Editing method of tobacco polyphenol oxidase gene NtPPO-1, gRNA, primer pair, gene editing plasmid and kit and application thereof

Abstract

The application discloses a tobacco polyphenol oxidase gene NtPPO-1 editing method, gRNA, primer pair, gene editing plasmid and kit and application, and relates to the technical field of gene editing. The gRNA for editing the tobacco polyphenol oxidase gene NtPPO-1 targets the first exon of the tobacco polyphenol oxidase gene NtPPO-1, the nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2, the nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO: 7, and the NtPPO-1 gene number is LOC107811292. Creatively, the first exon of the tobacco polyphenol oxidase gene NtPPO-1 is used as an editing target region for double-target knockout editing, and a homozygous mutant plant with a large fragment deletion is obtained. Through RNA expression sequencing and RT-PCR detection on the homozygous mutant plant of the tobacco, it is shown that the expression amount of the homozygous mutant plant NtPPO-1 (LOC107811292) is significantly reduced, the PPO activity is obviously reduced, the browning phenomenon of the tobacco leaf is significantly reduced, and the quality of the tobacco leaf is significantly improved.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, specifically to a method for editing the tobacco polyphenol oxidase gene NtPPO-1, gRNA, primer pairs, gene editing plasmids, and their kits and applications. Background Technology

[0002] Commonly cultivated tobacco is an allotetraploid plant, and there are as many as 15 family genes of PPO genes in cultivated tobacco. Studies on tobacco NtPPO genes have found that different family genes have different effects on PPO activity in tobacco plants, and this effect may vary depending on the variety. Furthermore, tobacco PPO activity is not only related to the processing quality of tobacco leaves but also to the plant's resistance to diseases and pests. Therefore, when improving tobacco PPO activity through NtPPO gene knockout editing, it is necessary to balance the needs of quality improvement and disease and pest resistance. The tobacco polyphenol oxidase gene NtPPO-1 (LOC107811292) is not the most expressed and active family gene in cultivated tobacco. A certain degree of inactivation of this gene will not significantly alter the plant's PPO activity while significantly improving the curing quality of tobacco leaves, achieving a balance between plant physiological needs and economic value. Therefore, it is an excellent candidate gene for improving tobacco quality.

[0003] Therefore, those skilled in the art are dedicated to improving tobacco quality by editing the tobacco polyphenol oxidase gene NtPPO-1. Summary of the Invention

[0004] This invention provides a method, gRNA, primer pairs, gene editing plasmid, and kit for editing the tobacco polyphenol oxidase gene NtPPO-1, and its applications, aiming to solve the problems existing in the above-mentioned background art.

[0005] To achieve the above-mentioned technical objectives, the present invention mainly adopts the following technical solutions:

[0006] In a first aspect, the present invention discloses a gRNA for editing the tobacco polyphenol oxidase gene NtPPO-1, wherein the gRNA targets the first exon of the tobacco polyphenol oxidase gene NtPPO-1, the nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2, the nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO: 7, and the NtPPO-1 gene is numbered LOC107811292.

[0007] Secondly, the present invention discloses a primer pair for editing the tobacco polyphenol oxidase gene NtPPO-1, wherein the primer pair comprises a DNA molecule having the nucleotide sequence shown in SEQ ID NO. 3 to 6.

[0008] Thirdly, the present invention discloses a gene editing plasmid for editing the tobacco polyphenol oxidase gene NtPPO-1, wherein the gene editing plasmid comprises the gRNA of the tobacco polyphenol oxidase gene NtPPO-1 as described in claim 1 and the editing gene of Cas9.

[0009] Fourthly, this invention discloses a gene editing kit for the tobacco polyphenol oxidase gene NtPPO-1, comprising:

[0010] The primer pairs as described in the second aspect; and,

[0011] The first plasmid carrying the deoxynucleotide sequence corresponding to the basic gRNA; and,

[0012] A second plasmid carrying the Cas9 editing gene.

[0013] Fifthly, this invention discloses a kit for editing the tobacco polyphenol oxidase gene NtPPO-1, comprising the gene-editing plasmid as described in the third aspect; and reagents for maintaining the transformation activity of the gene-editing plasmid; wherein,

[0014] The gene editing plasmid carries a gRNA that edits tobacco polyphenol oxidase NtPPO-1. The gRNA targets the first exon of the tobacco NtPPO-1 gene. The nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2. The nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO: 7. The NtPPO-1 gene is numbered LOC107811292.

[0015] In a preferred embodiment of the present invention, the kit further includes a reagent containing Agrobacterium GV3101.

[0016] In a sixth aspect, the present invention discloses a host cell carrying a gene-editing plasmid as described in the third aspect.

[0017] In a seventh aspect, this invention discloses a method for constructing a gene-editing plasmid for the tobacco polyphenol oxidase gene NtPPO-1, comprising:

[0018] A first plasmid was obtained and primer pairs were synthesized. The first plasmid carries the deoxynucleotide sequence corresponding to the basic gRNA as shown in SEQ ID NO. 1 or 2. The primer pairs were designed based on the deoxynucleotide sequence corresponding to the basic gRNA. The target sequence of the gRNA is located in the first exon of the tobacco polyphenol oxidase gene NtPPO-1.

[0019] A recombinant plasmid carrying the deoxynucleotide sequence corresponding to the gRNA was obtained using primer pairs and the first plasmid;

[0020] The recombinant plasmid carrying the deoxynucleotide sequence corresponding to the gRNA is digested with enzymes to obtain the DNA molecule corresponding to the gRNA, and then ligated with the digested second plasmid sequence carrying the Cas9 enzyme-encoded gene to obtain the gene editing plasmid.

[0021] Eighthly, this invention discloses a method for editing the tobacco polyphenol oxidase gene NtPPO-1, comprising:

[0022] The gRNA of the tobacco polyphenol oxidase gene NtPPO-1 was obtained, wherein the target sequence of the gRNA is located in the first exon of the tobacco NtPPO-1 gene, the nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2, the nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO: 7, and the NtPPO-1 gene is numbered LOC107811292;

[0023] A gene-editing plasmid for editing the tobacco NtPPO-1 gene was constructed using the gRNA described above.

[0024] The gene-editing plasmid was transferred into Agrobacterium tumefaciens;

[0025] Agrobacterium, which had been transferred into the gene-editing plasmid, was used to infect tobacco leaf discs.

[0026] In a ninth aspect, the present invention discloses the application of gRNA as described in the first aspect, primer pairs as described in the second aspect, gene editing plasmid as described in the third aspect, or kit as described in any one of the fourth and fifth aspects in the editing of the tobacco polyphenol oxidase gene NtPPO-1. The edited tobacco polyphenol oxidase gene NtPPO-1 is used to reduce PPO activity, improve the curing quality of tobacco leaves, and enhance the plant's resistance to diseases and pests.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] This invention involves a systematic screening and detection of PPO genes in the tobacco family. Based on the NCBI gene database, 15 family genes in tobacco were identified, and their genomic sequences and mRNA data were downloaded. Primers for cDNA expression detection of these 15 family genes were designed, and RT-PCR and expression sequencing were performed. Comparative analysis revealed that the expression of the NtPPO-1 (LOC107811292) gene differed significantly from other family genes, indicating it is not constitutive. The expression level fluctuated in plants from different tobacco varieties, and its level was considered moderate. This suggests that changes in the expression level of this gene will not lead to significant physiological changes in the plant, or even affect its main agronomic traits and growth. Based on the characteristics of the tobacco polyphenol oxidase gene, it was speculated that its inactivation might only weaken the overall activity of polyphenol oxidase without affecting other yield traits. Therefore, a dual-target knockout editing was performed using the first exon of the NtPPO-1 gene as the editing target region, hoping to significantly reduce the expression of the gene. Homozygous mutant plants with large fragment deletions were obtained. RNA expression sequencing and RT-PCR detection of the homozygous mutant plants showed that the expression level of NtPPO-1 (LOC107811292) in the homozygous mutant plants was significantly reduced. Analysis of the curing quality of tobacco leaves showed that PPO activity was significantly reduced, the browning of tobacco leaves was significantly alleviated, and the quality was significantly improved, while plant height, disease resistance, and tobacco yield were basically unaffected. Attached Figure Description

[0029] Figure 1 A schematic diagram illustrating the structure and construction process of the gene editing plasmid for the tobacco NtPPO-1 gene provided in this application embodiment;

[0030] Figure 2 This is a diagram showing the results of double enzyme digestion and electrophoresis of the gene-edited plasmid provided in the embodiments of this application after PCR amplification detection;

[0031] Figure 3 The electrophoresis results of PCR identification of plants obtained by editing the T1 and T2 positions of the first exon of the tobacco polyphenol oxidase gene NtPPO-1 provided in the embodiments of this application; lane M is the DL2000 DNA Marker.

[0032] Figure 4This image shows the sequence alignment results of the first position T1 of the first exon of each individual plant obtained through NtPPO-1 gene editing in tobacco, as provided in the embodiments of this application. In the image, underlines represent base substitutions, "-" indicates missing bases, and lowercase letters indicate base insertions. In the image, "Reference" represents the NCBI tobacco sequence, and "wild type" represents the nucleotide sequence of the first position of the polyphenol oxidase gene NtPPO-1 in the original tobacco variety. "Allele1" "Allele1" represents the nucleotide sequence at positions 1-34 of the allele corresponding to the NtPPO-1 mutant strain of the tobacco polyphenol oxidase gene; "Allele2" represents the nucleotide sequence at positions 3-49 of the allele corresponding to the NtPPO-1 mutant strain of the tobacco polyphenol oxidase gene; "Allele3" represents the nucleotide sequence at positions 6-17 of the allele corresponding to the NtPPO-1 mutant strain of the tobacco polyphenol oxidase gene; "Allele4" represents the nucleotide sequence at positions 1-10 of the allele corresponding to the NtPPO-1 mutant strain of the tobacco polyphenol oxidase gene. As shown in the example, Allele1, Allele2, and Allele4 show small fragment deletions, while Allele2 shows a large deletion.

[0033] Figure 5 The images show the cured tobacco leaves of the gene-edited tobacco NtPPO-1 plant (right) and the wild-type plant (left) provided in this application embodiment. The curing standard refers to the national standard for quality testing of flue-cured tobacco leaves in the tobacco industry. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0035] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0036] The term "gene editing" refers to the editing (directed modification) of a target gene and its transcription products to achieve the knock-in, knock-out, substitution, and modification of specific nucleic acid fragments or specific DNA bases, resulting in strains, strain lines, or organisms that alter the sequence, expression level, or function of the target gene or regulatory element. This can manifest as changes in function, loss, or partial loss of function of the target gene or regulatory element, functional masking, functional recombination, or functional mutation. "Gene editing plasmid" refers to a plasmid carrying a sequence designed to alter a target gene or regulatory element. When transferred into a strain, strain line, or organism, it can cause changes in function, loss, or partial loss of function of the target gene or regulatory element, functional masking, functional recombination, or functional mutation.

[0037] The term "gRNA" is used interchangeably with "guide RNA" and "target RNA," referring to RNA molecules that can form a complex with a CRISPR nuclease (such as the Cas9 protein) and carry the CRISPR nuclease to the target sequence to cleave the target site. The term "CRISPR nuclease" refers to an enzyme that can target and cleave specific nucleic acid sequences, and specifically refers to enzymes derived from systems including CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats).

[0038] The term "mutant" generally refers to a plant individual carrying a gene that has undergone a mutation. A "mutant" of the tobacco polyphenol oxidase gene NtPPO-1 refers to a tobacco plant whose NtPPO-1 gene coding has been mutated within its genome. A "homozygous mutant" of the tobacco polyphenol oxidase gene NtPPO-1 refers to a tobacco plant where both homologous chromosomes of the NtPPO-1 gene have the same coding mutation, including base deletions or insertions. A "heterozygous mutant" of the tobacco polyphenol oxidase gene NtPPO-1 refers to a tobacco plant where the NtPPO-1 gene coding on only one homologous chromosome has been mutated, while the other chromosome remains unmutated.

[0039] This application provides at least one gRNA for editing the tobacco polyphenol oxidase gene NtPPO-1, wherein the gRNA targets the first exon of the tobacco polyphenol oxidase gene NtPPO-1, the nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2, the nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO: 7, and the NtPPO-1 gene is numbered LOC107811292.

[0040] In this embodiment, the gRNA is a single-stranded RNA molecule that can guide CRISPR nuclease (e.g., Cas9 protein) to form a complex and carry the CRISPR nuclease to the first exon of the tobacco polyphenol oxidase gene NtPPO-1 and cleave the target site therein.

[0041] In the embodiments of this application, the location of "NtPPO-1 gene mutation" includes all regions between the first target site and the second target site.

[0042] In some embodiments, the gRNA shown in SEQ ID NO. 1 targets a first position in the first exon, the nucleotide sequence of which is shown in SEQ ID NO. 3. The gRNA shown in SEQ ID NO. 2 targets a second position in the first exon, the nucleotide sequence of which is shown in SEQ ID NO. 4.

[0043] This application also provides a gene-editing plasmid for the tobacco polyphenol oxidase gene NtPPO-1, wherein the gene-editing plasmid contains the same deoxynucleotide sequence as the gRNA provided in the above embodiments and the Cas9 editing gene. This same deoxynucleotide sequence as the gRNA can be transcribed in vitro or in vivo by RNA polymerase or a reagent containing RNA polymerase to obtain the gRNA, thereby enabling the guided CRISPR nuclease to target and cleave the first member of the tobacco polyphenol oxidase gene NtPPO-1.

[0044] In some embodiments, the transcription direction of the nucleotide sequence identical to that of the gRNA in the gene-editing plasmid is opposite to the transcription direction of the Cas9 editing gene. Thus, when the gene-editing plasmid is transferred into the target host, it utilizes the host's RNA polymerase and polymerization environment to achieve transcription and polymerization to obtain gRNA; while the transcription and expression in the other direction yields the Cas9 protein, thereby achieving targeted editing of the first exon of the tobacco NtPPO-1 gene.

[0045] This application also provides a method for constructing a gene-editing plasmid for the tobacco polyphenol oxidase gene NtPPO-1, comprising: (1) obtaining a gRNA entry plasmid and synthesizing primer pairs; (2) using the primer pairs and the gRNA entry plasmid to obtain a recombinant gRNA entry plasmid carrying the deoxynucleotide sequence corresponding to the gRNA; and (3) obtaining a gene-editing terminal plasmid. Specifically, the DNA molecule corresponding to the gRNA is obtained by digesting the gRNA entry plasmid carrying the deoxynucleotide sequence corresponding to the gRNA with enzymes, and then ligated with the digested Cas entry plasmid sequence carrying the Cas enzyme-encoded gene to obtain the gene-editing terminal vector.

[0046] In some embodiments, a gRNA is designed and synthesized based on the first exon sequence of the tobacco polyphenol oxidase gene NtPPO-1. The nucleotide sequence of this gRNA is derived from the deoxynucleotide sequence of the basic gRNA on a first plasmid (as shown in SEQ ID NO. 5) and a partial sequence from the first exon of the tobacco polyphenol oxidase gene NtPPO-1. Therefore, a primer pair can be designed and synthesized based on the nucleotide sequence of this gRNA. Additionally, a first plasmid is obtained, which is a plasmid carrying the basic gRNA with the deoxynucleotide sequence shown in SEQ ID NO. 5. In some embodiments, the deoxynucleotide sequence of the gRNA is shown in SEQ ID NO. 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NO. 3. In some embodiments, the deoxynucleotide sequence of the gRNA is shown in SEQ ID NO. 2, and the nucleotide sequence of the primer pair is shown in SEQ ID NO. 4.

[0047] In some embodiments, a recombinant plasmid carrying the complete nucleotide sequence of the gRNA is formed by inserting primer pairs downstream of the base gRNA of the first plasmid in the form of enzyme digestion.

[0048] These embodiments simplify the cumbersome process of directly synthesizing gRNA and reduce synthesis costs. Primer pairs with shorter sequences are designed based on the preset gRNA sequence. Using these primers, the deoxynucleotide sequence of the basic gRNA that is close to the existing first plasmid is digested and ligated in vitro. This allows for the direct acquisition of recombinant plasmids carrying the deoxynucleotide sequence corresponding to the gRNA that edits the tobacco polyphenol oxidase gene NtPPO-1, thereby improving synthesis efficiency. Furthermore, high concentrations of DNA molecules corresponding to the gRNA can be obtained through enzyme digestion, facilitating their further insertion into the second plasmid.

[0049] The following is a description through specific embodiments.

[0050] Example 1: Screening of PPO genes in the tobacco family

[0051] After systematic screening and detection of PPO genes in the tobacco family, 15 family genes were identified using the NCBI gene database. The genomic sequences and mRNA data of these 15 genes were downloaded, and primers for cDNA expression detection of these 15 family genes were designed. Using the tobacco actin gene as a control, quantitative real-time PCR was performed to detect expression. The results showed that only 8 genes showed detectable expression signals, while the transcription products of the other 7 family genes were undetectable, suggesting they may be invalid genes. Comparative analysis revealed that the expression level of the NtPPO-1 (LOC107811292) gene (its nucleotide sequence is shown in SEQ ID No. 7) differed significantly from other family genes, indicating it is not constitutively expressed (like the Actin gene). Its expression level fluctuated across different tobacco varieties, and its overall expression level was considered moderate.

[0052] The NtPPO-1 gene nucleotide sequence is shown below. The underlined sequences are, in order, the 5' region (single underline), the first exon (first wavy line), the first endon, the second exon (second wavy line), the second endon, the third exon (third wavy line), and the 3' region (double wavy line). The T1 and T2 target sequences are double underlines.

[0053] TCATATATTGATGAATAATATAGGTGTTCAAGTATTAAAAAGATTTAAGGCAATATTATTTTCAAAAT TATCTTTCTGTTTAGAGAAGCTTTGATTCTTCTTCTACAGATCTAGCAAATATAAAACACAAATGATAAGAGTTTT CCCACTTAATATTATCCTTCATTTAATTCCCACCTACCAGGTCCCGAATATGTTTTGGAGTGGTAGGTGAGACGTG CTCCATATATATTTTATTGGGTGCTTACATATTATATAAGGCAAAGGTGGAACCCTAAGAATCTTCAACTGAAAGC TAGCTATGGCATCAAGTGTTATTTCACCAGTGTGCAATAGCACACCACTCAAAACACCCTTTACATCAACCACCAA GTCTTCTTCTTTAGCATCCACTCCAAAACCCTCTCAACTTTTCCTCCGCGGAAAACGTAACCATAGCTTCAAAGTC TCATGCAAGGTCTCCAATGGTGATGAAAACAAAACTGTTGAAGCAAATTCTGTTGATAGGAGAAATGTTCTTCTAG GTTTAGGAGGTCTCTATGGTGCTTCTAATGTTGTACCATTGGCTTCAGCCACTCCCATTCCAGCCCCTACTACTTC ATGTAGCAAGACTGGCGCCACAATTAAACCCGGTGTACCAGTACCTTATTCTTGTTGCCCCCCTCCGCTAAAAATT GATCCTAAGGATATTCCTTATTACAAGTTTCCAACAGGGTCCAAGCTCCGTATTCGGCCAGCTTCTCATGCCGTGG ATGAAGAGTACATGGCTAAGTACAACTTAGCCATTACTAAAATGAAGGAGCTCGACGTCACCGATCCAGATGATCC ACGTGGATTCACGGCGCAAGCCAAAATCCACTGTGCTTATTGCAATGGTGCATACACCGTCGCTGGCAAAGAGCTA CAAATTCACTTCTCATGGCTTTTTTTCCCATTCCATAGATGGTATTTGTACTTCTATGAAAGAATCTTGGGCTCTT TAATCAATGATCCTACTTTTGGTTTGCCATATTGGAACTGGGATCATCCAAAGGGCATGCGTTTGCCACACATGTT TGATCAACCAAACGTGTACCCTGATCTTTACGATCCAAGAC GTAACCAAGAACACCGTGGTTCTGTAATCATGGACCTTGGTCATTTTGGTCAAGACGTGAAAGGAACTGACTTGCAAATGATGAGCAATAACCTTACTCTAATGTATCGTCAAATGATTACCAATTCACCATGTCCACAACTCTTTTTCNGATCCAAGACGTAACCAAGAGCACCGTGGTTCGGTAATCATGGACCTTGGTCATTTTGGTCAAGACGTGAAAGGAACTGACTTACAAATGATGAGAAATAACCTTACTCTAATGTATCGTCAAATGATTACCAATTCACCGTGTCCACAACTGTTTTTT GGTAAGCCATATTGTACGGAAGTTGGACCC AAACCAGGGCAGGGAGCTATTGAAAACATCCCTCATACTCCTGTCCACATTTGGGTTGGTAGTAAGCCTAATGAGA ATAACTGTAAAAACGGTGAAGATATGGGAAATTTCTATTCAGCTGGTAAGGATCCTGCTTTCTATAGTCACCATGC AAATGTAGATCGCATGTGGACAATATGGAAAACATTAGGAGGAAAACGCAAGGACATCAACAAGCCAGATTATTTG AACACTGAGTTCTTTTTCTACGACGAGAAGAAAAACCCTTATCTCGTCAAAGTCCGTGACTGTTTGGACAATAAGA AAATGGGATATGATTTCCAAGCAATGCCAACCCCATGGCGTAATTTTAAGCCATTGAAGAAGAGCAAGAGCAAGGT CAATGCACGTTCGGTTCAGTCAGCTACCCAAACATTCCCTATTGCAAAGATTGACAAACCCATAACATTTTCTATC AAAAGGGAAACTTCAG GTACTTTCAACTGTTATTTAAAAGTTTAAACGGTTAGAAATAACACATTTTTAATTACTAAACTTAATTAGATCTATCAGGTAGTTGGATAAAAATAAAGTTTTTGTTTTTCGTGTGACGGTGAAATTTAAAAACATGACCTCATTTCAATCGCTCATGCCATGTTAACTTGCTAGAGAGAGCATATTTTTAATTTGTTAGAGTACACTTTCAATTATTTAATTATATTACGTCTTAACAG GCAGGACTCAGCAGGAGAAAGACGCAAAAGAGGAGATGTTAACTTTC TTGGAACTCAACATTGATCAGCGAAAGCACATAAGGTTTGATGTCTTCATTAACGCAGATGCAAACTCCAACTGGC ATGAGCTAGACAGGGCAGAGTTTGCAGGAAGTTACACTGCCTTGCCTCATGTTCATTCAGATCCCAGTAAACCACA TGTCGCCCCTGTTGCAAAATTCCAGCTGGCCATTACCGAGTTGCTCGAGGAAATTGGCCTTGAAGATGAAGATGAT ATAGTGGTGACTCTGGTCCCGAAAACTGGGGGCGAATTTGTCGCCATTAAATCTGTGGTTATTACACTTGAAGCTT GTTGATGATGGCCTGCTCAAGTTTTCTTGTTGTGTCTTGGTGACCTGCATTTGATTTTAATTCCGTTTTATTTATG TTGAAATCAGCTTGATGTTAATGTCATTGCAATTGTTATTCAGGAATAAATCAGTACTGTATTTGGTGTTAGAATC ACTTTGTCTATCTTCTTCGAACTTTCTCTTTTTAAGACACTTTTATTTGGAATATAAAATAGGAAGAGAAAAAGAT AAACAATATGCCATAGTGCAAAAAGAAATTTTAAACCCACTTGCACTGATCTTGGAAAAAAAGGTTAAAATAATGC AATGACCCTAGACTCTTCTTAACTCTTTATGCATAAGATTTAACATGTAGATCTGGGAGCTATCATCAATAACCTT GAAATAGCAGCTCCTAAGACATCTCCAAGGCTACTCTAATTTGGTGCAAGAAATAGTGTTTTTTTGCTCCAATACA ACACTAATTCTTGCATTATTATAGAGCATGAATAGTGTTGCATCAAATTTGGAGCAACACTATTCATCACTCTAAA TTTGGTTTAATATTATTTTATTCAATCTTTTTATTTTGTGGACTTTTAATTTATCATATATTGTGTATATAATTAA TTTTTATATTAAGATCTTTC , as shown in SEQ ID No.7.

[0054] The specific experimental process is as follows:

[0055] (1) Total RNA was extracted using an RNA extraction kit. RNA yield was determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and its integrity was assessed by ethidium bromide-stained agarose gel electrophoresis.

[0056] (2) Real-time quantitative reverse transcription polymerase chain reaction (RT-PCR)

[0057] Quantitative analysis employed a two-step reaction procedure: reverse transcription (RT) and PCR. Each RT reaction mixture contained 0.5 μg RNA, 2 μl of 5×TransScript All-in-one SuperMix for qPCR, and 0.5 μl of DNA removal agent, for a total volume of 10 μl. The reaction was performed on a GeneAmp® PCR System 9700 (Applied Biosystems, USA): 42°C for 15 minutes, followed by 85°C for 5 seconds. Subsequently, the 10 μl RT reaction mixture was diluted 10-fold with nuclease-free water and stored at -20°C.

[0058] (3) Real-time quantitative PCR was performed using a LightCycler® 480 II real-time quantitative PCR instrument (Roche, Switzerland). The reaction system consisted of 10 μl PCR mixture, containing 1 μl cDNA, 5 μl 2×PerfectStart™ GreenqPCR SuperMix premix, 0.2 μl forward primer, 0.2 μl reverse primer, and 3.6 μl nuclease-free water. The reaction was pre-denatured at 94 °C for 30 seconds in a 384-well plate (Roche, Switzerland), followed by 45 cycles (94 °C for 5 seconds, 60 °C for 30 seconds). Each sample was analyzed in triplicate. After the PCR cycles, melting curve analysis was used to verify the specific generation of the expected PCR product.

[0059] (4) The experimental results (see table below) show that expression products were detected for 8 genes. The family gene represented by LOC107811292 has a low expression level in leaves and varies greatly among different varieties, indicating polymorphism among varieties.

[0060] Table 1. 15 families of tobacco PPO genes

[0061] GeneID Status Symbol description 107805360 live LOC107805360 polyphenol oxidase E, chloroplastic-like 107810501 live LOC107810501 polyphenol oxidase, chloroplastic-like 107789348 live LOC107789348 polyphenol oxidase E, chloroplastic-like 107811292 live LOC107811292 polyphenol oxidase E, chloroplastic-like 107824883 live LOC107824883 polyphenol oxidase E, chloroplastic-like 107810500 live LOC107810500 polyphenol oxidase, chloroplastic-like 107802629 live LOC107802629 polyphenol oxidase, chloroplastic-like 107787563 live LOC107787563 polyphenol oxidase E, chloroplastic-like 107786520 live LOC107786520 polyphenol oxidase E, chloroplastic-like 107780127 live LOC107780127 polyphenol oxidase E, chloroplastic 107773093 live LOC107773093 polyphenol oxidase E, chloroplastic-like 107767076 live LOC107767076 polyphenol oxidase, chloroplastic-like 107760231 live LOC107760231 polyphenol oxidase E, chloroplastic-like 107821546 live LOC107821546 polyphenol oxidase E, chloroplastic-like 107761830 live LOC107761830 polyphenol oxidase E, chloroplastic-like

[0062] Table 2. Expression of the eight family genes detected in tobacco leaves of two tobacco varieties (K326 and Zunyan 6)

[0063] gene k326-1 k326-2 k326-3 zy6-1 zy6-2 zy6-3 LOC107805360 6.86 6.07 6.53 13.957 11.197 7.697 LOC107810501 7.893 12.333 11.72 11.613 11.57 10.0 LOC107811292 5.483 6.64 7.3 15.277 11.297 13.69 LOC107787563 6.287 6.897 6.913 10.597 9.633 13.13 LOC107786520 9.067 9.177 8.117 6.757 4.683 3.473 LOC107780127 6.727 6.347 6.653 10.143 11.143 10.34 LOC107773093 7.593 6.4 6.337 7.18 6.98 3.53 LOC107821546 9.77 9.43 9.883 11.99 10.887 10.493

[0064] Table 3. Primers for real-time PCR detection of 15 PPO family genes in tobacco

[0065] Num GeneSymbol Forwardprimer(5->3) Reverseprimer(5->3) Productlength(bp) Tm(℃) 1 LOC107805360 CAGTGGCGAGCATGACAA AGATTAGCTGCGCCATACA 87 60 2 LOC107811292 CCAATGGTGATGAAAACAAAAC GAAGCCAATGGTACAACATTAG 109 60 3 LOC107787563 CGTTCAGTTCCTCCAGTTACC GCCTGAAGTTTCCCTTTTGA 87 60 4 LOC107786520 TTTATTGATGATGGCGTGCCTA GGTCATAGCAAGGAACGTC 88 60 5 LOC107780127 TATGTATGGTCAGAAACGCGAA GTGAAGCACGTGGTTGATT 121 60 6 LOC107773093 TCATGGACCTAATAGTGGCAA CTTCATCTTCCAAACCACAG 95 60 7 LOC107821546 CTGCATTGTGGAAAAAGCCCA GTTGCACAGTTAGCTGTTAAGTT 71 60 8 LOC107810501 ATGAAACAACTTCCAGACGAC AGTTCAGAGTTTGGGAAACCTA 110 60 9 LOC107761830 TTCCTCCATGGAAAAGTACG TGCACGGCCTGGAAAACGACG 219 58 10 LOC107789348 CACCAACTCATCTTTCTTTG GCCATTAGCCTCTGCTGCT 205 60 11 LOC107802629 CCACTCCCCACCACCAA GACATCAAAAGTTTCCACTAT 116 55 12 LOC107767076 CGCATGTCCAAGCTTCGTA TTGGCTTCAAGCAACAAGC 156 58 13 LOC107760231 GATAACTAACAACTTAATTCTAAT CCCGAACCTGGGATGG 132 57 14 LOC107824883 GCACCAGCAAAACTCCCTT GCATGATGGAAACCTTGACG 135 55 15 LOC107810500 TGAACTACATCTCAAACCAA TGCATTCTTCTACTTTCTTTACG 137 52 16 Tobacco Actin (CK) TCCATGCTCA ATGGGATACT TTCAACCCCTTGTC TGTGAT 208 60

[0066] Example 2

[0067] To prevent reversion mutations at the edited sites and ensure permanent knockout, a dual-target editing strategy was employed, simultaneously targeting the first exon of the tobacco polyphenol oxidase gene NtPPO-1 at position T729 and the second exon at position A835. Two targeting primers, gRNA1 and gRNA2, were designed, such as... Figure 1 As shown, the specific steps are as follows:

[0068] (1) Synthesize primer pairs

[0069] Based on the first exon of the tobacco polyphenol oxidase gene NtPPO-1, a gRNA1 molecule as shown in SEQ ID NO. 1 was designed. The nucleotide sequence of this gRNA1 molecule includes the deoxynucleotide sequence derived from the basic gRNA on the first plasmid and a partial sequence derived from the first exon of the tobacco NtNtPPO-1 gene (LOC107811292).

[0070] The pYPQ142 plasmid from Addgene was replaced with the OsU3 promoter to obtain the pOsU3-142D plasmid. The OsU3 promoter and the A base at the beginning of the gRNA sequence need to be used to construct the Esp3I restriction site. The 5'-TGGC adapter needs to be added to the 5' of the gRNA1 primer, and the 5'-AAAC adapter needs to be added to the reverse primer. Therefore, the primer pairs provided in this example are T729-T1F and T729-T1R.

[0071] Since the OsU3 promoter in the plasmid and the A base at the beginning of the gRNA2 sequence need to construct the Esp3I restriction site, a 5'-TGGC adapter needs to be added to the 5' of the gRNA2 primer, and a 5'-AAAC adapter needs to be added to the reverse primer. Therefore, the primer pair provided in this example is A835T2F and A835T2R.

[0072] gRNA1: ACAGGGTCCAAGCTCCGTAT, as shown in SEQ ID No. 1;

[0073] gRNA2: ATCCAGATGATCCACGTGGA, as shown in SEQ ID No. 2;

[0074] gRNA1 primer sequence T729-T1F: TGGCACAGGGTCCAAGCTCCGTAT, as shown in SEQ ID No. 3;

[0075] gRNA1 primer sequence T729-T1R: AAACATACGGAGCTTGGACCCTGT, as shown in SEQ ID No. 4;

[0076] gRNA2 primer sequence A835-T2F: TGGCATCCAGATGATCCACGTGGA, as shown in SEQ ID No. 5;

[0077] The gRNA2 primer sequence A835-T2R is: AAACTCCACGTGGATCATCTGGAT, as shown in SEQ ID No. 6.

[0078] In this embodiment, the primer pair can be synthesized using chemical or biological methods. Thus, the pOsU3--142D plasmid was obtained.

[0079] (2) Using primer pairs and the pOsU3--142D plasmid, a recombinant plasmid pOsU3-gRNA(PPO)-142D carrying the corresponding deoxynucleotide sequence of gRNA was obtained.

[0080] The pOsU3-142D plasmid, T729-T1F, and T729-T1R plasmids were digested with Esp3I. The digestion reaction volume (20 μL) contained 13 μL ddH2O, 2 μL T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase enzyme, 2 μL T729-T1F and T729-T1R annealing solutions, and 2 μL of Esp3I-digested pOsU3-142D plasmid solution. The reaction mixture was incubated at 37°C for 2 h to obtain the pOsU3-gRNA(PPO)-142D recombinant plasmid. The ligation solution was then transformed into *E. coli* DH5α using the heat shock method and plated on LB agar plates overnight.

[0081] (3) Select colonies for expansion culture, then extract plasmids and sequence to verify positive clones.

[0082] The positive gRNA entry plasmid pOsU3-gRNA(PPO)-142D recombinant plasmid, Cas9 entry plasmid pYPQ150 (from Addgene), and expression plasmid pYPQ203 (from Addgene) were added to the Gateway LR reaction system (5 μL (150 ng) of OsU3-gRNA(PPO)-142D recombinant plasmid, 1 μL (100 ng) of pYPQ150 plasmid, 1 μL (100 ng) of pYPQ203 plasmid, 10 μL of TE buffer, and 4 μL of LR Enzyme Mix). The mixture was incubated overnight at 25°C (room temperature) to obtain the T-DNA plasmid pYPQ203-PPO-1.

[0083] Thaw competent *E. coli* cells (DH5α) at ​​4°C. Transform 5 μL of the LR ligation product T-DNA (pYPQ203-PPO-1) plasmid into the competent cells and incubate on ice for 30 min. Then, heat shock at 42°C for 60 s. Immediately incubate on ice at 4°C for 2–3 min. Plate the cells onto LB agar plates overnight. Select large white resistant colonies, pick them with a sterile toothpick, and place them in a 5 ml sterile EP tube (containing LB liquid medium). Incubate overnight at 37°C with shaking. Extract the plasmid, and verify the results by enzyme digestion (see results below). Figure 2 The plasmid cloning was completed, and preparations were made for transfection with Agrobacterium.

[0084] Depend on Figure 2 It can be seen that a correctly assembled vector shows three bands after enzyme digestion, with the largest fragment being the brightest.

[0085] Tobacco leaf discs were transfected with positive Agrobacterium: Agrobacterium GV3101 competent cells were dissolved on ice, 50 ng of clone pYPQ203-PPO-1 plasmid was added, mixed well and heat-shocked in a 37°C water bath for 5 minutes, then spread on LB agar plates containing ampicillin and incubated overnight at 28°C.

[0086] Pick up bacterial plaques using a sterile 10µl pipette tip and place them in a 10ml sterile PE tube containing LB liquid medium. Incubate overnight at 28°C with a shaker at 180 rpm. Extract plasmids for restriction enzyme digestion or sequencing verification. Transfer the Agrobacterium strain containing T-DNA to an Erlenmeyer flask containing 50ml of liquid LB medium and incubate at 180 rpm for 36 hours.

[0087] Prepare sterile tobacco seedlings, generally under 20 cm tall. Take normally growing leaves and cut them into 1 cm squares with a sterile blade. Soak the leaf squares in Agrobacterium tumefaciens solution (57) for 5 minutes. Remove the leaf squares, blot dry with sterile paper, and place them on MS plates containing antibiotics. Incubate in the dark for 3 days.

[0088] After removing the dark culture, the tobacco plants were cultured in leaf trays at 28°C under normal light. Once new buds and roots grew around the leaf trays and eventually became new tobacco seedlings, the resulting tobacco plants were transferred to flowerpots with soil substrate for further cultivation.

[0089] The results are as follows Figure 5 As shown, the difference in color after curing is between a single tobacco plant (right) edited with the positive gene and a wild-type single plant (left). Wild-type tobacco leaves, due to their higher polyphenol oxidase activity, are prone to over-oxidation during the drying process after harvesting, resulting in a brownish color. In the leaves of the gene-edited progeny tobacco plants, the reduced NtPPO-1 polyphenol oxidase activity leads to less oxidation after curing, resulting in a lighter, golden-yellow color and significantly improved commercial value.

[0090] (4) The editing status of the target site of the first exon of the polyphenol oxidase gene NtPPO-1 in the edited tobacco plants was detected by PCR amplification.

[0091] The detection experiment process is as follows:

[0092] (1) DNA extraction: Extract DNA from tobacco leaves using a plant DNA micro-extraction kit. Take about 100 μg of fresh tobacco leaves, freeze them in liquid nitrogen, grind them, transfer the powder to a 2.0 ml sterile EP centrifuge tube, add 500 μl of lysis buffer, mix well and lyse for 5-10 minutes. Centrifuge at 12000 rpm for 5 minutes. Transfer the supernatant to a clean 1.5 ml sterile EP centrifuge tube with a sterile pipette tip, add 100 μl of binding buffer, mix immediately, and then transfer the mixed liquid to a resin column with a sterile pipette tip. After filtering out the liquid in the column under negative pressure, add 600 μl of elution buffer to the column, filter under negative pressure, add 50 μl of deionized water to the resin column, let stand for 5 minutes, and then centrifuge at 12000 rpm for 2 minutes to obtain tobacco DNA extract.

[0093] (2) PCR detection: The PCR primers were upstream primer A1F1: 5`-TGGTGCTTCTAATGTTGT-3`, and downstream primer A1R1: 5`-GAGCGATTGAAATGAGGT; PCR reaction program: after melting at 94℃ for 4 minutes, the cells were cycled at 94℃ for 35 seconds, 55℃ for 30 seconds, and 72℃ for 30 seconds for 30 cycles, followed by extension at 72℃ for 5 minutes. The target fragment length was 492bp-1524bp, the negative edited fragment length was around 1500bp, and the positive edited fragment length was 490-1000bp.

[0094] (3) Gel electrophoresis: Weigh 2g of agar powder, add 100ml of fresh TAE buffer, boil in microwave oven and cool to 60℃, add 5ul of 100mg / L EB ethidium bromide, mix slowly, pour into agarose gel mold, insert electrophoresis comb, let the lane cool and solidify, remove the comb, add PCR product, run the gel at 10ft / cm voltage for 20 minutes, observe and take pictures on a UV imaging instrument.

[0095] The results are as follows Figure 3 As shown, due to sequence loss in the target region of positive edited monocultures, the sequence size was smaller after PCR amplification compared to wild-type monocultures. Homozygous monocultures showed only a single small fragment, while heterozygous monocultures showed two bands. Negative edited monocultures showed only a large fragment.

[0096] (5) The sequence of the first position T1 of the first exon of each individual plant obtained by editing the tobacco NtPPO-1 gene was compared.

[0097] Sequencing experiment procedure: Figure 3 The PCR products obtained in the experiment were recovered by band recovery, and the method was the same as that of the MPID gel recovery kit. Sanger sequencing was performed using sequencing primer PPOF1: 5`-CTATGGTGCTTCTAATGTTGT-3`.

[0098] The results are as follows Figure 4 As shown, Sanger sequencing revealed that, compared with wild-type single plants, the positive edited single plants exhibited different types and lengths of sequence deletions in the target region of the target gene, indicating that the first exon region of the NtPPO-1 gene contained fragments of different lengths of deletion.

[0099] The above description is merely a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and variations that are directly derived or conceived by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included within the protection scope of the present invention.

Claims

1. Editing the gRNA of the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, The gRNA targets the first exon of the tobacco polyphenol oxidase gene NtPPO-1. The nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2. The nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO:

7. The gene number of NtPPO-1 is LOC107811292.

2. Primer pairs for editing the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, The primer pairs comprise DNA molecules having nucleotide sequences as shown in SEQ ID NO. 3–6.

3. A gene-editing plasmid for editing the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, The gene editing plasmid contains the gRNA of the tobacco polyphenol oxidase gene NtPPO-1 as described in claim 1 and the editing gene of Cas9.

4. A gene editing kit for the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, include: The primer pair as described in claim 2; and, The first plasmid carrying the deoxynucleotide sequence corresponding to the basic gRNA; as well as, A second plasmid carrying the Cas9 editing gene.

5. A kit for editing the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, Includes the gene-editing plasmid as described in claim 3; and a reagent for maintaining the transformation activity of the gene-editing plasmid; wherein, The gene editing plasmid carries a gRNA that edits tobacco polyphenol oxidase NtPPO-1. The gRNA targets the first exon of the tobacco NtPPO-1 gene. The nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2. The nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO:

7. The NtPPO-1 gene is numbered LOC107811292.

6. The reagent kit according to claim 5, characterized in that, The kit also includes reagents containing Agrobacterium GV3101.

7. A host cell, characterized in that, The host cell carries the gene-editing plasmid as described in claim 3.

8. A method for constructing a gene-editing plasmid for the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, include: A first plasmid was obtained and primer pairs were synthesized. The first plasmid carries the deoxynucleotide sequence corresponding to the basic gRNA as shown in SEQ ID NO. 1 or 2. The primer pairs were designed based on the deoxynucleotide sequence corresponding to the basic gRNA. The target sequence of the gRNA is located in the first exon of the tobacco polyphenol oxidase gene NtPPO-1. A recombinant plasmid carrying the deoxynucleotide sequence corresponding to the gRNA was obtained using primer pairs and the first plasmid; The recombinant plasmid carrying the deoxynucleotide sequence corresponding to the gRNA is digested with enzymes to obtain the DNA molecule corresponding to the gRNA, and then ligated with the digested second plasmid sequence carrying the Cas9 enzyme-encoded gene to obtain the gene editing plasmid.

9. A method for editing the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, include: The gRNA of the tobacco polyphenol oxidase gene NtPPO-1 was obtained, wherein the target sequence of the gRNA is located in the first exon of the tobacco NtPPO-1 gene, the nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 or 2, the nucleotide sequence of the tobacco polyphenol oxidase gene NtPPO-1 is shown in SEQ ID NO: 7, and the NtPPO-1 gene is numbered LOC107811292; A gene-editing plasmid for editing the tobacco NtPPO-1 gene was constructed using the gRNA described above. The gene-editing plasmid was transferred into Agrobacterium tumefaciens; Agrobacterium, which had been transferred into the gene-editing plasmid, was used to infect tobacco leaf discs.

10. The application of the gRNA as described in claim 1, the primer pair as described in claim 2, the gene editing plasmid as described in claim 3, or the kit as described in any one of claims 4 to 6 in the editing of the tobacco polyphenol oxidase gene NtPPO-1, characterized in that, The edited tobacco polyphenol oxidase gene NtPPO-1 is used to reduce PPO activity, improve the quality of tobacco curing, and enhance the plant's resistance to diseases and pests.

Images