Rice wx gene promoter cis-acting element and application thereof

Abstract

This invention discloses a rice Wx Gene promoter cis-regulatory elements and their applications belong to the field of genetic engineering technology. The promoter cis-regulatory elements are located in... Wx The sequence CACG is located 2808 bp to 2805 bp upstream of the ATG gene translation start codon. This invention successfully obtained various different [genes / products] through CRIPSR / Cas9 gene editing. Wx This invention edits the cis-acting elements of the gene promoter and synergistically improves multiple rice cooking and eating quality indicators. It not only enriches the allele types of Wx but also provides a novel and important target for rice quality improvement breeding. The various Wx mutants obtained in this invention do not affect agronomic traits such as growth, development, and yield, further verifying the promising application prospects and high application value of this invention in creating new germplasm for rice quality improvement.

Description

Technical Field

[0001] This invention relates to a type of rice Wx Gene promoter cis-acting elements and their applications belong to the field of genetic engineering technology. Background Technology

[0002] Rice is a vital food crop globally, providing staple food for more than half of the world's population, including over 60% of my country's population. With rising economic levels, people are increasingly demanding higher quality rice. Rice quality is a crucial factor influencing its commercial value and consumer demand. Starch is the most abundant storage substance in the endosperm, existing primarily in two forms: linear or minimally branched amylose and highly branched amylopectin. While amylose accounts for only 0%-30% of total starch, it is considered the most critical factor affecting the cooked and flavorful quality of rice. For example, rice with higher amylose content has a higher gelatinization temperature, lower gel consistency, and a looser, drier texture; conversely, rice with lower amylose content has a higher gel consistency, resulting in stickier, softer rice. The starch-binding enzyme (GBSSI) is the only enzyme in the endosperm responsible for amylose synthesis, and is produced by… Waxy ( Wx ) gene (also known as OsGBSSI Gene encoding. Wx Loss of gene function leads to the complete absence of amylose in the endosperm, resulting in an opaque, waxy endosperm that forms glutinous rice. Glutinous rice is only suitable for processing into special foods and is not suitable as a staple food.

[0003] Currently, rice quality is mainly improved through two methods. One method is to control the content of medium to low amylose. Wx Alleles (e.g.) Wx b W x mq (e.g., [various methods]) are introduced into varieties with high amylose content through hybridization, thereby reducing amylose content and improving rice quality. On the other hand, gene editing technology is used to […]. Wx Editing gene promoters and coding regions to change Wx Gene expression levels and enzyme activity can be adjusted to fine-tune amylose content, thereby improving rice quality through breeding. However, the number of existing natural Wx allelic variations, especially superior alleles, is very limited and cannot meet breeding needs. Furthermore, most gene editing methods are based on software-predicted cis-acting elements, resulting in a limited number of available cis-acting elements, and the editing effect of some elements is poor. Summary of the Invention

[0004] Purpose of the invention: The primary purpose of this invention is to provide a rice Wx Gene promoter cis-acting elements and their applications. A second objective of this invention is to provide a method for regulating rice... Wx Methods for improving rice quality by adjusting gene expression, amylose content, or other parameters.

[0005] Technical solution: The rice described in this invention Wx Gene promoter cis-acting element, the promoter cis-acting element being located at Wx The sequence from -2808 bp to -2805 bp upstream of the gene translation start codon ATG is CACG.

[0006] The rice described in this invention Wx Gene promoter cis-acting elements regulate rice Wx Applications in gene expression levels and / or amylose content in rice.

[0007] Furthermore, the application utilizes gene editing. Wx Gene Acquisition wx Mutants make rice Wx Gene expression levels and / or amylose content in rice decreased.

[0008] Furthermore, the aforementioned wx Mutants include one or more of CATCG, CAACG, CCG, and CAG.

[0009] The present invention describes a method for regulating rice Wx Methods for gene expression, amylose content, or improvement of rice quality include the following steps: designing rice... Wx The target sequence of the gene promoter cis-acting element is obtained by using CRISPR / Cas9 genome editing technology to induce base mutations, deletions, or insertions in the promoter cis-acting element sequence.

[0010] Furthermore, the target sequence is shown in SEQ ID NO.1.

[0011] Furthermore, the designed CRISPR / Cas9 vector was transformed into rice using Agrobacterium and genetically modified rice plants were obtained through screening.

[0012] Furthermore, the rice variety mentioned is Nipponbare.

[0013] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention successfully obtained a variety of different genes through CRIPSR / Cas9 gene editing. WxThe editing of cis-acting elements in the gene promoter and the synergistic improvement of multiple rice cooking and eating quality indicators not only enrich the allele types of Wx but also provide a novel and important target for rice quality improvement breeding. The various Wx mutants obtained in this invention do not affect agronomic traits such as growth, development, and yield, further verifying the promising application prospects and high application value of this invention in creating new germplasm for rice quality improvement. Attached Figure Description

[0014] Figure 1 OsNAC24 can be directly bound to... Wx CACG elements on gene promoters. (A) Identified by ChIP-seq technology. Wx The cis-acting element sequence on the gene promoter is indicated by red letters, and the mutant base is indicated by blue. (B) In vitro EMSA experiments confirmed that OsNAC24 directly binds to... Wx When a mutation occurs in the bases of the CACG cis-acting element on the gene promoter, the binding ability is weakened or eliminated.

[0015] Figure 2 Successfully edited genes using the CRISPR / Cas9 gene editing system Wx CACG element on gene promoter. (A) Wx A schematic diagram of the gene promoter structure and the location of the editing target site. (B) Different types of edits obtained after editing. Wx Allele sequencing identification results. (C) Identification of edited plants without transgenic vectors in F2 generation by PCR technology.

[0016] Figure 3 Editing of CACG elements reduced the amount of CACG in the endosperm. Wx Gene transcription levels and amylose content. (A) Detection of wild-type and... wx In mutants Wx Gene expression levels. (B) Wild type and wx Detection of amylose content in mature mutant rice.

[0017] Figure 4 . Wx Editing of CACG at the gene promoter improved the cooked and palatable quality of rice. (A) Wild type and different wx Observation of the appearance of rice from mutants. (B) Wild type and wx Determination of gel consistency in mutant rice. (C) Wild type and wx Determination of gelatinization temperature of mutant rice. (D) Wild type and wx Determination of the taste value of mutants.

[0018] Figure 5 . Wx Editing of the CACG gene promoter does not affect agronomic traits such as plant architecture and grain type in rice. (A) Wild type and wx Phenotypic observation of mutant rice plants. (BD) Under field growing conditions, wild-type and... wx Agronomic traits such as plant height, number of tillers, and yield per plant were determined in the mutants. (E) Wild type and wx Observation of the appearance of mature seeds of mutants. (FH) wild type and wx Results of agronomic traits testing of mature seeds of mutants, including seed length, seed width, and thousand-seed weight. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] Example 1: Direct binding of OsNAC24 Wx CACG sequence elements on gene promoters Given that most existing research relies on software prediction to find... Wx The number of cis-acting elements on gene promoters is limited, and their effects are unpredictable and highly indeterminate. This results in very few cis-acting elements ultimately being usable. To address this shortcoming, the inventors of this application, in previous research, cloned and identified a... Wx The direct positive regulator of genes is OsNAC24. Studies have shown that OsNAC24 can bind to... Wx The gene promoter contains at least four cis-regulatory elements. These cis-regulatory elements are different from previously predicted elements; they are actual, identified, and functional cis-regulatory elements that bind to cis-regulatory elements. One of these cis-regulatory elements, CACG, is... Wx A novel element identified on the gene promoter, which has not been edited or utilized in previous studies. Using a polyclonal antibody against the OsNAC24 protein (prepared by Shanghai Wenyuange Biotechnology Co., Ltd.), to... OsNAC24 Using the immature endosperm of transgenic rice plants overexpressing the OsNAC24 gene as material, chromatin immunoprecipitation sequencing (ChIP-seq) was performed to analyze the binding motif of OsNAC24 in the plant and the classic binding core sequence CACG of NAC family members. Wx The binding motif of OsNAC24 was searched on the gene promoter to determine the location of the CACG element, and this was verified using ChIP-qPCR, confirming that the CACG sequence was enriched in the immunoprecipitation fraction. Subsequently, OsNAC24 protein was expressed and purified in *E. coli* to... WxThe sequence containing the CACG motif on the gene promoter was used as a probe. Simultaneously, CACG bases were mutated one by one, and in vitro gel electrophoresis (EMSA) was performed to further confirm the authenticity and strength of OsNAC24's binding to CACG. Finally, dual-fluorescence reporter assay (Du-LUC) technology was used in rice protoplasts to confirm that OsNAC24 can activate... Wx Gene expression, and OsNAC24 Loss-of-function mutations can reduce Wx Gene expression levels. In summary, CACG is Wx A novel cis-acting element has been identified on the gene promoter. Figure 1 (As shown).

[0021] Example 2: Successfully edited genes using CRISPR / Cas9 gene editing technology. Wx Gene promoter CACG element Sequence analysis showed that the CACG sequence was located in the... Wx The gene translation start codon is located 2808 bp to 2805 bp upstream of the ATG codon ( Figure 2 A), for Figure 1 The first red element in A is located at position 1; the second element was not successfully edited during the study. This invention employs CRISPR / Cas9 gene editing technology, and the CRISPR / Cas9 gene editing systems used are pYLgRNA-OsU3 and pYLCRISPR / Cas9-MH (the construction process is based on Xie, X., Ma, X., Zhu, Q., Zeng, D., Li, G. and Liu, YG (2017) CRISPR-GE: A convenient software toolkit for CRISPR-based genome editing. Mol. Plant 10,1246–1249).

[0022] The target sequence for editing was designed and synthesized using the website (http: / / skl.scau.edu.cn / targetdesign / ): CCAAGTCAAATTAGCCACGTAGG (SEQ ID NO.1). The synthesized target primer sequences (SEQ ID NO.2: GGCaccaagtcaaattagccacgt, SEQ ID NO.3: AAACACGTGGCTAATTTGACTTGG) were annealed to form double strands and then digested with enzymes. BsaI (product number: R3733V, manufacturer: NEB) and T4 ligase (product number: M1794, manufacturer: Promega) are inserted into the vector pYLgRNA-OsU3.

[0023] The gRNA expression cassette was amplified using a two-round nested PCR: the first round of PCR was performed in two tubes. The primers for the first tube were: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO.4) + AAACACGTGGCTAATTTGACTTGG (SEQ ID NO.5). The primers for the second tube were: CGAGGAAAATTCCATCCAC (SEQ ID NO.6) + GGCaccaagtcaaattagccacgt (SEQ ID NO.7). Prepare the PCR reaction system as follows: 7.5 μL 2×PCR buffer, 1 μL template, 0.4 μL each of 10 μM primers, 0.3 μL KOD Fx neo high-fidelity enzyme (product number: KFX-201, manufacturer: Toyobo), and 5.4 μL sterile water. After mixing, perform the following reaction program on the PCR instrument: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 20 s, return to step two, and repeat 27 times to complete the PCR reaction. Second round PCR reaction: Take 1 μL of each of the two tubes of product from the first round PCR reaction, add 8 μL of sterile water to dilute, and take 1 μL as the template for the second round PCR reaction. The primers for the second round of PCR were: TTCAGAGGggtctcTctcgACTAGTGGAATCGGCAGCAAAGG (SEQ ID NO.8) + AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC (SEQ ID NO.9). The PCR reaction system was as follows: 10 μL of 2×PCR buffer, 1 μL of template, 0.3 μL each of 10 μM primers, 0.4 μL of KOD Fxneo high-fidelity enzyme, and 8 μL of sterile water. After mixing, the following reaction program was performed on the PCR instrument: denaturation at 98℃ for 10 s, annealing at 58℃ for 15 s, extension at 68℃ for 20 s, and then returning to the first step for 20 cycles to complete the PCR reaction.

[0024] The obtained gRNA expression cassette was inserted into the pYLCRISPR / Cas9-MH vector to form a recombinant plasmid, which was then transformed into competent DH5α cells. Positive clones were selected, and the target sequence was verified by gene sequencing. The recombinant plasmid was then extracted using a plasmid miniprep kit and transformed into Agrobacterium tumefaciens strain EHA105. After selecting positive clones, the strain was infected, genetically transformed, and screened with wild-type Nipponbare rice mature seeds.

[0025] PCR amplification and sequencing were performed on successfully transformed transgenic rice seedlings (PCR primers: AGGCACCACTGGGTGTACTA (SEQ ID NO.10), AGCTTGTCGTCATTCCGTAGG (SEQ ID NO.11); PCR reaction system and procedure: 10 μL of 2×Taq Mix (product number: P111-03, manufacturer: Novizan), 0.5 μL each of 10 μM primers, 1 μL of DNA template, and 8 μL of sterile water. After homogenization, the mixture was pre-denatured at 95℃ for 3 min, denatured at 95℃ for 15 s, annealed at 58℃ for 15 s, extended at 72℃ for 30 s, and then cycled 35 times to complete the PCR. Sequencing was performed using one forward primer from the PCR process). Four different editing forms were successfully obtained. wx Mutant. According to sequencing results, wx-1 Insert one T base at the target site. wx-2 Insert a base A at the target site. wx-3 Delete one base A at the target site. wx-4 Delete a base G at the target site ( Figure 2 B). Furthermore, segregators without the transgenic vector were also screened from the T2 generation plants. Figure 2 C).

[0026] Example 3 Wx Mutations in the gene promoter CACG element reduce the concentration of CACG in the endosperm. Wx Expression level and amylose content To verify Wx The editing effect of the CACG element in the gene promoter was investigated using real-time quantitative PCR (RT-qPCR) (primer sequences: AACTGGCTGCTCCTTGA (SEQ ID NO.12), TTGGCAATAAGCCACACACA (SEQ ID NO.13). The RT-qPCR system and procedure were as follows: 10 μL of 2×TB Green (catalog number: RR420, manufacturer: TAKARA), 0.4 μL each of 10 μM primers, 2 μL of cDNA template, and 6.8 μL of sterile water. After mixing, the mixture was pre-denatured at 95℃ for 30 s, denatured at 95℃ for 5 s, annealed / extended at 60℃ for 30 s, and then cycled 40 times in the second step to complete the reaction) in immature endosperm 7 days after flowering. Wx Gene expression levels. The results showed that all wx In mutants Wx The expression levels were significantly reduced. Figure 3 A). Further studies on wild-type and wxThe apparent amylose content (used to characterize amylose content) in the mature endosperm of the mutant was determined, and the results showed that, compared with the wild-type plants, all... wx The apparent amylose content in the mutant was also significantly reduced, and this reduction level was similar to that in the mutant. Wx Gene expression levels are consistent ( Figure 3 B). The above results all indicate that, Wx Mutations in the CACG element on the gene promoter can indeed affect Wx Normal transcriptional levels of genes and synthesis of amylose.

[0027] Example 4 Wx Editing the CACG gene promoter element improves the cooking and eating quality of rice. Amylose content is generally negatively correlated with the cooked and palatable quality of rice. In this invention... Wx Editing gene promoters not only reduces Wx The gene expression level also decreased the amylose content of rice. To further verify whether this editing could improve the cooking and eating quality of rice, some cooking and eating indicators of wild type and mutant were measured. First, the gel consistency of rice was measured (operated according to the national standard method (GB / T 22294-2008)). Gelatin consistency is an important indicator reflecting the softness or hardness of cooked rice. Generally, the higher the gel consistency, the softer and more sticky the rice, and the better the taste, while the lower the gel consistency, the drier and harder the rice. In addition, existing studies have shown that gel consistency is generally inversely proportional to amylose content. The measurement results showed that all wx The gel consistency of the mutants was significantly increased. Figure 4 B), the gel length of wild-type rice is 83.37 mm. wx The mutant gel length ranged from 86.63 mm to 92.27 mm, indicating that the mutant rice was stickier and softer after cooking, resulting in an improved texture. Gelatinization temperature is another important indicator of cooking quality, and it is generally proportional to amylose content. The gelatinization temperature of the rice was determined using DSC. The results showed that, compared to the wild-type plant, wx The peak of the gelatinization curve of the mutant shifts slightly to the left. Figure 4 C), this shows wx The mutant rice exhibited a lower gelatinization temperature, indicating that the cooked rice was easier to cook and the cooking time was shorter. This is consistent with the reduced amylose content in the mutant. Subsequently, the overall palatability of the rice was measured using a palatability meter. The results showed that, compared to wild-type plants, all... wx The taste value of the mutant was also significantly improved. Figure 4 D).

[0028] Example 5 WxEditing of the CACG gene promoter element does not affect rice yield or other agronomic traits. In order to evaluate the present invention Wx The application value of CACG gene promoter editing in rice quality improvement was investigated, and other agronomic traits of rice were examined in detail. The results showed that, compared to wild-type plants, wx The mutant's plant height, tillering, and yield per plant were not significantly different from the wild type. Figure 5 BD), Explanation Wx Changes in gene expression levels do not affect the normal growth and development of rice plants. Further testing showed that... wx There were no significant differences in grain length, grain width, and thousand-grain weight between the mutant and the wild type. Figure 5 EH), further indicating Wx Changes in gene expression levels do not affect seed size.

Claims

1. A type of rice Wx Gene promoter cis-acting element, characterized in that, The promoter cis-acting element is located at Wx The sequence from -2808 bp to -2805 bp upstream of the gene translation start codon ATG is CACG.

2. The rice according to claim 1 Wx Gene promoter cis-acting elements regulate rice Wx Applications in gene expression levels and / or amylose content in rice.

3. The application according to claim 2, characterized in that, The application utilizes gene editing. Wx Gene Acquisition wx Mutants make rice Wx Gene expression levels and / or amylose content in rice decreased.

4. The application according to claim 2, characterized in that, The wx Mutants include one or more of CATCG, CAACG, CCG, and CAG.

5. A method for regulating rice Wx Methods for gene expression, amylose content, or improvement of rice quality, characterized in that: Includes the following steps: The design is aimed at the rice described in claim 1. Wx The target sequence of the gene promoter cis-acting element is obtained by using CRISPR / Cas9 genome editing technology to induce base mutations, deletions, or insertions in the promoter cis-acting element sequence.

6. The method according to claim 5, characterized in that, The target sequence is shown in SEQ ID NO.

1.

7. The method according to claim 5, characterized in that, The designed CRISPR / Cas9 vector was transformed into rice using Agrobacterium, and genetically modified rice plants were obtained through screening.

8. The method according to claim 7, characterized in that, The rice variety mentioned is Nipponbare.

Images