A splicing modulating oligonucleotide targeting MCM6 exon 13 and its use in the preparation of an antitumor drug

Abstract

This invention discloses a splicing-regulating oligonucleotide targeting exon 13 of MCM6 and its application in the preparation of antitumor drugs, relating to the field of biomedical technology. The nucleotide sequence of this splicing-regulating oligonucleotide is shown in SEQ ID NO.21. This invention also provides the application of the splicing-regulating oligonucleotide in the preparation of antitumor drugs. Based on the structure of the MCM6 pre-mRNA exon and the splicing regulatory region, this invention designs and screens a splicing-regulating oligonucleotide targeting exon 13 of MCM6. This splicing-regulating oligonucleotide can effectively induce MCM6 exon 13 skipping and reduce the proportion of the full-length MCM6 transcript, thereby providing a new strategy for the treatment of endometrial cancer.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a splicing-regulated oligonucleotide targeting exon 13 of MCM6 and its application in the preparation of antitumor drugs. Background Technology

[0002] Malignant tumor cells typically possess continuous proliferative capacity, and their proliferation process depends on stable and efficient DNA replication. The minichromosome maintenance protein (MCM) family is an important regulator of DNA replication permission and initiation in eukaryotic cells. Among them, MCM2, MCM3, MCM4, MCM5, MCM6, and MCM7 together form the MCM2-7 heterohexamer complex, which is an important component of the replication helicase complex and participates in DNA double-strand unwinding, replication fork advancement, and cell cycle maintenance.

[0003] MCM6 is a component subunit of the MCM2-7 complex and plays a crucial role in DNA replication initiation, cell cycle progression, and cell proliferation maintenance. Studies have reported elevated MCM6 expression in various tumor tissues, which is correlated with tumor grade, proliferative activity, disease progression, and patient prognosis. For example, elevated MCM6 expression levels in endometrial cancer, breast cancer, and neuroblastoma have been reported to be associated with higher malignant biological characteristics or adverse clinical outcomes. Therefore, MCM6 could serve as a potential intervention target for tumor proliferation-related interventions.

[0004] Current interventions targeting MCM6 mainly include small interfering RNA (siRNA), short hairpin RNA (shRNA), or RNase H-dependent antisense oligonucleotides, which primarily work by reducing MCM6 mRNA levels or decreasing MCM6 protein expression. While these strategies can inhibit tumor cell proliferation to some extent, they still have several limitations: First, MCM6, as a fundamental factor related to DNA replication, also has physiological functions in some normal proliferating cells, and completely or extensively reducing MCM6 expression may lead to potential toxicity; second, simply reducing MCM6 expression mainly involves level regulation and is difficult to further utilize the assembly-dependent structural interference of the MCM6 protein complex; third, the sustained inhibition of target gene expression by traditional degradative nucleic acid drugs depends on high delivery efficiency and relatively stable intracellular exposure.

[0005] Splice-switching oligonucleotides (SSOs) are a class of nucleic acid drugs that bind to specific regions of pre-mRNA through base complementarity, thereby altering splice site recognition or exon selection. Unlike degradative oligonucleotides (ASOs), SSOs typically do not primarily aim to degrade target RNA. Instead, they influence the recognition of pre-mRNA by the spliceosome or splice regulators through steric hindrance, thereby inducing exon jumping, exon inclusion, intron retention, or alternative splice site utilization. This technology has been validated in several genetic diseases, for example, by restoring or improving the function of target proteins through exon jumping. However, the application of SSOs for structural splicing intervention in tumor-related genes, especially by inducing functionally impaired isoforms through key exon jumping to inhibit tumor cell proliferation, still has room for further development. Summary of the Invention

[0006] The purpose of this invention is to provide a splicing-regulating oligonucleotide targeting exon 13 of MCM6 and its application in the preparation of antitumor drugs, thereby addressing the problems existing in the prior art. The splicing-regulating oligonucleotide provided by this invention can effectively induce MCM6 exon 13 skipping and reduce the proportion of the full-length MCM6 transcript, providing a new strategy for the treatment of endometrial cancer.

[0007] The function of the MCM6 protein depends on its structural integrity and its co-assembly with other subunits of the MCM2-7 complex. If specific coding exon skipping in the MCM6 pre-mRNA can be induced through splicing regulation, resulting in a splice isoform that retains the open reading frame but lacks key structural regions, it is possible to alter the structure and function of the MCM6 protein without completely eliminating the MCM6 transcript, and further influence the MCM6-related replication process.

[0008] Based on the exon structure and splicing regulatory region of MCM6 pre-mRNA, this invention designs and screens splicing regulatory oligonucleotides targeting exon 13 of MCM6. These oligonucleotides can induce MCM6 exon 13 skipping, generating MCM6 splice isoforms lacking the coding region of this exon, and inhibiting the proliferation of tumor cells highly expressing MCM6.

[0009] Based on this, the present invention provides the following solution: This invention provides a splicing regulatory oligonucleotide targeting exon 13 of MCM6, the nucleotide sequence of which is shown in SEQ ID NO. 21.

[0010] The present invention also provides the application of the above-mentioned splice-regulated oligonucleotides in the preparation of antitumor drugs.

[0011] Furthermore, the anti-tumor drug targets endometrial cancer.

[0012] The present invention also provides an antitumor drug, the active ingredient of which includes the above-mentioned splice-regulating oligonucleotide.

[0013] Furthermore, the antitumor drug also includes pharmaceutically acceptable excipients.

[0014] This invention also provides the application of reagents that inhibit EFTUD2 gene expression in the preparation of antitumor drugs.

[0015] Furthermore, the anti-tumor drug targets endometrial cancer.

[0016] Furthermore, the reagent is siRNA or shRNA.

[0017] Furthermore, the nucleotide sequence of the positive strand of the siRNA is shown in SEQ ID NO.27 or SEQ ID NO.28.

[0018] Furthermore, the nucleotide sequence of the shRNA is shown in SEQ ID NO.24 or SEQ ID NO.25.

[0019] The present invention discloses the following technical effects: This invention provides a splicing regulation strategy that differs from traditional degradation-based MCM6 intervention strategies. Instead of aiming for global degradation of MCM6 mRNA, this strategy modulates MCM6 pre-mRNA splicing to induce specific exon skipping, thereby altering the MCM6 transcript and protein structure.

[0020] The splicing-regulated oligonucleotide provided by this invention targets exon 13 of MCM6. Skipping this exon generates an MCM6 splice isoform that maintains an open reading frame, resulting in a protein lacking the 54 amino acid residues encoded by exon 13. Unlike strategies that introduce premature stop codons and lead to NMD, this invention can be used to generate structurally altered MCM6 isoforms.

[0021] The splicing-regulating oligonucleotides provided in this invention can effectively induce exon 13 skipping in MCM6 and reduce the proportion of the full-length MCM6 transcript. Experimental results show that this splicing change is associated with decreased tumor cell proliferation.

[0022] The splicing-regulating oligonucleotides provided by this invention target the region near the 5' end inside exon 13 of MCM6. Compared with some candidate oligonucleotides that target other regions of the exon or splice junction regions, oligonucleotides in this region can achieve higher exon jumping efficiency.

[0023] The splice-regulating oligonucleotides of the present invention can inhibit the in vitro proliferation and colony formation ability of MCM6-overexpressing tumor cells, and may be accompanied by decreased DNA synthesis ability, cell cycle alteration and increased apoptosis level.

[0024] The splice-regulating oligonucleotides of the present invention can reduce tumor growth rate, terminal tumor volume, or terminal tumor weight in animal tumor models, suggesting their potential as candidates for anti-tumor nucleic acid drugs.

[0025] The splice-regulated oligonucleotides of the present invention can be modified with various nucleic acid chemical forms such as 2'-OMe, 2'-MOE, LNA, cEt, PMO, PNA, and PS backbone according to actual application needs, and can be used in combination with lipid nanoparticles, cell-penetrating peptides or other delivery systems to improve their stability, cellular uptake efficiency or in vivo application adaptability. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1This is an analysis of the expression and in vitro / in vivo function of MCM6 in endometrial cancer. A shows the function of the MCM2-7 hexamer complex as a core replication helicase during DNA replication. B shows the mRNA expression profiles of MCM2-7 family members in endometrial cancer and normal endometrial tissues based on GEPIA3 analysis. C shows a quantitative comparison of MCM6 mRNA expression levels between normal and endometrial cancer tissues in the TCGA endometrial cancer cohort. D shows a comparison of MCM6 protein abundance between endometrial cancer and normal endometrial tissues in the CPTAC endometrial cancer proteome cohort. E shows the Kaplan-Meier Plotter results of overall survival analysis, grouping endometrial cancer patients according to MCM6 expression levels using the lower quartile as the cutoff value. F shows the pan-cancer expression of MCM6 mRNA in various human malignancies and matched normal tissues based on GEPIA3 analysis. G shows fresh frozen endometrial cancer tissues (n = ...) from the Qilu cohort. qPCR results of MCM6 mRNA expression levels in 36) and normal endometrial tissue (n = 22) (normalized with GAPDH); I is the Western blot image of MCM6 protein expression in fresh frozen endometrial cancer tissue (n = 12) and normal endometrial tissue (n = 12) from the Qilu cohort; H is the quantitative analysis image of I; J is a representative immunohistochemical staining image showing obvious nuclear enrichment of MCM6 in endometrial cancer specimens; K is the Western blot image of MCM6 knockdown using two independent siRNAs (si-MCM6#1 ​​and #2) in Ishikawa, AN3CA, and HEC-1A cells. The results of the knockdown efficiency verification are shown in Figure 1; LN shows the results of functional experiments in EC cells with MCM6 silence, and L is the cell viability assay (MTT); M shows the results of the EdU incorporation assay; N shows the results of the colony formation assay; O shows the results of apoptosis detection by Annexin V / PI staining after knocking down MCM6 in Ishikawa and AN3CA cells; PR shows representative images (P), tumor volume statistics (Q), and tumor weight statistics (R) of subcutaneous tumors obtained on day 15 after Ishikawa cells stably expressing pLKO.1-control or pLKO.1-shMCM6 (#1, #2) were seeded subcutaneously into BALB / c nude mice (n = 5 / group); the top left corner of each subfigure in J is a scale bar of 50 micrometers; the scale bar in M ​​is 100 micrometers. Figure 2The results of RNA-seq alternative splicing analysis show that MCM6 is a key downstream target of ETUD2. A and B are heatmaps and volcano plots showing global transcriptomic changes in Ishikawa cells after ETUD2 silencing, respectively. C is a GO enrichment analysis of DEGs identified after ETUD2 silencing. D shows the results of rMATS identification of differentially expressed alternative splicing (AS) events and their type distribution quantitative analysis. E is a Venn plot showing the intersection between downregulated DEGs (log2FC ≤ -1, padj < 0.05; n = 1,673) and genes with significant SE changes (n = 4,881). F shows the results of GO functional annotation analysis of 181 candidate genes identified in E. G shows the results of further intersection analysis of the 181 candidate genes with upregulated genes in TCGA-endometrial cancer and differentially expressed proteins in CPTAC-endometrial cancer. H shows the results of mRNA level analysis in the TCGA-endometrial cancer cohort (n = 181) Pearson correlation analysis results between ETUD2 and 15 core candidate targets; I is the Pearson correlation analysis results between ETUD2 and 15 core candidate targets at the protein level (n = 100) in the CPCAC-endometrial cancer cohort; J is a heatmap showing the expression profiles of 15 core candidate targets in TCGA-UCEC in normal endometrium and endometrial cancer tissues; K is a heatmap showing the expression profiles of 15 core candidate targets in the CPCAC-UCEC cohort in normal endometrium and endometrial cancer tissues; L is the correlation analysis results between ETUD2 and MCM6 mRNA expression levels (n = 36) in fresh frozen endometrial cancer specimens from the Qilu Hospital cohort; M and N are the qPCR detection results (M) and western blot detection results (N) of ETUD2 knockdown mediated by siRNA in Ishikawa, AN3CA, and HEC-1A cells, respectively. Figure 3The results of identifying ETUD2 as a pro-tumor splicing factor in endometrial cancer are shown in the following figures: A is a box plot showing the expression levels of ETUD2 mRNA in normal endometrium (n = 23) and endometrial cancer tissue (n = 181) based on TCGA-GTEx data; B is a box plot showing the abundance of ETUD2 protein in normal endometrium (n = 31) and endometrial cancer tissue (n = 100) based on CPTAC-endometrial cancer data; C is a Kaplan-Meier analysis of overall survival based on the Kaplan-Meier Plotter database, using the lower quartile as the cutoff value to group endometrial cancer patients according to ETUD2 expression levels; D shows the ETUD2 protein abundance of different TCGA molecular subtypes in the CPTAC-endometrial cancer cohort; E shows the validation of ETUD2 by qPCR in fresh frozen endometrial cancer tissue (n = 36) and normal endometrial tissue (n = 22) in the Qilu cohort. The results of mRNA expression level are shown in Figure G; G is the Western blot detection of ETUD2 protein expression level in fresh frozen endometrial cancer tissue (n = 12) and normal endometrial tissue (n = 12) in the Qilu cohort; F is the quantitative analysis of G; H is a representative immunohistochemical staining image showing ETUD2 nuclear enrichment in endometrial cancer specimens; I and K are the cell viability detection results (I), colony formation experiment results (J), and EdU incorporation experiment results (K) of Ishikawa, AN3CA, and HEC-1A cells after ETUD2 knockdown, respectively; L is the PI staining analysis of cell cycle distribution in Ishikawa cells after ETUD2 knockdown; M is the quantitative analysis of the proportion of each cell cycle phase derived from L; N is the Annexin V / PI ratio of apoptosis in Ishikawa cells after ETUD2 knockdown. Staining evaluation plot; O represents the quantitative analysis plot for N; PR represents the representative images (P), tumor volume statistics (Q), and tumor weight statistics (R) of subcutaneous tumors on day 15 after Ishikawa cells stably expressing pLKO.1-control or pLKO.1-shEFTUD2 (#1, #2) were seeded into BALB / c nude mice (n = 5 / group); the upper left corner of each subplot in H is a scale bar of 50 micrometers; the scale bar in K is 100 micrometers. Figure 4To illustrate how EFTUD2 maintains the canonical splicing pattern of MCM6 exon 13 by promoting its inclusion; A is a Sashimi diagram based on RNA-seq data showing increased MCM6 exon 13 skipping in Ishikawa cells after EFTUD2 silencing; B is a schematic diagram of MCM6 transcript isoforms annotated in the Ensembl database; C and D are MCM6 protein domain annotations with domain information from cBioPortal (C) and ExonSkip DB (D), respectively; E shows the MCM6-L in endometrial cancer tissue compared to normal endometrium. The TCGA-UCEC analysis diagram shows elevated mRNA expression; F and G represent the relative expression levels of MCM6-S and MCM6-L in normal endometrial tissue (F) and endometrial carcinoma tissue (G) of the Qilu cohort, respectively; H and I represent the results of isoform-specific qPCR analysis of MCM6-L (H) and MCM6-S (I) expression levels in normal endometrial and endometrial carcinoma tissues of the Qilu cohort, respectively; J is a pan-cancer analysis diagram of MCM6-L mRNA expression in various TCGA tumors and their corresponding normal tissues; K represents the expression levels of EFTUD2 and MCM6-L in the TCGA endometrial carcinoma cohort. Pearson correlation analysis showing a positive correlation between mRNA expression and MCM6-L / MCM6-total ratio in the Qilu cohort of endometrial cancer tissues; L is a Pearson correlation analysis showing a positive correlation between ETUD2 expression and the MCM6-L / MCM6-total ratio; M is a schematic diagram of the MCM6 exon 13 inclusion / skipping pattern and primer design; N is a statistical graph showing the endogenous MCM6-S / MCM6-total ratio after ETUD2 knockdown in Ishikawa, AN3CA, and HEC-1A cells; O is an RT-PCR analysis showing altered endogenous MCM6 exon 13 splicing in Ishikawa cells after ETUD2 knockdown, characterized by a decrease in exon 13-included MCM6-L products and an increase in exon 13-skipping MCM6-S products; P is a RIP-qPCR analysis showing significant enrichment of endogenous MCM6 transcripts in ETUD2 immunoprecipitates in Ishikawa cells; Q is the binding of ETUD2 to exon 13-included MCM6. Figure 1 shows the results of the RNA pull-down experiment in the pre-mRNA region; Figure 2 shows the results of the actinomycin D tracking experiment in Ishikawa cells, which reduced the stability of MCM6 mRNA by knocking down EFTUD2; Figure 5To illustrate the analysis of the impaired MCM6-S isoform generated by exon 13 skipping and its interference with the formation of the MCM6-L complex, the following diagrams are presented: A shows the results of detecting the total MCM6 protein level in cells transfected with MCM6-L; B shows the results of detecting the expression level of MCM6-S-Flag using anti-FLAG antibody in cells transfected with MCM6-S; C shows the results of directly comparing the protein accumulation levels of MCM6-L-Flag and MCM6-S-Flag in cells transfected with MCM6-L and MCM6-S using anti-FLAG immunoblotting; D shows the degradation kinetics curves of endogenous MCM6-L and MCM6-S transcripts in Ishikawa cells as detected by the actinomycin D tracing assay; E and G represent the Western spectral density of MCM6-S-Flag protein in Ishikawa (E), AN3CA (F), and HEC-1A (G) cells after treatment with the proteasome inhibitor MG132 (10 μM), respectively. Blot results; H and I show the results of EdU incorporation assay (H) and colony formation assay (I) for functional characterization of MCM6-L and MCM6-S in endometrial cancer cells, respectively; J and K show the results of immunoprecipitation analysis of the binding of MCM6-S-Flag to the MCM2-containing complex in HEK293T cells (J) and Ishikawa cells (K) after endogenous MCM6 depletion; L and M show the competitive immunoprecipitation analysis of HEK293T cells (L) and Ishikawa cells (M), showing that the level of MCM6-L-Myc incorporation into the MCM2-containing complex gradually decreases with increasing MCM6-S-Flag expression; the scale bar for H is 100 micrometers. Figure 6 The diagram illustrates the pro-tumorigenic effect of EFTUD2 in EC cells mediated by MCM6-L rather than MCM6-S. AB represents the results of isoform-specific rescue experiments in Ishikawa, AN3CA, and HEC-1A cells; A represents the results of the MTT cell viability assay; B represents the results of the clonogenic assay. CE shows representative images (C), tumor volume statistics (D), and tumor weight statistics (E) of tumors validated in vivo using a subcutaneous xenograft tumor model. FG represents the results of MTT cell viability experiments (F) and clonogenic assays (G) of Ishikawa, AN3CA, and HEC-1A cells transfected with control or EFTUD2 expression plasmids, and simultaneously transfected with MCM6 siRNA or si-NC. HJ shows representative images (H), tumor volume statistics (I), and tumor weight statistics (J) of EFTUD2-driven tumor growth dependent on MCM6 in vivo. Figure 7Figure 1 shows the results of in vitro and in vivo functional experiments induced by SSO specifically targeting exon 13 of MCM6. A is a schematic diagram of the M-SSO design, where M-SSO targets the exon region near the 5′ donor splicing site in exon 13 of MCM6 to induce exon jumping (ES). B shows the quantitative results of the exon 13 jumping ratio (MCM6-S / totalMCM6). C is a representative semi-quantitative RT-PCR gel image showing the changes in full-length MCM6-L and exon-jugating MCM6-S transcripts after treatment with different concentrations of M-SSO (0, 25, 50, and 75 nM). D is a Western blot image showing the expression level of full-length MCM6 protein after treatment of EC cells with 25 or 50 nM M-SSO. EH is a validation diagram of M-SSO (50 nM M-SSO, 25 nM M-SSO, 50 nM M-SSO, 75 ... The results of the effect of nM on the functional phenotype of EC cells in vitro are shown in the figure. E is a representative fluorescence image of the EdU incorporation experiment, F is the result of the colony formation experiment, G is the result of Annexin V / PI apoptosis analysis in Ishikawa cells, and H is the result of Annexin V / PI apoptosis analysis in AN3CA cells. IK are representative images (I), tumor volume statistics (J), and tumor weight statistics (K) of PDX tumors in the EC PDX#1 model for evaluating the in vivo efficacy of M-SSO, respectively. LN are representative images (L), tumor volume statistics (M), and tumor weight statistics (N) of PDX tumors in the EC PDX#2 model for evaluating the in vivo efficacy of M-SSO, respectively. The scale bar of E is 100 micrometers. Detailed Implementation

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0031] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0033] Terminology Explanation: EFTUD2 refers to elongation factor Tu GTP-binding domain protein 2, which is a core component of the spliceosome complex U5 small ribonucleoprotein. As a GTPase, it plays a key role in the splicing of precursor mRNA, thereby regulating the expression of related genes.

[0034] MCM6 refers to miniature chromosome maintenance protein 6, which is an important component of the DNA replication initiation complex. It helps unwind the DNA double helix structure, allowing genetic information to be fully replicated during cell division.

[0035] The nucleotide sequences of the 17 exons of the human MCM6 gene are shown in SEQ ID NO. 1-17: SEQ ID NO.1: ATGGACCTCGCGGCGGCAGCGGAGCCGGGCGCCGGCAGCCAGCACCTGGAGGTCCGCGACGAGGTGGCCGAGAAGTGCCAGAAACTGTTCCTGGACTTCTTGGAGGA (exon 1); SEQ ID NO.2: GTTTCAGAGCAGCGATGGAGAAATTAAATACTTGCAATTAGCAGAGGAACTGATTCGTCCTGAGAGAAACACATTGGTTGTGAGTTTTGTGGACCTGGAACAATTTAACCAGCAACTTTCCACCACCATTCAAGAGGAGTTCTATAG (exon 2); SEQ ID NO.3: AGTTTACCCTTACCTGTGTCGGGCCTTGAAAACATTCGTCAAAGACCGTAAAGAGATCCCTCTTGCCAAGGATTTTTATGTTGCATTCCAAGACCTGCCTACCAGACACAA (exon 3); SEQ ID NO.4: GATTCGAGAGCTCACCTCATCCAGAATTGGTTTGCTCACTCGCATCAGTGGGCAGGTGGTGCGGACTCACCCAGTTCACCCAGAGCTTGTGAGCGGAACTTTTCTGTGCTTGGACTGTCAGACAGTGATCAGGGATGTAGAACAGCAGTTCAAATACACACAGCCAAACATCTGCCGAAATCCAGTTTGTGCCAACAGGAGGAGATTCTTACTGGATACAAATAAATCAAGATTTGTTGATTTTCAAAAG (exon 4); SEQ ID NO.5: GTTCGTATTCAAGAGACCCAAGCTGAGCTTCCTCGAGGGAGTATCCCCCGCAGTTTAGAAGTAATTTTAAGGGCTGAAGCTGTGGAATCAGCTCAAGCTGGTGACAAGTGTGACTTTACAGGGACACTGATTGTTGTGCCTGACGTCTCCAAGCTTAGCACACCAG (exon 5); SEQ ID NO.6: GAGCACGTGCAGAAACTAATTCCCGTGTCAGTGGTGTTGATGGATATGAGACAGAAGGCATTCGAGGACTCCGGGCCCTTGGTGTTAGGGACCTTTCTTATAGGCTGGTCTTTCTTGCCTGCTGTGTTGCGCCAACCAACCCAAGG (exon 6); SEQ ID NO.7: TTTGGGGGGAAAGAGCTCAGAGATGAGGAACAGACAGCTGAGAGCATTAAGAACCAAATGACTGTGAAAGAATGGGAGAAAGTGTTTGAGATGAGTCAAGATAAAAATCTATACCACAATCTTTGTACCAGCCTGTTCCCTACTATACATG (exon 7); SEQ ID NO.8: GCAATGATGAAGTAAAACGGGGTGTCCTGCTGATGCTCTTTGGTGGCGTTCCAAAGACAACAGGAGAAGGGACCTCTCTTCGAGGGGACATAAATGTTTGCATTGTTGGTGACCCAAGTACAGCTAAGAGCCAATTTCTCAA (exon 8); SEQ ID NO.9: GCACGTGGAGGAGTTCAGCCCCAGAGCTGTCTACACCAGTGGTAAAGCGTCCAGTGCTGCTGGCTTAACAGCAGCTGTTGTGAGAGATGAAGAATCTCATGAGTTTGTCATTGAGGCTGGAGCTTTGATGTTGGCTGATAAT (exon 9); SEQ ID NO.10: GGTGTGTGTTGTATTGATGAATTTGATAAGATGGACGTGCGGGATCAAGTTGCTATTCATGAAGCTATGGAACAGCAGACCATATCCATCACTAAAGCAGGAGTGAAG (exon 10); SEQ ID NO.11: GCTACTCTGAACGCCCGGACGTCCATTTTGGCAGCAGCAAACCCAATCAGTGGACACTATGACAGATCAAAATCATTGAAACAGAATATAAATTTGTCAGCTCCCATCATGTCCCGATTCGATCTCTTCTTTATCCTTGTGGATGAATGTAATGAG (exon 11); SEQ ID NO.12: GTTACAGATTATGCCATTGCCAGGCGCATAGTAGATTTGCATTCAAGAATTGAGGAATCAATTGATCGTGTCTATTCCCTCGATGATATCAGAAGATATCTTCTCTTTGCAAGACAGTTTAAACCCAAG (exon 12); SEQ ID NO.13: ATTTCCAAAGAGTCAGAGGACTTCATTGTGGAGCAATATAAACATCTCCGCCAGAGAGATGGTTCTGGAGTGACCAAGTCTTCATGGAGGATTACAGTGCGACAGCTTGAGAGCATGATTCGTCTCTCTGAAGCTATGGCTCGGATGCACTGCTGTGATGAG (exon 13); SEQ ID NO.14: GTCCAACCTAAACATGTGAAGGAAGCTTTCCGGTTACTGAATAAATCAATCATCCGTGTGGAAACACCTGATGTCAATCTAGATCAAGAGGAAGAGATCCAGATGGAGGTAGATGAGGGTGCTGGTGGCATCAATG (exon 14); SEQ ID NO.15: GTCATGCTGACAGCCCTGCTCCTGTGAACGGGATCAATGGCTACAATGAAGACATAAATCAAGAGTCTGCTCCCAAAGCCTCCTTAAGGCTGGGCTTCTCTGAGTACTGCCGAATCTCTAACCTTATTGTGCTTCACCTCAGAAAGGTGGAAGAAG (exon 15); SEQ ID NO.16: AAGAGGACGAGTCAGCATTAAAGAGGAGCGAGCTTGTTAACTGGTACTTGAAGGAAATCGAATCAGAGATAGACTCTGAAGAAGAACTTATAAATAAAAAAAGAATCATAGAGAAAGTTATTCATCGACTCACACACTAT (exon 16); SEQ ID NO.17: GATCATGTTCTAATTGAGCTCACCCAGGCTGGATTGAAAGGCTCCACAGAGGGAAGTGAGAGCTATGAAGAAGATCCCTACTTGGTAGTTAACCCTAACTACTTGCTCGAAGATTGA (exon 17).

[0036] MCM6 gene exon 12-intron 12-exon 13-intron 13-exon 14 sequence (SEQ ID NO.18):

[0037] SSO design sequence and location; The SSO#1 sequence is: CCTTTGGAAATCTGTTTCA (SEQ ID NO.19); Reverse complementary sequence: TGAAACAGATTTCCAAAGAG (SEQ ID NO.20); Corresponding position: the junction position between intron 12 and exon 13 (i.e., bases 1345-1364 of SEQ ID NO.18).

[0038] SSO#2: CACAGCAGTGCATCCGAGCC (SEQ ID NO.21); Reverse complementary sequence: GGCTCGGATGCACTGCTGTG (SEQ ID NO.22); Corresponding position: internal position of exon 13 (i.e., bases 1490-1509 of SEQ ID NO.18).

[0039] The sequence information of shRNA, siRNA, ASO and SSO involved in this invention is shown in Table 1.

[0040] Table 1. Sequence information of shRNA, siRNA, ASO, and SSO Note: All siRNAs in the table are of the sense strand, and the antisense strand is the opposite complement to it.

[0041] Example 1 1. Materials and Methods 1.1 Public Data Acquisition and Bioinformatics Analysis Transcriptome data of uterine corpus endometrial carcinoma (UCEC) were obtained from The Cancer Genome Atlas (TCGA) database using the GEPIA3 platform and the UCSC Xena database. Protein expression data of EC were obtained from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) database and used for protein level validation. Pan-cancer expression of EFTUD2 and MCM6 in tumors and adjacent normal tissues was analyzed using GEPIA3 and UALCAN, respectively.

[0042] Based on regulatory potential (RP) scores, the Cistrome Toolkit was used to predict candidate transcription factors that may regulate EFTUD2. The FOXM1 binding motif MA2469.1 was obtained from the JASPAR database. The public ChIP-seq dataset from Cistrome was used to assess the enrichment of FOXM1 near the EFTUD2 transcription start site (TSS). Genes co-expressed with EFTUD2 in the TCGA-UCEC cohort were identified using cBioPortal.

[0043] Overall survival analysis of candidate genes was performed using the Kaplan-Meier Plotter. Gene Ontology (GO) enrichment analysis was performed using DAVID, and enrichment maps were generated using GraphPad Prism 9. Alternative splicing (AS) events were analyzed using rMATS based on raw RNA-seq data. Exon skipping events were visualized using Sashimi plots in Integrative Genomics Viewer (IGV). Transcriptome and proteome heatmaps were generated using TBtools-II.

[0044] 1.2 Patient Specimen Collection Freshly cryopreserved endometrial cancer (EC) tissue and normal endometrium (EM) tissue were obtained from patients who underwent radical hysterectomy at Qilu Hospital of Shandong University (Jinan, China). Immediately after surgical resection, tissue samples were flash-frozen in liquid nitrogen and stored at -80°C until subsequent use. This invention complies with the Declaration of Helsinki and has been approved by the Institutional Ethics Committee of Qilu Hospital of Shandong University. All participants signed written informed consent forms.

[0045] 1.3 RNA extraction and real-time quantitative PCR (qPCR) Total RNA was extracted from cultured cells or tissue samples using TRIzol reagent. The purified RNA was reverse transcribed into cDNA for subsequent qPCR analysis. Gene-specific primers were used to quantitatively detect total transcript abundance and splice isoforms. For MCM6 splicing analysis, isoform-specific primers were designed to distinguish between MCM6-L transcripts containing exon 13 and MCM6-S transcripts that skip exon 13. GAPDH was used as an internal control. -ΔΔCt The method calculates the relative expression level.

[0046] 1.4 Western blotting Cells and tumor tissues were lysed for 30 min using pre-chilled RIPA lysis buffer containing protease and phosphatase inhibitors. They were then centrifuged at 12,000 × g for 15 min at 4 °C, and the supernatant was collected. Protein concentration was determined using the BCA method. Equal volumes of protein samples were separated by SDS-PAGE and then electrotransferred to PVDF membranes. The membranes were blocked with 5% skim milk powder for 1 h, followed by overnight incubation with the corresponding primary antibody at 4 °C. After washing, the membranes were incubated with HRP-labeled secondary antibody at room temperature for 1 h. Protein bands were detected using enhanced chemiluminescence reagent. β-actin was used as an internal control for sample loading.

[0047] 1.5 Immunohistochemistry (IHC) Formalin-fixed, paraffin-embedded tissue sections were dewaxed and rehydrated, followed by antigen retrieval in Tris-EDTA buffer (pH 9.0). After blocking endogenous peroxidase activity with hydrogen peroxide, the sections were incubated with normal goat serum to reduce nonspecific binding. Subsequently, the sections were incubated overnight at 4°C with either anti-EFTUD2 (Proteintech, 10208-1-AP) or anti-MCM6 primary antibody (Proteintech, 13347-2-AP). Immunostaining was performed using a commercial IHC detection kit (ZSGB-BIO, Beijing, China), with 3,3′-diaminobenzidine (DAB; ZSGB-BIO, ZLI-9018) as the substrate.

[0048] 1.6 Cell Culture This invention uses Ishikawa, AN3CA, and HEC-1A as human EC cell lines. Cells were purchased from Cyagen Biosciences (Guangzhou, China), Haixing Biotechnology (Suzhou, China), or the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), respectively. Their corresponding RRIDs are CVCL_2529, CVCL_0028, and CVCL_0293. Cell identity was confirmed by STR typing, and mycoplasma testing was routinely performed during culture. Ishikawa cells were cultured in DMEM; AN3CA cells were cultured in Minimum Essential Medium (MEM) supplemented with 1% non-essential amino acids and 1 mM sodium pyruvate; HEC-1A cells were cultured in McCoy's 5A medium. All complete media were supplemented with 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. Cells were cultured in a humidified incubator at 37°C and 5% CO2.

[0049] 1.7 Plasmid construction, transfection, and lentivirus transduction Small interfering RNAs (siRNAs) targeting ETUD2, MCM6, and FOXM1, as well as ASOs and SSOs, were synthesized by Gemma Pharmaceutical Technology Co., Ltd. (Shanghai, China). Transient transfection of siRNAs, ASOs, SSOs, or plasmids was performed using Lipofectamine 2000 according to the manufacturer's instructions. Oligonucleotide sequences are shown in Table 1. Short hairpin RNA (shRNA) constructs targeting ETUD2 or MCM6 were designed and prepared by Boshan Biotechnology Co., Ltd. (Jinan, China).

[0050] For transient overexpression experiments, the coding sequences for human EFTUD2 and FOXM1, as well as the coding sequences for the full-length MCM6 (MCM6-L) and exon 13 skipping MCM6 (MCM6-S) isoforms, were cloned into the pcDNA3.1(+) vector, and a 3×Flag or Myc tag was fused to the C-terminus. For stable overexpression experiments, the corresponding coding sequences were cloned into pLVX or pCMV lentiviral vectors. The EFTUD2 promoter fragment containing the predicted FOXM1 binding region and its corresponding mutant fragment were cloned into the pGL4.26 luciferase reporter vector. Plasmid construction and sequencing were performed by Boshan Biotechnology Co., Ltd.

[0051] Depending on the specific experimental design, gene expression was manipulated through transient transfection or stable lentiviral transduction. Lentiviral particles were prepared in HEK293T cells: the corresponding lentiviral plasmids (pLKO.1, pLVX, or pCMV) were co-transfected with packaging plasmids psPAX2 and pMD2.G. Viral supernatants were collected at 48 h and 72 h post-transfection, filtered through a 0.45 μm filter, and used to infect target EC cells. Stable cell pools were obtained by screening for appropriate antibiotics based on the antibiotic resistance markers carried by the lentiviral vectors.

[0052] 1.8 In vitro functional experiments DNA synthesis capacity was assessed using an EdU incorporation detection kit (Beyotime, China). In short, cells were incubated with EdU, fixed, permeabilized, and then chemically labeled according to the manufacturer's instructions. Images were acquired using fluorescence microscopy, and the proportion of EdU-positive cells was calculated.

[0053] Cell migration assays were performed using Transwell chambers with 8 μm pore sizes. Cells were resuspended in serum-free medium and seeded in the upper chamber, while serum-containing medium was added to the lower chamber to create a chemotactic gradient. After a specified incubation time, unmigrated cells were removed from the upper membrane surface. Cells that migrated to the lower membrane surface were fixed, stained with crystal violet, photographed, and quantified in five random microscopic fields. In invasion assays, the membrane was pre-coated with Matrigel before cell seeding; cells that crossed the Matrigel-coated membrane were treated and quantified using the same method.

[0054] In the clonogenic assay, transfected cells were seeded at low density and cultured until visible clones formed. The cells were then fixed, stained with crystal violet, and the number of clones was counted.

[0055] Apoptosis and cell cycle distribution were analyzed using appropriate staining kits and flow cytometry. Data were acquired by flow cytometer and analyzed using appropriate software.

[0056] 1.9 In vivo xenograft tumor experiment All animal experiments were approved by the Laboratory Animal Ethics Committee of Shandong University. Four-week-old female BALB / c nude mice were purchased from Jicui Pharmaceutical (Jiangsu, China) and housed under specific pathogen-free (SPF) conditions. For cell line-derived xenograft experiments, stably knocked-down Ishikawa cells or corresponding control cells were subcutaneously injected into the axillary region of the nude mice. Tumor growth was monitored regularly. At the end of the experiment, the mice were sacrificed, the xenograft tumors were dissected, photographed, weighed, and used for subsequent analysis.

[0057] 1.10 Patient-derived xenograft (PDX) model and treatment intervention A PDX model was established using fresh EC tumor specimens. Viable tumor tissue was cut into small pieces and subcutaneously implanted into immunodeficient NCG mice purchased from Jicui Pharmaceutical. After successful tumor formation, the tumors were continuously passaged in recipient mice to obtain sufficient tumor material for therapeutic experiments.

[0058] Mice bearing tumors of similar size were randomly assigned to different treatment groups. SSO or a corresponding disordered control oligonucleotide was administered intratumorally, with each mouse receiving 5 nmol SSO or a corresponding disordered control oligonucleotide + 3 μL lipofectamine 2000 + 25 μL Opti-MEM. Tumor volume was calculated using the following formula: Volume = Length × Width 2 / 2. At the end of the study, the tumors were dissected, their size and weight were measured, and statistical analysis was performed.

[0059] 1.11 RNA-seq and AS analysis Cells transfected with either EFTUD2-targeting siRNA or control siRNA were collected 48 h post-transfection. Total RNA was extracted and quality-assessed, followed by library construction and sequencing by Boshan Biotechnology Co., Ltd. Differential gene expression in the resulting RNA-seq data was analyzed using the DEGseq software package. |log2FC| ≥ 1 and corrected p Genes with a value <0.05 were defined as differentially expressed genes. rMATS was used to identify AS events to analyze EFTUD2 deletion-related splicing changes. Events with |IncLevelDiff|>0.1 and FDR<0.05 were considered statistically significant.

[0060] 1.12 RNA Immunoprecipitation Assay Cells expressing the Flag tag EFTUD2 were lysed under RNase-free conditions using an EZ-Magna RIP kit (Millipore, USA). Cell lysates were incubated with anti-Flag antibody (Sigma-Aldrich, F1804), with normal IgG serving as a negative control. RNA-protein complexes were recovered using Protein A / G magnetic beads and washed to reduce non-specific binding. The co-precipitated RNA was then purified, reverse transcribed, and quantified by qPCR. Transcript enrichment was calculated relative to the IgG control.

[0061] 1.13 RNA pull-down experiment In the RNA pull-down assay, a biotin-labeled MCM6 RNA probe covering exons 12-14 of MCM6 and containing partial sequences of introns 12 and 13 was designed. The probe was prepared by Watson Biotechnology Co., Ltd. (Jinan, China) via in vitro transcription and incubated with Ishikawa cell nuclear extract. The probe-bound ribonucleoprotein complex was captured using streptavidin magnetic beads. After washing the beads, the bound proteins were eluted, and the specified proteins, including the anti-EFTUD2 antibody (Proteintech, 67855-1-Ig), were detected by Western blotting.

[0062] 1.14 Immunoprecipitation To investigate the ability of MCM6 isoforms to integrate into the MCM2-containing complex, the corresponding tagged MCM6 constructs were expressed in MCM6-knockdown cells, followed by anti-MCM2 immunoprecipitation. Cells were first transfected with siRNA targeting endogenous MCM6, then transfected with MCM6-S-Flag alone, or co-transfected with a fixed dose of MCM6-L-Myc and escalating doses of MCM6-S-Flag. Forty-eight hours after plasmid transfection, cells were treated with MG132 for six hours, then collected and lysed using pre-chilled IP lysis buffer containing a protease inhibitor. An equal volume of clear lysis buffer and anti-MCM2 antibody were incubated overnight at 4°C by rotation, followed by incubation with Protein A / G magnetic beads. The beads were washed three times with lysis buffer, and the bound proteins were eluted by boiling with SDS loading buffer. Input and immunoprecipitated samples were separated by SDS-PAGE, and Western blot analysis was performed using antibodies against MCM2, Flag, Myc, and MCM6.

[0063] 1.15 Chromatin Immunoprecipitation Assay The binding of FOXM1 to the EFTUD2 promoter was assessed using ChIP-qPCR. EC cells were fixed in formaldehyde to cross-link the protein-DNA complex, followed by chromatin fragmentation by sonication. Fragmented chromatin was immunoprecipitated using anti-Flag antibody (Sigma-Aldrich, F1804) or control IgG. After reversing the cross-linking, the DNA was purified and recovered, and qPCR analysis was performed using primers covering the predicted FOXM1 binding region in the EFTUD2 promoter. ChIP enrichment was normalized to the input chromatin and expressed as a percentage of input.

[0064] 1.16 Dual-luciferase reporter assay ETUD2 promoter activity was detected using a dual-luciferase reporter assay. Cells were co-transfected with pGL4.26 reporter plasmid carrying the wild-type ETUD2 promoter fragment or the corresponding mutant fragment, as well as FOXM1-targeting siRNA or disordered control siRNA. pRL-TK Renilla luciferase plasmid was also added to correct for transfection efficiency.

[0065] Forty-eight hours post-transfection, the activities of firefly luciferase and Renilla luciferase were measured using the Dual-Luciferase Reporter Assay System (Promega). Relative promoter activities were calculated as the ratio of firefly luciferase activity to Renilla luciferase activity.

[0066] 1.17 Statistical Analysis The comparison between the two groups was performed using unpaired two-tailed Student's tTests were performed. One-way or two-way ANOVA was used for experiments involving two or more groups, combined with appropriate post-hoc tests. Survival curves were plotted using the Kaplan-Meier method and compared using the log-rank test. Statistical analysis was performed using GraphPad Prism 9.0. p A value <0.05 is considered statistically significant.

[0067] 2. Experimental Results 2.1 MCM6 defines clinically relevant replication helicase dependence in EC. MCM6 encodes one of the core subunits of the MCM2-7 replicating helicase complex. Figure 1 Analysis of the TCGA-UCEC dataset showed that, compared with normal endometrium (EM), all MCM2-7 family members were upregulated in UCEC tissues (A). Figure 1 (B). Elevated MCM6 expression was further validated at both the mRNA and protein levels in multiple independent datasets. Figure 1 (Medium CD). Survival analysis showed that high MCM6 expression was associated with poorer overall survival in EC patients ( Figure 1 (E). Pan-cancer analysis further showed that MCM6 was upregulated in multiple tumor types. Figure 1 (Middle F).

[0068] Subsequently, the expression of MCM6 was examined in a clinical cohort. qPCR and Western blot analyses confirmed that both the mRNA and protein levels of MCM6 were significantly upregulated in EC tissues. Figure 1 Immunohistochemical staining showed that MCM6 was mainly located in the cell nucleus, and its staining intensity in EC tissue was significantly higher than that in normal EM tissue. Figure 1 (J). The above results support the abnormal upregulation of MCM6 in EC and suggest its important clinical relevance.

[0069] Next, this invention further investigates whether MCM6 is involved in regulating the malignant phenotype of EC cells. Western blot analysis confirmed that MCM6 was effectively knocked down in Ishikawa, AN3CA, and HEC-1A cells. Figure 1 Functional experiments showed that knockdown of MCM6 significantly reduced cell viability, EdU incorporation levels, and colony formation ability. Figure 1 Flow cytometry analysis showed that MCM6 depletion induced apoptosis in Ishikawa and AN3CA cells. Figure 1 (O).

[0070] Furthermore, this invention uses a subcutaneous xenograft tumor model to evaluate the effect of MCM6 depletion on in vivo tumor growth. Ishikawa cells stably expressing sh-MCM6#1, sh-MCM6#2, or control shRNA were subcutaneously seeded into nude mice. Compared with the control group xenograft tumors, the MCM6 knockdown group showed significantly slower tumor growth, with both tumor volume and weight significantly reduced. Figure 1 (PR). In summary, these data indicate that MCM6 is a clinically relevant replication helicase component in ECs and a key factor essential for maintaining EC cell growth, malignant phenotype, and in vivo tumor growth.

[0071] 2.2 EFTUD2 deletion affects DNA replication program by regulating alternative splicing, and MCM6 was identified as a key effector molecule. To systematically analyze the changes in downstream gene expression and splicing caused by ETUD2 deletion, this invention employs an siRNA-mediated ETUD2 knockdown strategy in Ishikawa cells and performs transcriptome sequencing (RNA-seq). Figure 2 (A). Differential expression analysis identified a total of 2,666 differentially expressed genes (DEGs), of which 993 were upregulated and 1,673 were downregulated (|log2FC| ≥ 1, after correction). P <0.05)( Figure 2 B). GO enrichment analysis showed that the above DEGs were significantly enriched in biological processes such as signal transduction, cell adhesion, angiogenesis, ciliary assembly, transmembrane transport, and integrin-mediated signaling pathways. Figure 2 (C)

[0072] Further analysis of splicing variant events using rMATS software (|IncLevelDifference|>0.1, FDR<0.05) identified a total of 8,621 differential splicing (AS) events. Among these, skipped exon (SE) was the most common, accounting for 4,881 cases (56.62%); followed by retained intron (RI; 1,195 cases, 13.86%), variable 3′ splice site (A3SS; 997 cases, 11.56%), variable 5′ splice site (A5SS; 836 cases, 9.70%), and mutually exclusive exons (MXE; 712 cases, 8.26%). Figure 2 (D). Given that SE is the most prevalent splicing pattern, subsequent analysis will focus on this type of event.

[0073] To screen target genes regulated by EFTUD2 at both expression and splicing levels, this invention will downregulate DEGs (log2FC ≤ -1, padjThe intersection of genes with <0.05 and the set of genes that have experienced significant SE events yielded 181 candidate genes. Figure 2 E). GO enrichment analysis of the above genes revealed significant enrichment in pathways such as ciliary assembly, cell process organization, DNA homologous recombination, fatty acid metabolism, DNA replication, and spermidine transport. Figure 2 (F). Among them, the significant enrichment of DNA recombination and DNA replication-related pathways suggests that EFTUD2 deletion may affect the proliferation mechanism of tumor cells by synergistically regulating gene expression and splicing.

[0074] To further narrow down the candidate pool, this invention integrates the above 181 genes with genes significantly upregulated in TCGA-UCEC and differentially expressed proteins in CPTAC-UCEC, ultimately screening out 15 potential downstream effector molecules. Figure 2 (G). In this candidate list, MCM6 and EFTUD2 showed the strongest positive correlation at the mRNA level (Pearson in TCGA-UCEC). r =0.6504; Figure 2 A similar trend was observed at the protein level (Pearson in CPTAC-UCEC). r = 0.5925; Figure 2 (I). Furthermore, in both of the aforementioned datasets, MCM6 expression in endometrial cancer (EC) tissues was significantly higher than in normal endometrium (EM). Figure 2 JK (Chinese).

[0075] To confirm the clinical relevance of the ETUD2-MCM6 axis, this invention further analyzed fresh frozen EC samples from our center's clinical cohort. The results showed a significant positive correlation between ETUD2 and MCM6 mRNA expression (Pearson). r = 0.5757; Figure 2 In addition, in Ishikawa, AN3CA, and HEC-1A cells, knockdown of EFTUD2 using two independent siRNAs significantly reduced both the mRNA and protein levels of MCM6. Figure 2 (MN). In summary, by integrating multi-omics data and functional experimental results, we confirm that MCM6 is a key effector molecule in the EFTUD2-mediated splicing regulatory pathway, linking splicing abnormalities with the DNA replication program, and has important functional significance in EC.

[0076] 2.3 Integrated multi-omics analysis identified EFTUD2 as a clinically relevant spliceosome-dependent factor in endometrial cancer. To screen for splicing factors associated with endometrial cancer (EC) progression, this invention utilizes the GEPIA3 platform to analyze differential gene expression between UCEC tissues and normal endometrium (EM) in the TCGA cohort, setting a threshold of |log2FC| ≥ 0.8 and correcting for... q <0.01, a total of 7,369 differentially expressed genes (DEGs) were identified. Further analysis of upregulated DEGs ( n By intersecting genes from the KEGG spliceosome pathway (= 4,610) and upregulated proteins in the CPCAC-UCEC database, 10 candidate genes with significantly elevated mRNA and protein levels were identified. Cross-validation using TCGA, GTEx, and CPCAC datasets revealed that six of these genes—ALYREF, ETUD2, PUF60, SNRPA1, SNRPD3, and SNRPG—were persistently highly expressed in EC tissues, significantly higher than in normal EM. Subsequently, survival analysis was used to assess the clinical relevance of these six candidate genes. The results showed that only high expression of ETUD2 was associated with clinical prognosis in EC patients, and therefore it was selected as the focus of future research.

[0077] Based on transcriptomic and proteomic data analysis from TCGA-UCEC and CPTAC-UCEC, differential expression of EFUTD2 in EC and EM was analyzed. Figure 3 As shown in Figure AB. Analysis based on the Kmplotter database showed that high expression of EFTUD2 was significantly associated with shortened overall survival in EC patients. Figure 3 (C). Given the important prognostic and biological stratification value of molecular subtyping for EC, this invention further investigates the expression characteristics of EFTUD2 in TCGA / CPTAC molecular subtypes. In the CPTAC-UCEC proteome cohort annotated by TCGA molecular subtypes, the abundance of EFTUD2 protein differed significantly among different subtypes, showing significant enrichment in copy-number high (CN-H) tumors, significantly higher than in copy-number low (CN-L) and microsatellite highly unstable (MSI-H) subtypes; while there was no statistically significant difference between CN-H and POLE hypermutant subtypes. Figure 3 (D). This result suggests that EFTUD2 upregulation is closely associated with the CN-H subtype—a subtype characterized by extensive copy number variation, representing a clinically high-risk population.

[0078] To verify the above findings, this invention detected EFTUD2 expression in an independent clinical cohort. Consistent qPCR and Western blot analyses showed that the mRNA and protein levels of EFTUD2 in EC tissues were significantly higher than those in adjacent normal tissues. Figure 3In EC (endothelial cells), immunohistochemical (IHC) results showed that EFTUD2 was mainly located in the cell nucleus, and the staining intensity in EC tissue was significantly stronger than that in normal EM (endothelial cells). Figure 3 The presence of H in the middle of the spectrum further confirms its abnormally high expression in EC.

[0079] To clarify whether EFTUD2 directly participates in the regulation of malignant phenotypes in EC, this invention used two independent siRNAs to efficiently knock down EFTUD2 in Ishikawa, AN3CA, and HEC-1A cells. Functional experiments showed that EFTUD2 deficiency significantly inhibited cell viability (…). Figure 3 (I) Cloning ability ( Figure 3 (J) and EdU incorporation rate ( Figure 3 Flow cytometry analysis showed that EFTUD2 silencing induced G1 phase arrest (K). Figure 3 LM) and promotes apoptosis ( Figure 3 Medium NO).

[0080] To evaluate the effect of ETUD2 deficiency on tumor growth in vivo, this invention constructed a subcutaneous xenograft tumor model with stable ETUD2 knockdown in Ishikawa cells. Results showed that the tumor growth rate in the ETUD2 silencing group was significantly lower than that in the control group during the 15-day observation period. Figure 3 (P); tumor volume and weight at the endpoint were also significantly reduced ( Figure 3 (QR). In summary, this invention, through the integration of bioinformatics screening, clinical validation, and functional experiments, systematically confirms that EFTUD2 is a spliceosome-dependent factor with clear clinical significance in EC. It is not only significantly associated with poor prognosis, but also drives EC cell proliferation, survival, and metastasis potential both in vitro and in vivo, suggesting its value as a potential therapeutic target.

[0081] 2.4 EFTUD2 promotes the inclusion of the MCM6-L isoform state with replication-functional adaptability in exon 13. To clarify whether ETUD2 regulates MCM6 at the splicing level, this invention analyzed the splicing changes of MCM6 in Ishikawa cells after ETUD2 knockdown. Sashimi diagrams showed that ETUD2 deletion increased exon 13 skipping events in MCM6. Figure 4 (A). The classic transcript of MCM6, ENST00000264156, also annotated as MCM6-201, is named MCM6-L in this invention, encoding a protein of 821 amino acids. Exon 13 skipping produces a shorter in-frame transcript, ENST00000939156 / MCM6-210, hereinafter named MCM6-S, which lacks the 54-amino acid segment encoded by exon 13 (…). Figure 4(Middle B). Based on the domain annotations of cBioPortal and ExonSkip, the fragment is located within the AAA-lid domain of MCM6, where amino acids 586-639 encoded by exon 13 are located within the annotated AAA-lid region (amino acids 571-656). Figure 4 (CD). Given that the AAA-lid domain is involved in the ATP-dependent conformational remodeling process of MCM helicase, the above annotation results suggest that exon 13 inclusion may be crucial for maintaining an MCM6 isoform that is predicted to support the function of replicating helicase.

[0082] Subsequently, this invention further evaluated whether this isomer state was related to EC. TCGA-UCEC data analysis showed that, compared with normal EM, MCM6-L expression was significantly increased in UCEC tissues ( Figure 4 In the Qilu cohort, isoform-specific qPCR analysis further demonstrated that MCM6-L was the major expressed isoform of MCM6 in both normal EM and EC tissues. Figure 4 Consistent with this, the level of MCM6-L transcripts in EC tissues was significantly higher than that in normal EM tissues (FG). Figure 4 In contrast, the overall expression level of MCM6-S was lower, and no significant increase was observed between the two groups (H); Figure 4 Pan-cancer analysis showed that MCM6-L was widely upregulated in a variety of human malignancies (I). Figure 4 (J). Correlation analysis further confirmed that in the TCGA-UCEC cohort, EFTUD2 and MCM6-L mRNA levels were significantly positively correlated (Pearson). r = 0.6348, p <0.0001; Figure 4 (Middle K). In the Qilu cohort, EFTUD2 expression was also positively correlated with the MCM6-L / MCM6-total ratio (Pearson). r = 0.4873, p =0.0026; Figure 4 The abundance of EFTUD2 (in the L-type) suggests that it is closely related to the maintenance of the MCM6-L isomer state.

[0083] To further verify the EFTUD2-dependent isoform regulation at the experimental level, this invention designed isoform-specific primers: a primer targeting exon 13 is used to detect MCM6-L, and a primer spanning the exon 12-14 linker region is used to detect MCM6-S. Figure 4 The results showed that EFTUD2 knockdown significantly increased the MCM6-S / MCM6-total ratio (M). Figure 4(N). Further RT-PCR analysis using primers flanking exon 13 revealed that EFTUD2 deletion resulted in a decrease in the MCM6-L product containing exon 13, while an increase in the MCM6-S product containing skipping exon 13. Figure 4 RIP-qPCR analysis showed that endogenous MCM6 transcripts were significantly enriched in the EFTUD2 immunoprecipitation complex (O). Figure 4 (P); Simultaneously, RNA pull-down experiments using biotin-labeled probes covering exons 12-14 and introns 12 and 13 of MCM6 also enriched EFTUD2 protein (P). Figure 4 (Q). The above results support the association between EFTUD2 and the region containing exon 13 in the MCM6 precursor mRNA.

[0084] Subsequently, this invention further investigated whether this splicing conversion was accompanied by changes in MCM6 RNA stability. Actinomycin D tracking assays combined with qPCR detection showed that EFTUD2 knockdown (using si-EFTUD2#2) shortened the half-life of total MCM6 mRNA. Figure 4 The results (R) suggest that MCM6 transcript stability decreases when classical exon 13 inclusion is disrupted. In summary, these results indicate that ETUD2 can bind to MCM6 precursor mRNA and promote exon 13 inclusion, thereby maintaining the MCM6-L isoform state; this isoform state is expected to contribute to supporting replication helicase function in EC cells.

[0085] 2.5 Exon 13 skipping produces a functionally impaired MCM6-S isomer and interferes with the formation of the MCM6-L complex. Subsequently, this invention compared the stability and functional characteristics of MCM6-L and MCM6-S. Expression vectors for MCM6-L and MCM6-S with flag tags were constructed and introduced into EC cells. Western blot analysis using an anti-MCM6 antibody (immunogen region: 471-821 aa) showed that overexpression of MCM6-L increased the abundance of total MCM6 protein. Figure 5 (A); and further immunoblotting with anti-Flag antibody confirmed that MCM6-S-Flag expression could be detected after transfection ( Figure 5 (B) Under the same transfection conditions, MCM6-L-Flag could be clearly detected, while the accumulation level of MCM6-S-Flag was significantly lower in various EC cell lines. Figure 5 (C)

[0086] Therefore, this invention further investigates whether the low abundance of MCM6-S originates from reduced transcript or protein stability. Actinomycin D tracking experiments using isoform-specific primers showed that, under basal conditions, endogenous MCM6-S transcripts degraded faster than MCM6-L transcripts. Figure 5 (D). At the protein level, treatment with the proteasome inhibitor MG132 increased the abundance of exogenously expressed MCM6-S-Flag ( Figure 5 Treatment with the lysosomal inhibitor chloroquine had a relatively small effect, suggesting that proteasome-mediated degradation is involved in maintaining the low homeostatic protein level of MCM6-S. Therefore, the MCM6 isoform generated by exon 13 skipping has inherent instability at both the RNA and protein levels.

[0087] Next, this invention evaluates whether MCM6-S retains the pro-tumor function of MCM6-L. Exogenous expression of MCM6-L can enhance EdU incorporation levels ( Figure 5 (H) and clone formation ability ( Figure 5 In contrast, MCM6-S failed to promote the aforementioned malignant phenotypes and even showed an inhibitory effect in some experiments. These results indicate that the deletion of the AAA-lid segment encoded by exon 13 weakens the pro-proliferative and pro-tumorigenic activities of MCM6.

[0088] Given that MCM6 functions as a component of the MCM2-7 replication helicase complex, this invention further investigates whether MCM6-S can still bind to the MCM2-containing complex. First, endogenous MCM6 was depleted using siRNA, followed by exogenous expression of MCM6-S-Flag, and treatment with MG132 for 6 h 48 h post-transfection. Immunoprecipitation (Co-IP) using an anti-MCM2 antibody revealed the detection of MCM6-S-Flag in the precipitated complex, indicating that MCM6-S retains its ability to bind to the MCM2-containing complex in HEK293T and Ishikawa cells. Figure 5 JK (Chinese).

[0089] Subsequently, this invention further verified whether MCM6-S interferes with the integration of MCM6-L into the relevant complex. After depletion of endogenous MCM6, cells were co-transfected with a fixed dose of MCM6-L-Myc and an escalating dose of MCM6-S-Flag, and treated with MG132 for 6 h 48 h post-transfection. The results showed that as the expression level of MCM6-S-Flag gradually increased, the amount of MCM6-L-Myc recovered by MCM2 immunoprecipitation gradually decreased; at the same time, the level of MCM6-S-Flag bound to MCM2 gradually increased (…). Figure 5 (Middle LM).

[0090] These findings indicate that MCM6-S is not simply a loss-of-function isoform. Despite its lower stability and impaired function, MCM6-S retains its ability to bind to MCM2 and competitively interferes with the integration of MCM6-L into the MCM2-containing replication helicase complex. This dominant-negative effect provides a mechanistic explanation for how EFTUD2 deletion or exon 13 forced skipping disrupts the classical MCM6-L isoform state, which is thought to contribute to maintaining the normal function of replication helicase in EC cells.

[0091] 2.6 MCM6-L is a functional isomer that supports EFTUD2-dependent EC progression. Having established that ETUD2 promotes classical MCM6-L splicing and that MCM6-L and MCM6-S have different functional characteristics, this invention further examines whether MCM6-L functions as a downstream effector molecule of ETUD2. In Ishikawa, AN3CA, and HEC-1A cells, ETUD2 siRNA (using si-EFTUD2#1) was co-transfected with an empty vector, MCM6-L, or MCM6-S expression plasmids, respectively. The results showed that ETUD2 knockdown significantly reduced cell viability and colony formation ability in all three cell lines; re-expression of MCM6-L partially restored these phenotypes, while MCM6-S had little or no rescue effect. Figure 6 (AB).

[0092] Subsequently, this invention further validated this isoform-specific dependence in vivo. Ishikawa cells stably expressing sh-EFTUD2#1 were transduced into MCM6-L or MCM6-S expression constructs, and then subcutaneously seeded into nude mice. Consistent with in vitro results, ETUD2 deletion significantly inhibited tumor growth and reduced tumor volume and weight; re-expression of MCM6-L partially restored tumor growth, while the effect of MCM6-S was weaker or negligible. Figure 6 (CE). These results indicate that MCM6-L is the major functional isoform supporting EFTUD2-dependent tumor growth.

[0093] To further determine whether endogenous MCM6 is essential for ETUD2-driven malignant phenotype, this invention conducted a reverse dependence experiment. Exogenous expression of ETUD2 enhances EC cell viability, colony formation, migration, and invasion; however, when MCM6 is simultaneously knocked down with siRNA, the aforementioned pro-tumor effects induced by ETUD2 are significantly weakened. Figure 6 The results suggest that MCM6 is a key downstream molecule essential for EFTUD2 to exert its pro-tumor function in vitro.

[0094] Next, this invention utilizes a subcutaneous xenograft tumor model to verify this dependency in vivo. Ishikawa cells stably overexpressing ETUD2 were constructed, and MCM6 was knocked down in combination. Results showed that ETUD2 overexpression significantly accelerated tumor growth and increased endpoint tumor volume and weight; while MCM6 depletion significantly attenuated the pro-tumor growth effect mediated by ETUD2 overexpression. Figure 6 (HJ). In summary, these rescue and dependence experiments together demonstrate that MCM6 is downstream of ETUD2, and the classic MCM6-L isomer is the main functional isomer supporting ETUD2-driven EC progression.

[0095] 2.7 Splice conversion redirects MCM6 isoform output and reveals therapeutic vulnerabilities in EC that can be targeted by oligonucleotides. Given that EFTUD2 is a core spliceosome factor, this invention further explores whether its downstream MCM6 splicing events can be redirected more directly. Referring to the design strategy of Eteplirsen, a clinically approved splice-switching oligonucleotide (SSO), this invention designs two SSOs to induce MCM6 exon 13 skipping. Specifically, SSO#1 targets the 3′ splice acceptor site, and SSO#2 targets the exon region near the 5′ splice donor site. Figure 7 (A). Experimental results showed that SSO#1 exhibited only limited splicing conversion activity, while SSO#2 efficiently promoted exon 13 skipping. Therefore, this invention selected SSO#2 for subsequent research and named it M-SSO.

[0096] Dose-response analysis showed that M-SSO increased the expression of the exon 13 skipping MCM6-S isoform in a concentration-dependent manner; semi-quantitative RT-PCR further confirmed that M-SSO treatment could induce the conversion of the MCM6 transcript from MCM6-L to MCM6-S. Figure 7 (MBC). At concentrations of 25 and 50 nM, M-SSO also reduced the total MCM6 protein abundance ( Figure 7 This is consistent with the decrease in stable MCM6-L production and the increase in unstable, functionally impaired MCM6-S production. Based on these results, 50 nM M-SSO was selected as the working concentration for subsequent functional experiments.

[0097] At the functional level, M-SSO treatment significantly inhibited DNA synthesis and colony formation in EC cells and induced apoptosis. Figure 7Therefore, event-driven induction of MCM6 exon 13 skipping is sufficient to reproduce the key growth-inhibiting effect associated with EFTUD2 deletion. Finally, this invention uses two subcutaneous EC patient-derived xenograft (PDX) models to evaluate the in vivo efficacy of M-SSO. The results showed that, compared with control oligonucleotide treatment, intratumoral administration of M-SSO significantly inhibited PDX tumor growth and reduced tumor volume and weight. Figure 7 IN).

[0098] In summary, these results indicate that the ETUD2-MCM6 axis can be targeted at two levels by oligonucleotide strategies: first, by inhibiting upstream ETUD2 expression through ETUD2-ASO; and second, by directly inducing downstream MCM6 splicing transition through M-SSO. Notably, M-SSO does not directly inhibit core spliceosome factors, but rather redirects MCM6 isoform output from classical MCM6-L to the unstable and impaired MCM6-S. These findings support the use of MCM6 exon 13 skipping as an event-driven therapeutic strategy to disrupt DNA replication-related splicing dependence in EC.

[0099] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A splicing regulatory oligonucleotide targeting exon 13 of MCM6, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

21.

2. The use of the splice-regulated oligonucleotide as described in claim 1 in the preparation of antitumor drugs.

3. The application according to claim 2, characterized in that, The anti-tumor drug is targeted at endometrial cancer.

4. An antitumor drug, characterized in that, The active ingredient includes the splice-regulating oligonucleotide as described in claim 1.

5. The antitumor drug according to claim 4, characterized in that, The antitumor drug also includes pharmaceutically acceptable excipients.

6. Application of reagents that inhibit EFTUD2 gene expression in the preparation of antitumor drugs.

7. The application according to claim 6, characterized in that, The anti-tumor drug is targeted at endometrial cancer.

8. The application according to claim 7, characterized in that, The reagent is siRNA or shRNA.

9. The application according to claim 8, characterized in that, The nucleotide sequence of the positive strand of the siRNA is shown in SEQ ID NO.27 or SEQ ID NO.

28.

10. The application according to claim 8, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID NO.24 or SEQ ID NO.25.

Images