F132L, G185C / Y241C, F18C / I147C, and A116C / L164C.

[0124] The purification results of the mutants showed that different mutants were successfully expressed in Escherichia coli. The purity of the purified enzyme solutions varied, but the molecular weight was similar to that of the wild type, all remaining around 33.8 kDa. Single-point mutant strains and double-point mutant strains were obtained.

[0125] (2) Screening of single-point mutants:

[0126] Under the same culture conditions, the initial screening enzyme activity of the single-point mutant strains obtained in step (1) was determined. Based on the initial screening results of Example 1, the wild-type enzyme activity was set to 100%. Superior mutants with relative enzyme activity higher than 100% were selected, and mutants with significantly reduced catalytic efficiency were removed. Their half-life was further measured, and mutants with a higher half-life extension effect than the wild-type were screened. The screening results are as follows: Figure 1 As shown in (b).

[0127] according to Figure 2 (b) The results screened out 13 mutants with both high catalytic efficiency and good enzyme activity, including G53D, Y38R, K152E, E171A, D232H, K60Q, P86G, C108G, F207T, A94F, Q155V, H120A and F18C / I147C. Among them, the enzyme activity of mutant G53D was not significantly increased. Among the other 12 mutants, C108G showed the most outstanding performance, with enzyme activity increased by 586.76% compared with wild type.

[0128] (3) Thermal stability analysis of single-point mutants:

[0129] To assess the thermostability changes of single-point mutants, the thermostability of 12 mutants with stable enzyme activity was determined at 60℃. The results are as follows: Figure 1 As shown in (c).

[0130] As shown in the figure, mutants F207T, P86G, E171A, K60Q, H120A, and K152E exhibited varying degrees of improved thermostability, with their half-lives increasing to 2.52 h, 3.92 h, 2.67 h, 2.86 h, 4.12 h, 9.46 h, and 3.02 h, respectively. Among them, the optimal mutant H120A showed the most significant improvement in thermostability, with a half-life of 9.46 h, which was 3.75 times longer than the wild type, and an enzyme activity increase of 43.64%.

[0131] In summary, among the single-point mutants of PFHL obtained through molecular modification of the enzyme, K60Q, P86G, H120A, K152E, E171A, and P207T showed significantly improved enzyme activity and thermostability. Therefore, these mutants were selected for subsequent experiments.

[0132] Example 3. Combinatorial mutagenesis based on positive mutation points and screening of combined lipase mutants

[0133] To further enhance the rational modification effect, this embodiment uses the six effective single-point mutants (K60Q, P86G, H120A, K152E, E171A, and P207T) screened in Example 2 as a basis to construct two-point, three-point, and four-point combined mutants sequentially, and rigorously evaluates changes in enzyme activity and thermostability in each round of mutation. After multiple rounds of screening, combined mutations are then performed with the effective mutant F18C / I147C, which introduces disulfide bonds. The combined mutation strategy aims to achieve a stepwise improvement in lipase performance through the cumulative effect of single-point mutations and the synergistic optimization of stability. The specific steps are as follows:

[0134] (1) Construction, expression and purification of combinatorial mutants:

[0135] The combined mutants were constructed using corresponding single-point mutant plasmids as templates and with corresponding primers. The mutated plasmids were then transformed into *E. coli* DH5α, and after successful sequencing verification, they were transformed into *E. coli* BL21 for induced expression. A schematic diagram of the combined mutant iteration process is shown below. Figure 2 (a) The purification results of the mutant are as follows Figure 2 As shown in (b).

[0136] As shown in the figure, the mutant was successfully expressed in E. coli. The purity of the enzyme solutions obtained after purification varied, but the molecular weight was similar to that of the wild type, all remaining around 33.8 kDa.

[0137] (2) Activity and thermal stability analysis of the two-point combination mutant:

[0138] The enzyme activity assay results of the two-point mutant are as follows: Figure 2 As shown in (c). Compared with wild-type WT, most mutants showed significant increases in specific enzyme activity to varying degrees, with mutant T12 showing an increase to 408.57%. Thermostability analysis results of the two-point mutants ( Figure 2 (d) shows that the thermal stability of mutants such as T1, T2, T3, T4, T5, T6, T7, T8, T9 and T11 is improved. Among them, the half-life of mutant T8 at 60℃ is increased from 2.52 h of wild type to 12.39 h, which is 4.92 times that of wild type.

[0139] (3) Activity and thermal stability analysis of multi-point combination mutants:

[0140] When the number of mutation sites increases from two to three or four, the probability of loss of enzyme activity and thermal stability in the mutant increases significantly.

[0141] like Figure 2 As shown in (e), mutants with significantly increased enzyme activity include TH3, TH2, M5, M1, TH14, TH9, M2, and TH10, which increased relative enzyme activity by 895.99%, 274.82%, 237.69%, 237.50%, 155.39%, 140.65%, 122.33%, and 117.08% compared to the wild type, respectively. Among them, mutant TH3 showed the most significant increase in enzyme activity, almost nine times that of the wild type. Regarding thermostability, Figure 2 (f) The results showed that the mutant TH10 had the most significant improvement in thermal stability, with its half-life increasing from 2.52 h in the wild type to 16.13 h, an increase of more than 6 times.

[0142] In summary, based on the results of thermal stability and enzyme activity assays, the performance of the above mutants was comprehensively evaluated, and the top five mutants with excellent performance were selected: TH10, T8, T6, TH8, and T7.

[0143] Example 4. Enzymatic Properties Analysis of Effective Mutants

[0144] This embodiment details the determination and analysis of the enzymatic properties of the mutants TH10, T8, T6, TH8, and T7 obtained in Example 3. The specific steps are as follows:

[0145] (1) Optimal reaction temperature and temperature stability of effective mutants:

[0146] Figure 3 (a) The results showed that, except for T6, the optimal reaction temperature for the other mutants decreased to 50℃. After incubation at 60℃ for 1 h, the residual enzyme activities of the TH10, T8, T6, TH8, and T7 mutants were all higher than those of the wild type, at 93.93%, 95.53%, 93.39%, 94.08%, and 98.05%, respectively. Further measurements showed that the residual enzyme activities of T8, T7, and T6 at 70℃ were also significantly higher than those of the wild type, at 95.19%, 97.69%, and 93.23%, respectively, indicating that these mutants have better thermal stability under high-temperature conditions.

[0147] (2) Optimal reaction pH and pH stability of effective mutants:

[0148] The optimal reaction pH for mutant T7 decreased to 6.0, while the optimal reaction pH for TH10, TH8, T8, and T6 all increased to 8.0. Figure 3 (b)). The pH stability of all mutants was lower than that of the wild type, indicating that the stability of these mutants was reduced under different pH conditions.

[0149] (3) Response kinetic parameters of effective mutants: using pNPC 12 Using substrates, enzyme activities were measured at different substrate concentrations. Based on the relationship between substrate concentration and initial reaction rate, the Michaelis-Menten equation was used to calculate the kinetic parameters Vmutant and wild-type enzymes. max K m k cat and k cat / K m The values ​​are shown in Table 1.

[0150] Table 1. Kinetic parameters of mutant and wild-type enzymes

[0151]

[0152] As can be seen from the table, compared with the wild type, TH8's K m The value is the lowest, only 1.06 mM, indicating that it has the strongest affinity for the substrate. The V of T6 is... max and k cat The highest value was achieved, reaching 1210.67 μmol·min. -1 ·mg -1 and 1522.85 min -1 The K value of T6 is significantly better than other mutants and the wild type, indicating that T6 possesses stronger catalytic activity. cat / K m The highest value was 753.76 mM. -1 ·min -1 It is 8.14 times that of the wild type, indicating that it performs best in terms of substrate catalytic efficiency.

[0153] Example 5. Determination of the lipid hydrolysis ability of mutant T6

[0154] To evaluate the catalytic performance of the optimal mutant T6 obtained in Example 4 on the natural substrate olive oil, this example measured the degree of hydrolysis of wild-type WT and mutant T6 at different reaction times. The results are as follows: Figure 4 As shown.

[0155] As shown in the figure, the degree of hydrolysis of both WT and T6 increased with increasing reaction time, but T6 was higher than WT at all time points, and its advantage gradually increased as the reaction progressed. T6 exhibited superior hydrolytic performance compared to WT throughout the entire reaction, especially at 60 min, where the average degree of hydrolysis of T6 was 18.76%, 3.04 times that of WT (6.17%), indicating that T6 significantly improved the initial hydrolysis rate of olive oil. Subsequently, the degree of hydrolysis of both T6 and WT steadily increased, but T6 maintained a consistently higher level. After 180 min, the degree of hydrolysis of WT showed a certain decreasing trend, decreasing from 40.13% at 150 min to 39.63% at 180 min, indicating that its hydrolytic activity decreased in the later stages of the reaction. This may be because as the reaction time increases, WT reaches its thermal stability half-life, and the protease begins to partially inactivate, resulting in a decrease in catalytic ability and thus a slight decrease in the degree of hydrolysis; while T6 continues to increase its degree of hydrolysis within the same reaction time, from 45.29% at 150 min to 54.62% at 180 min, indicating that it has better thermal stability and catalytic persistence under long-term reaction conditions.

[0156] The amino acid sequence of the T6 mutant is shown in SEQ ID NO:2, and the nucleotide sequence encoding the T6 mutant is shown in SEQ ID NO:3.

[0157] Example 6. Catalytic performance determination of mutant T6 in the synthesis of biodiesel from kitchen waste oil

[0158] To evaluate the catalytic performance of the optimal mutant T6 obtained in Example 4 in the synthesis of biodiesel from kitchen waste oil, this example measured the catalytic effects of wild-type WT and mutant T6 on the biodiesel synthesis reaction under the same enzyme-waste oil reaction mass ratio, in order to preliminarily verify the applicability and catalytic potential of lipase mutant T6 to industrial waste oil substrates.

[0159] Using a low enzyme addition condition with a lipase to kitchen waste oil mass ratio of 1:666.7, catalytic reaction systems of wild-type WT lipase and mutant T6 lipase were constructed respectively. The reaction was carried out under the same reaction temperature, methanol addition ratio and stirring conditions, and the formation of fatty acid methyl ester, a key product of biodiesel, in the reaction system was analyzed by gas chromatography.

[0160] The results showed that characteristic signal peaks of fatty acid methyl esters, such as methyl stearate, methyl palmitate, and methyl oleate, key components of biodiesel, could be detected in the reaction system catalyzed by mutant T6. The total conversion rate of biodiesel from waste cooking oil catalyzed by T6 reached 60%–80%, indicating its ability to catalyze the conversion of waste cooking oil into key biodiesel products. In contrast, under the same conditions, the total conversion rate of fatty acid methyl esters in the reaction system catalyzed by WT was only 15%–25%, indicating extremely weak catalytic ability for waste cooking oil at this low enzyme dosage, failing to achieve effective conversion. Therefore, compared to WT, T6 exhibits certain catalytic activity and substrate adaptability to waste cooking oil substrates, and still possesses the ability to drive biodiesel synthesis reactions at extremely low enzyme dosages, demonstrating good potential for industrial application.

[0161] In summary, this invention utilizes consensus sequence analysis, computer-aided prediction, and disulfide bond introduction strategies to molecularly modify the lipase PFHL derived from *Pseudomonas fluorescens* HK44, obtaining a mutant T6 with significantly enhanced thermal stability. The optimal reaction temperature for mutant T6 is 60°C, and after reacting at 60°C for 1 hour, its residual enzyme activity remains at 98.05%, demonstrating excellent thermal stability and catalytic persistence. Mutant T6 can be used for oil hydrolysis and catalytic synthesis of biodiesel, exhibiting a wide range of applications and high practicality.

[0162] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A mutant T6 of the thermostable lipase PFHL, characterized in that, The mutant T6 was subjected to a site-directed mutation based on the wild-type lipase PFHL, whose amino acid sequence is shown in SEQ ID NO:1; the site-directed mutation includes: (1) Mutate amino acid P at position 86 to G; and / or (2) Mutate the 120th amino acid H to A.

2. The mutant T6 according to claim 1, characterized in that, The amino acid sequence of the mutant T6 is shown in SEQ ID NO:

2.

3. A biomaterial, characterized in that, The biomaterials include genes, expression cassettes, recombinant expression vectors, recombinant engineered bacteria or cells; The gene encodes the mutant T6 as described in claim 1 or 2; The expression cassette contains the gene; The recombinant expression vector contains the gene or the expression cassette; The recombinant engineered bacteria or cells contain any one of the gene, expression cassette, and expression vector, or express the mutant T6 as described in claim 1 or 2.

4. The biomaterial according to claim 3, characterized in that, The nucleotide sequence of the gene is SEQ ID NO:3 or its degenerate sequence.

5. The application of the mutant T6 of the thermostable lipase PFHL as described in claim 1 or 2 in the catalytic hydrolysis of lipids.

6. A method for catalytic hydrolysis of oils and fats, characterized in that, The method includes using the mutant T6 described in claim 1 or 2 as a catalyst for the hydrolysis reaction of fats and oils.

7. The application of the mutant T6 of the thermostable lipase PFHL as described in claim 1 or 2 in the catalytic synthesis of biodiesel.

8. The application according to claim 7, characterized in that, In this application, waste cooking oil is catalyzed to synthesize biodiesel.

9. A method for synthesizing biodiesel from catalytic waste cooking oil, characterized in that, The method includes: The mutant T6 described in claim 1 or 2 is mixed with pretreated kitchen waste oil, and then methanol is added to it. The mixture is reacted in a shaker, and centrifuged after the reaction is complete to obtain biodiesel.

10. The method according to claim 9, characterized in that, The mass ratio of the purified mutant T6 to the pretreated kitchen waste oil was 1:666.7; The total amount of methanol added is in a molar ratio of 3:1 to the waste cooking oil, and is added in three portions. The reaction conditions were: 45°C, 240 rpm in a shaker for 48 h.

Images