A sgRNA combination targeting hbv, base editing system, pharmaceutical composition and application

Abstract

This invention discloses a combination of sgRNAs targeting HBV, a base editing system, a pharmaceutical composition, and its applications. The sgRNA combination includes a first sgRNA targeting the HBs open reading frame and a second sgRNA targeting the HBx open reading frame, preferably a combination of HBV-Smut_14 and HBV-Xmut_11, which are complementary in function, respectively reducing HBsAg expression or secretion and inhibiting HBx-dependent cccDNA transcriptional activity. The base editing system comprises an adenine base editor and the sgRNA combination or a single sgRNA; and a pharmaceutical composition comprising the base editing system. This base editing system and pharmaceutical composition have shown antiviral effects in both cell and mouse models, reducing cccDNA and levels of integrated HBsAg, HBeAg, and viral RNA, providing a new option for drug preparation in chronic hepatitis B.

Description

Technical Field

[0001] This invention relates to the field of hepatitis B virus targeted drug technology, specifically to a combination of sgRNAs targeting HBV, a base editing system, a pharmaceutical composition, and its applications. Background Technology

[0002] Chronic hepatitis B caused by hepatitis B virus (HBV) infection seriously endangers human health. Currently, clinical medications mainly consist of interferon and nucleoside (acid) analogs: the former has a low response rate and poor tolerability, while the latter requires long-term or even lifelong use, and both are difficult to achieve HBsAg clearance and sustained silencing of cccDNA. The root cause of the difficulty in treating HBV infection lies in two aspects: first, cccDNA in the hepatocyte nucleus serves as a stable template for viral transcription, which existing drugs cannot directly clear or sustainably silence, easily leading to viral rebound after drug withdrawal; second, HBV DNA can integrate into the host genome. Although the integrated sequence does not support complete viral replication, it can continuously produce HBsAg, maintaining viral antigen load and immune tolerance. Therefore, simultaneously inhibiting cccDNA transcriptional activity and the expression of HBsAg from integration is key to achieving functional cure of chronic hepatitis B.

[0003] In recent years, small nucleic acid drugs, represented by ASO and siRNA, have significantly reduced HBsAg, but they act at the RNA level and cannot reach cccDNA or integrated HBV DNA, requiring repeated administration. Epigenetic regulatory strategies are reversible and difficult to achieve permanent silencing. While CRISPR / Cas9-based nuclease editing can directly cleave cccDNA, it relies on DNA double-strand breaks. The presence of HBV integrated sequences means that double-strand breaks may induce large-segment deletions or rearrangements in the host chromosome, limiting clinical safety. Base editing technology can perform site-specific base conversions on the HBV genome without generating double-strand breaks. Existing technologies (such as WO2020 / 231863A1 and WO2023 / 049935A1) have disclosed the use of base editors in conjunction with guide RNAs targeting different regions of HBV to reduce viral antigens and replication indicators, and proposed multi-guide RNA combination strategies. However, the aforementioned existing technologies primarily verify the feasibility of editing different HBV regions, but have not yet provided specific sgRNA sequences targeting specific functional sites of HBx (such as X11 and its mediated F63P / S64P mutations), nor have they provided specific sgRNA combinations and their functional complementarity experimental data that can simultaneously act on the expression of both cccDNA-derived and integrated-derived HBsAg and inhibit HBx-dependent cccDNA transcriptional activity. Therefore, existing technologies still need to screen for sgRNA combinations with clearly defined functional divisions to simultaneously address the two functional curative barriers of persistent expression of integrated-derived HBsAg and persistent transcription of cccDNA.

[0004] Therefore, there is still a need to develop HBV base editing treatments with clearly defined targets, clear mechanisms, and complementary functions. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a combination of sgRNAs targeting HBV, a base editing system, a pharmaceutical composition, and its applications.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention relates to a combination of sgRNAs targeting HBV, comprising: The first sgRNA targets the HBV HBs open reading frame, wherein the spacer sequence of the first sgRNA contains the sequence shown in any one of SEQ ID NO: 13-16, or the sequence having at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 13-16, or containing at least 16 consecutive amino acids of the sequence shown in any one of SEQ ID NO: 13-16. The second sgRNA targets the HBV HBx open reading frame. The spacer sequence of the second sgRNA contains the sequence shown in SEQ ID NO:27 or SEQ ID NO:28, or a sequence that has at least 90% sequence identity with the sequence shown in SEQ ID NO:27 or SEQ ID NO:28, or contains at least 16 consecutive amino acids of the sequence shown in SEQ ID NO:27 or SEQ ID NO:28. The first sgRNA is used to reduce HBsAg expression or secretion, and the second sgRNA is used to inhibit HBx-dependent cccDNA transcriptional activity; the two functions are complementary.

[0007] Furthermore, the first sgRNAs are HBV-Smut_14 (denoted as S14), HBV-Smut_15 (denoted as S15), HBV-Smut_16 (denoted as S16), and HBV-Smut_17 (denoted as S17), and their spacer sequences are shown in SEQ ID NO:13~16, respectively; The second sgRNA is either HBV-Xmut_11 (denoted as X11) or HBV-Xmut_15 (denoted as X15), and its spacer sequence is shown in SEQ ID NO:27 or SEQ ID NO:28.

[0008] Preferably, the first sgRNA is HBV-Smut_14, and its spacer sequence is shown in SEQ ID NO:13; the second sgRNA is HBV-Xmut_11, and its spacer sequence is shown in SEQ ID NO:27.

[0009] Furthermore, the first sgRNA and / or the second sgRNA are full-length sgRNAs, which include the spacer sequence at the 5′ end and a Cas9 sgRNA backbone (Cas9 scaffold) sequence attached to its 3′ end. The sgRNA scaffold sequence is used to bind to the Cas domain in the Cas protein or base editor, thereby forming a ribonucleoprotein complex that can mediate targeted editing.

[0010] Furthermore, the T in the DNA spacer sequence is replaced with U to obtain the RNA spacer sequence, which is then ligated into the Cas9 sgRNA scaffold to form a full-length sgRNA.

[0011] Further, the full-length sgRNA sequence of the first sgRNA is shown in any one of SEQ ID NO:45~48, and the full-length sgRNA sequence of the second sgRNA is shown in SEQ ID NO:59 or SEQ ID NO:60.

[0012] Preferably, the first sgRNA is HBV-Smut_14, and its full-length sgRNA sequence is shown in SEQ ID NO: 45; the second sgRNA is HBV-Xmut_11, and its full-length sgRNA sequence is shown in SEQ ID NO: 59.

[0013] Furthermore, to improve the in vivo stability and resistance to nuclease degradation of sgRNA, the sgRNA contains one or more chemically modified nucleotides, including but not limited to 2'-O-methyl (2′-O-methyl) modification, 2′-fluoro modification, phosphorothioate backbone modification, pseudouridine modification, N1-methylpseudouridine modification, or other modifications that can improve RNA stability, reduce immunogenicity, or improve editing effects.

[0014] Furthermore, the sgRNA contains one or more chemically modified nucleotides, the chemical modifications including 2'-O-methyl modification and / or phosphate thioester backbone modification.

[0015] Preferably, the sgRNA contains a 2′-O-methyl modification in the first three nucleotides at the 5′ end and the last three nucleotides at the 3′ end, and the phosphodiester bonds between each pair of the first four nucleotides at the 5′ end and between each pair of the last four nucleotides at the 3′ end are thiophosphate bonds.

[0016] Furthermore, the chemically modified sgRNA is purified by high performance liquid chromatography, PAGE, DSL or other methods suitable for RNA purification, and then dissolved, quantified, aliquoted and frozen using nuclease-free water or appropriate buffer.

[0017] A second aspect of the invention relates to an sgRNA that targets HBV, said sgRNA being able to target the open reading frame of HBs or HBx.

[0018] Furthermore, the spacer sequence of the sgRNA targeting the HBs open reading frame comprises a sequence as shown in any one of SEQ ID NO: 13-16, or a sequence having at least 90% sequence identity with the sequence shown in any one of SEQ ID NO: 13-16, or comprising at least 16 consecutive amino acids of the sequence shown in any one of SEQ ID NO: 13-16; when the sgRNA is used in conjunction with a base editor, it can introduce base editing mutations into the HBs open reading frame, thereby reducing the expression or secretion of HBsAg.

[0019] Furthermore, the spacer sequence of the sgRNA targeting the HBx open reading frame comprises the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28, or comprising at least 16 consecutive amino acids of the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28; when the sgRNA is used in conjunction with a base editor, it can introduce base editing mutations into the HBx open reading frame, thereby inhibiting HBx-dependent cccDNA transcriptional activity.

[0020] Preferably, the spacer sequence of the sgRNA targeting the HBs open reading frame comprises the sequence shown in any one of SEQ ID NO: 13-16.

[0021] Preferably, the spacer sequence of the sgRNA targeting the HBx open reading frame comprises the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28.

[0022] Furthermore, the sgRNA described in this invention is obtained through screening using the following method: 1) Analysis of HBV genome structure and transcript distribution. The HBV genome is approximately 3.2 kb, containing overlapping open reading frames for HBs, HBc, Pol, and HBx, and multiple functional elements regulating HBV transcription and replication. Based on the distribution characteristics of different transcripts in the HBV genome (serotype: ayw; genotype: D; GenBank Accession number: V01460.1), regions related to HBsAg expression, HBx function, cccDNA transcriptional regulation, or viral replication were selected as candidate target regions.

[0023] 2) Selection of candidate target regions. The candidate target regions include, but are not limited to, the HBs open reading frame, the HBx open reading frame, the S / Pol overlap region, the Epsilon region, the XP / ENI region, the CP / ENII region, and other conserved HBV functional regions. Preferably, the candidate target regions include the HBs open reading frame and the HBx open reading frame. More preferably, the candidate target regions include the N-terminal functional region of the small S protein and the conserved functional region within the C-terminal transactivation domain of HBx.

[0024] 3) Design candidate sgRNAs according to the PAM requirements (5'-NGG-3') and editing window (bases 3-12) of the base editor. The sgRNA may contain a spacer sequence of 18-24 nucleotides, preferably a spacer sequence of 20 nucleotides. The spacer sequence should be complementary to the HBV target sequence, guiding the base editor to the target editing site in the HBV genome, and exhibit <20 nt homology with the human genome sequence.

[0025] 4) Initial screening of candidate sgRNAs based on HBV multi-genotype sequence conservation. Alignment is performed with a set of 11,185 HBV genome sequences downloaded from the HVDB hepatitis virus database to obtain the sequence conservation (number of perfectly matching sequences / total number of HBV gene sequences × 100%). Preferably, sgRNAs with >70% conservation across multiple HBV genotypes are selected. The HBV genotypes include, but are not limited to, A, B, C, D, E, F, G, and H. Preferably, candidate sgRNAs should cover clinically common HBV genotypes and retain key sequences relevant to base editor recognition and editing in the target region.

[0026] 5) Functional screening was performed in HBV-related cell models. HepG-HBV / EGFP cell lines and HepG-HBV / loxPsgRNA screening and validation were performed in the recombinant cccDNA model; and screening and validation were also performed in HepAD38 (HBV replicon model), PLC / PRF / 5 (clinically screened liver cancer cell line containing naturally integrated HBV), and HBV-infected HepG2-NTCP (HBV infection model) cells.

[0027] 6) Based on the inhibitory effects and editing efficiency in different models, select optimal sgRNAs and sgRNA combinations. Preferred sgRNAs are those that can stably reduce HBsAg from both cccDNA-derived and integrated HBV DNA-derived sources, and HBx-derived sgRNAs that can reduce HBsAg, HBeAg, pgRNA, or pgRNA / cccDNA. Further, these two types of sgRNAs are combined to obtain a dual-target combination that exhibits both HBsAg inhibition and cccDNA transcriptional inhibition effects.

[0028] A third aspect of the invention relates to a nucleic acid molecule or expression vector encoding the sgRNA combination described in the first aspect of the invention or the sgRNA described in the second aspect of the invention.

[0029] A fourth aspect of the present invention relates to a base editing system comprising: (1) an adenine base editor, or a nucleic acid molecule encoding said base editor; and (2) The sgRNA combination as described in any of the first aspects of the present invention, or the sgRNA as described in the second aspect of the present invention.

[0030] Furthermore, the adenine base editor comprises a Cas9 nickase domain and an adenosine deaminase domain.

[0031] Furthermore, the nucleic acid molecule encoding the adenine base editor is mRNA.

[0032] Furthermore, the amino acid sequence of the adenine base editor is shown in SEQ ID NO: 65.

[0033] A fifth aspect of the invention relates to a base-edited HBV DNA, said HBV DNA comprising at least one mutation selected from the group consisting of: (1) Codon mutations in the HBs open reading frame that cause the 34th serine of the small S protein to be changed to proline (S34P) and / or the 35th tryptophan to be changed to arginine (W35R); (2) Codon mutations in the HBx open reading frame that cause the 63rd phenylalanine of the HBx protein to be mutated to proline (F63P) and / or the 64th serine to be mutated to proline (S64P); (3) A codon mutation in the HBx open reading frame that causes the leucine at position 71 of the HBx protein to be changed to proline (L71P); The amino acid site numbers described in this invention are all based on HBV genotype D (ayw subtype), whose gene reference sequence GenBank Accession number: V01460.1.

[0034] Preferably, the HBV DNA contains both S34P and W35R mutations in the HBs open reading frame and F63P and S64P mutations in the HBx open reading frame.

[0035] Preferably, the HBV DNA is selected from HBV cccDNA, HBV DNA integrated into the host genome, or HBV replication intermediates.

[0036] Furthermore, in some embodiments, since the HBs open reading frame overlaps with the HBV polymerase (Pol) open reading frame, the base editing can also generate corresponding codon mutations in the HBV polymerase open reading frame; the codon mutations include a codon mutation that changes leucine (Leu, L) at position 377 of the HBV polymerase to proline (Pro, P), and a codon mutation that changes valine (Val, V) at position 378 of the HBV polymerase to alanine (Ala, A).

[0037] Furthermore, the base editing mutations in the HBs open reading frame can lead to HBs protein folding, processing, and intracellular localization. And / or alterations in secretion and transport, including but not limited to causing intracellular retention or abnormal aggregation of HBs protein, thereby reducing the expression or secretion of HBsAg; the base editing mutations in the HBx open reading frame can lead to changes in HBx protein expression, stability, conformation and / or biological function, weakening the antagonistic effect of HBx on the host SMC5 / 6 complex, thereby reducing the transcriptional activity of HBV cccDNA.

[0038] Furthermore, the base-edited HBV DNA also includes HBV DNA fragments containing the HBs open reading frame and / or HBx open reading frame, as well as viral nucleic acid products generated from the edited HBV DNA.

[0039] A sixth aspect of the present invention relates to a pharmaceutical composition, characterized in that it comprises: (1) The sgRNA combination described in the first aspect of the present invention or the sgRNA described in the second aspect of the present invention or the nucleic acid molecule or expression vector described in the third aspect of the present invention; (2) The base editing system described in the fourth aspect of the present invention; (3) Pharmaceutically acceptable carrier.

[0040] Furthermore, the mass ratio of the base editing system to a single sgRNA is 1:(0.1~10); preferably 1:1.

[0041] Furthermore, the mass ratio of the base editing system, the first sgRNA, and the second sgRNA is 1:(0.1~2):(0.1~2); preferably 1:0.5:0.5 or 1:0.8:0.8.

[0042] Furthermore, the carrier is preferably lipid nanoparticles.

[0043] Furthermore, the lipid nanoparticles comprise ionizable lipids, auxiliary lipids, cholesterol, and polyethylene glycol-modified lipids.

[0044] Preferably, the lipid nanoparticles comprise ionizable lipid ALC-0315, phospholipid DSPC, cholesterol, and polyethylene glycol-modified lipids.

[0045] Preferably, the ionizable lipid is ALC-0315, the auxiliary phospholipid is 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC), and the PEGylated lipid is 1,2-dimyristoyl-rac-glycerol-methoxy polyethylene glycol 2000 (DMG-PEG2000) and / or 1,2-distearyl-sn-glycerol-3-phosphoethanolamine-polyethylene glycol 2000-azide (DSPE-PEG2000-N3).

[0046] Furthermore, the surface of the lipid nanoparticles is coupled with a liver-targeting ligand, preferably N-acetylgalactosamine (GalNAc).

[0047] Furthermore, the dosage form of the pharmaceutical composition may be a liquid formulation, a lyophilized formulation, a suspension formulation, or a nanoparticle formulation, or other dosage forms suitable for in vivo administration.

[0048] A seventh aspect of the present invention is a kit comprising the sgRNA combination described in the first aspect of the present invention, the sgRNA described in the second aspect of the present invention, the nucleic acid molecule or expression vector described in the third aspect of the present invention, or the base editing system described in the fourth aspect of the present invention.

[0049] Preferably, the kit further includes reagents for detecting HBV target site editing efficiency and / or reagents for detecting HBsAg and HBeAg levels.

[0050] Furthermore, the kit may also include one or more of the following: delivery vector, nuclease-free water, buffer, positive control, negative control, PCR primers for detecting HBV target site editing efficiency or candidate off-target sites, and primers or probes for detecting HBV DNA or HBV RNA.

[0051] The eighth aspect of the invention is the use of the sgRNA combination described in the first aspect of the invention, the sgRNA described in the second aspect of the invention, the nucleic acid molecule or expression vector described in the third aspect of the invention, the base editing system described in the fourth aspect of the invention, or the pharmaceutical composition described in the sixth aspect of the invention in the preparation of a medicament for treating HBV infection or chronic hepatitis B.

[0052] Furthermore, the HBV infection-related diseases are selected from chronic hepatitis B, HBV-related liver fibrosis, HBV-related cirrhosis, and HBV-related hepatocellular carcinoma risk status; Preferably, the drug is used to reduce the serum HBsAg and / or HBeAg levels of the subject, reduce the HBV pgRNA level, induce epigenetic silencing of cccDNA transcription, or reduce the expression of HBsAg derived from HBV integration sequence.

[0053] Furthermore, the drug is used in combination with a second anti-HBV drug, which is selected from nucleoside (acid) analogs, interferon, HBV-targeting siRNA, antisense oligonucleotides, HBV entry inhibitors, capsid assembly modulators, antibodies, or therapeutic vaccines.

[0054] Furthermore, the drug is administered intravenously in the form of lipid nanoparticles, with a single total RNA dose of 0.01–10 mg / kg.

[0055] Preferably, the total RNA dose of the drug in a single administration is 2-4 mg / kg. The drug is administered twice, with a 3-day interval between the two administrations.

[0056] Furthermore, the first sgRNA and the second sgRNA can be administered simultaneously or sequentially; for example, sgRNA targeting the HBs open reading frame can be administered first to reduce HBsAg expression or secretion, and then sgRNA targeting the HBx open reading frame can be administered to inhibit cccDNA transcriptional activity; or sgRNA targeting the HBx open reading frame can be administered first to inhibit cccDNA transcriptional activity, and then sgRNA targeting the HBs open reading frame can be administered to reduce HBsAg expression or secretion.

[0057] Further, the uses of the drug include any one or more of the following: (1) reducing HBsAg expression or secretion; (2) reducing HBeAg expression or secretion; (3) reducing the levels of HBV pgRNA, preS / S RNA, total HBV RNA, HBV DNA, or HBV DNA replication intermediates; (4) inhibiting the transcriptional activity of HBV cccDNA or cccDNA-like templates; (5) reducing the expression or secretion of HBsAg derived from HBV integration sequences; (6) weakening the expression, stability, conformation, or functional activity of HBx proteins; (7) restoring the restriction effect of the SMC5 / 6 complex on cccDNA; (8) increasing the enrichment of SMC6 or Nse4 on cccDNA-like templates; (9) increasing the enrichment of H3K9me3 on cccDNA-like templates and / or reducing the enrichment of H3K27Ac or RNA polymerase II on cccDNA-like templates; (10) inducing the formation of a transcriptional repressive epigenetic state in cccDNA-like templates; and (11) achieving functional silencing of HBV or promoting functional cure of chronic hepatitis B.

[0058] Furthermore, the HBV infection-related diseases also include acute hepatitis B, HBV-related chronic liver disease, and related disease states caused by persistent HBV infection, persistent HBsAg expression, or persistent cccDNA transcriptional activity.

[0059] The present invention adopts the above technical solution and has the following technical effects compared with the prior art: (1) This invention uses a dual-target combination of sgRNA targeting the HBs open reading frame and sgRNA targeting the HBx open reading frame, so that the two types of sgRNA act on two complementary links of HBsAg expression / secretion and HBx-dependent cccDNA transcriptional regulation, thereby simultaneously reducing HBsAg, HBeAg, pgRNA and viral replication-related indicators in various HBV cell models, covering the two key obstacles to functional cure of chronic HBV infection; (2) The present invention’s S14 introduces amino acid substitution in the first cytoplasmic loop of the small S protein, which leads to HBs protein endoplasmic reticulum retention and secretion blockage, thus simultaneously reducing HBsAg from cccDNA source and HBV integration source, which is more in line with the complex HBsAg source characteristics under chronic infection status. (3) The X11 of the present invention weakens the function of HBx and relieves its antagonism to the host SMC5 / 6 complex by introducing amino acid substitutions into the conserved functional region of HBx, thereby causing the cccDNA template to form a transcriptional repressive epigenetic state with increased H3K9me3, reduced H3K27Ac and RNA Pol II enrichment, thereby achieving functional silencing of cccDNA transcriptional activity without relying on cccDNA clearance. (4) The present invention uses an adenine base editor, which does not rely on DNA double-strand breaks, and has the potential to reduce the risk of host chromosome instability compared with nuclease-based HBV editing schemes; (5) The preferred sgRNA of this invention has been verified by whole-genome conservation analysis and multi-genotype coverage. The S14+X11 combination has a coverage rate of more than 98% for all HBV genotypes and has broad applicability. (6) The preferred sgRNA of this invention was verified by off-target prediction and high-throughput sequencing. The detected off-target sites were all located in non-coding regions, and no off-target editing of protein-coding exon regions was observed, which has a safety basis for further development. (7) The chemically modified sgRNA and ABE mRNA of the present invention, after being delivered by lipid nanoparticles, can achieve in vivo dual-target editing in HBV cccDNA mouse model and significantly reduce serum HBsAg and HBeAg levels (with a maximum reduction of 3.54 log10 and 1.80 log10, respectively), with effects reaching or exceeding those of the siRNA positive control in the clinical stage. Moreover, the animals tolerated the treatment well in the short term (no significant and sustained weight loss was observed up to week 3), and it has further drug development potential. Attached Figure Description

[0060] Figure 1 The following are the design and screening results of HBV base editing candidate sgRNAs in one embodiment of the present invention, wherein A is a schematic diagram of the experimental design; B is the screening result of the effect of candidate sgRNAs targeting HBV regulatory element regions on HBsAg secretion levels; C is the screening result of the effect of HBV-Smut series sgRNAs targeting HBs open reading frames on HBsAg secretion levels; and D is the screening result of the effect of HBV-Xmut series sgRNAs targeting HBx open reading frames on HBsAg and HBeAg secretion levels.

[0061] Figure 2 The present invention provides the functional validation results of preferred sgRNAs in different HBV cell models in one embodiment of the invention. A represents the effect of HBV-Smut-sgRNA and HBV-Xmut-sgRNA, delivered alone or in combination, on the secretion levels of HBsAg and HBeAg in the HepG2-HBV / loxP cell model; B represents the effect of HBV-Smut_14, HBV-Xmut_11, and their combination on cccDNA transcriptional activity indicators (pgRNA and pgRNA / cccDNA) in HepG2-HBV / loxP cells; C represents the effect of different sgRNA combinations on the expression of HBsAg from integration in the HBV integration cell model PLC / PRF / 5; and D represents the effect of candidate sgRNAs and their combinations on HBsAg secretion in the HepAD38 cell model.

[0062] Figure 3 The results of the detection of HBV replication and transcription-related indicators by preferred sgRNA in one embodiment of the present invention are shown. A represents the effect of S14, X11, X15 and their combinations on intracellular HBV DNA replication intermediates (rcDNA, dslDNA and ssDNA) in HepAD38 cells; B represents the effect of S14, X11, X15 and their combinations on the levels of HBV pgRNA and preS / S RNA in HepAD38 cells.

[0063] Figure 4 The above are the detection results of preferred sgRNA on HBV replication and transcription related indicators in one embodiment of the present invention, where C represents the effect of S14, X11, X15 and their combination on HBsAg and HBeAg levels in the HepG2-HBV / loxP cell model; and D represents the effect of S14, X11, X15 and their combination on HBV pgRNA and preS / S RNA levels in HepG2-HBV / loxP cells.

[0064] Figure 5 This is the result of a preferred sgRNA off-target analysis in one embodiment of the present invention.

[0065] Figure 6 The following are the verification results of the preferred sgRNA mechanism of action in one embodiment of the present invention, wherein A is a schematic diagram of the experimental design; B is a schematic diagram of the target sites and editing mutations of S14, X11 and X15 in the open reading frame of HBs or HBx in the HBV genome; C is the result of the effect of the S14 target editing mutation on HBs protein secretion and intracellular localization; D is the result of the effect of the X11 and X15 target editing mutations on HBx protein expression and SMC6 nuclear signaling.

[0066] Figure 7 The following are the verification results of the mechanism of HBx targeted editing-induced cccDNA epigenetic silencing in one embodiment of the present invention, wherein A is a schematic diagram of the experimental design; B is the ChIP-qPCR detection results of the enrichment levels of H3K9me3, RNA polymerase II, H3K27Ac and Nse4 on cccDNA sample templates after X11 and X15 treatment; C is the detection results of HBsAg and HBeAg levels and target site editing efficiency in cell supernatant after S14, X11 and X15 treatment.

[0067] Figure 8This document presents the in vivo pharmacodynamic evaluation results of candidate sgRNAs and the preferred S14+X11 combination in acute and chronic HBV cccDNA mouse models in one embodiment of the present invention. A represents a schematic diagram of the establishment and administration regimen of the acute HBV cccDNA mouse model; B represents the dynamic changes in serum HBsAg levels in each group of mice in the acute mouse model; C represents the changes in serum HBeAg levels in each group of mice in the acute mouse model; D represents the detection results of the base editing efficiency of the target site in liver tissue on day 10 of the acute mouse model; E represents a schematic diagram of the establishment and administration regimen of the chronic HBV cccDNA mouse model; F represents the dynamic changes in serum HBsAg levels in each group of mice in the chronic mouse model; G represents the changes in serum HBeAg levels in each group of mice in the chronic mouse model; and H represents the changes in body weight of mice in the chronic mouse model. Detailed Implementation

[0068] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0069] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0070] The technical solution of the present invention can also be implemented in the following ways; in the absence of conflict, the technical features in the following embodiments can be combined with the technical solutions of any aspect of the present invention and the technical features in the following embodiments.

[0071] In one embodiment, the sgRNA targeting the HBs open reading frame can be selected from the HBV-Smut series of sgRNAs, including but not limited to HBV-Smut_2, HBV-Smut_6, HBV-Smut_8, HBV-Smut_10, HBV-Smut_11, HBV-Smut_12, HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, HBV-Smut_17, HBV-Smut_18, HBV-Smut_19, and HBV-Smut_20; among them, HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, and HBV-Smut_17 have shown good HBsAg inhibitory effects in cell models and are preferred HBs-targeting sgRNAs.

[0072] In one embodiment, the sgRNA targeting the HBx open reading frame can be selected from the HBV-Xmut series of sgRNAs, including but not limited to HBV-Xmut_2, HBV-Xmut_3, HBV-Xmut_5, HBV-Xmut_6, HBV-Xmut_7, HBV-Xmut_9, HBV-Xmut_10, HBV-Xmut_11, HBV-Xmut_15, HBV-Xmut_16, HBV-Xmut_17, HBV-Xmut_18, and HBV-Xmut_20; among them, HBV-Xmut_11 and HBV-Xmut_15 have shown the effect of reducing HBeAg, pgRNA, or cccDNA transcriptional activity-related indicators in cell models, and are preferred HBx-targeting sgRNAs.

[0073] In one embodiment, the sgRNA combination can be any combination of an sgRNA targeting the HBs open reading frame and an sgRNA targeting the HBx open reading frame, including but not limited to S14+X11, S14+X15, S15+X11, S15+X15, S16+X11, S16+X15, S17+X11, and S17+X15.

[0074] In one embodiment, the sgRNA combination may also include two or more sgRNAs, such as a combination of one sgRNA targeting the HBs open reading frame and two sgRNAs targeting the HBx open reading frame, a combination of two sgRNAs targeting the HBs open reading frame and one sgRNA targeting the HBx open reading frame, or a combination of sgRNAs targeting both the HBs and HBx open reading frames and one sgRNA targeting HBV regulatory elements or the S / Pol overlap region.

[0075] In one embodiment, the spacer sequence of the sgRNA may be a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in any one of SEQ ID NO: 13-16, 27, or 28, as long as the sequence can still target the same or similar HBV functional region and can guide the base editor to generate base editing events that reduce HBsAg expression or secretion, weaken HBx function, or inhibit cccDNA transcriptional activity; or it may be a truncated or extended form of the above sequence, for example, deleting or adding 1, 2, 3, 4, or 5 nucleotides at the 5′ end and / or 3′ end, as long as it can still bind to the HBV target sequence and guide the base editor to the target editing region.

[0076] In one embodiment, the sgRNA can be appropriately adjusted according to the sequence differences of different HBV genotypes. For example, for cases where there are individual base differences in the corresponding target regions of HBV A, B, C, D, E, F, G, or H genotypes, variant sgRNAs with functional equivalent sequences to those shown in SEQ ID NO: 13-16, 27, or 28 can be designed based on the target sequence of that genotype to achieve broad-spectrum coverage of different HBV genotypes. In one embodiment, the sgRNA can also be appropriately adjusted according to the PAM sequence requirements of the Cas protein used. For example, when using SpCas9, SaCas9, Cas12, or near-PAM-restricted Cas9 variants, the spacer sequence can be adjusted according to the corresponding PAM position.

[0077] In one embodiment, the sgRNA targeting the HBs open reading frame can target any region of the HBs protein that is related to transmembrane topology, local conformation, particle assembly, endoplasmic reticulum processing, or secretory transport, especially the target region that can cause intracellular retention of the HBs protein, enhanced endoplasmic reticulum colocalization, or blocked secretion.

[0078] In one embodiment, the sgRNA targeting the HBx open reading frame may target the N-terminal negative regulatory domain, the C-terminal transactivation domain, or other regions related to HBx stability, conformation, DDB1 binding, SMC5 / 6 antagonism, or cccDNA transcriptional activation function of the HBx protein. Preferably, it targets the transactivation domain of amino acids 51-154 (aa51-154), the conserved functional region of amino acids 58-84 (aa58-84), or the region near the zinc-binding functional motif containing cysteine ​​residues at positions 61 and / or 69 (C61 / C69).

[0079] In one embodiment, in addition to HBs and HBx open reading frames, the sgRNA combination may further include sgRNAs targeting HBV regulatory elements, S / Pol overlapping regions, Epsilon regions, XP / ENI regions, CP / ENII regions, or other HBV conserved functional regions to further enhance the inhibitory effect on HBV replication, transcription, or antigen expression.

[0080] In one embodiment, the base editor can be a different type of adenine base editor, including but not limited to an adenine base editor composed of Cas9 nickase or a variant thereof and adenosine deaminase or a variant thereof; different versions, different editing windows, different PAM adaptability, or different off-target features of adenine base editors can all be used in this invention. In one embodiment, the base editor can also be a cytosine base editor, as long as it can introduce the C·G to T·A conversion to achieve the purpose of this invention in the HBs open reading frame or HBx open reading frame. In one embodiment, the editing system can also be other precise editing systems that do not rely on DNA double-strand breaks, such as a prime editing system.

[0081] In one embodiment, the base editor can be a different type of adenine base editor, including but not limited to an adenine base editor composed of Cas9 nickase or its variants and adenosine deaminase or its variants; different versions, different editing windows, different PAM adaptability or different off-target features of adenine base editors can all be used in this invention, as long as they can introduce the A·T to G·C conversion to achieve the purpose of this invention in the HBs or HBx target region.

[0082] In one embodiment, the sgRNA may be a full-length sgRNA or a bimolecular guide RNA composed of crRNA and tracrRNA; the sgRNA may be chemically synthesized RNA or transcribed intracellularly from a DNA template, plasmid, viral vector, linear expression cassette, or other nucleic acid expression system.

[0083] In one embodiment, the sgRNA may be in an unmodified, partially modified, or fully modified form; the modification includes, but is not limited to, 2′-O-methyl modification, 2′-fluoro modification, phosphorothioate backbone modification, pseudouridine modification, N1-methylpseudouridine modification, locked nucleic acid modification, or other modifications that can improve RNA stability, reduce nuclease degradation, reduce immunogenicity, or improve editing effect; the modification site is not limited to the first 3 nucleotides at the 5′ end and the last 3 nucleotides at the 3′ end, and chemical modification may be introduced into any one or more nucleotides at the 5′ end, 3′ end, or internally.

[0084] In one embodiment, the base editor may be in the form of mRNA, protein, plasmid DNA, viral vector expression, or linear DNA expression cassette. The sgRNA may be co-encapsulated with the mRNA encoding the base editor in the same delivery vector, or they may be encapsulated separately in different delivery vectors and delivered simultaneously or sequentially. The base editor protein may also be delivered after pre-forming a ribonucleoprotein (RNP) complex with the sgRNA to reduce the sustained expression time of the base editor in cells, thereby reducing the potential off-target risk.

[0085] In one embodiment, the delivery system may be lipid nanoparticles, liposomes, polymer nanoparticles, virus-like particles, exosome-like carriers, inorganic nanoparticles, peptide delivery systems, or other non-viral delivery systems. It may also be adeno-associated virus vectors, adenovirus vectors, lentivirus vectors, or other viral vectors. The delivery system may further incorporate liver-targeting ligands, cell-penetrating peptides, glycoligands, antibodies, or antibody fragments to improve delivery efficiency to hepatocytes or HBV-infected cells.

[0086] In one embodiment, the pharmaceutical composition may be administered via intravenous, subcutaneous, intramuscular, portal vein, or other routes that enable the base editing system to reach hepatocytes.

[0087] In one embodiment, the sgRNA combination and base editing system can be used in combination with other anti-HBV drugs or immunomodulatory drugs; for example, when used in combination with nucleoside (acid) analogs, it can reduce HBsAg expression or secretion and cccDNA transcriptional activity through base editing while inhibiting HBV reverse transcription and viral replication; when used in combination with siRNA or antisense oligonucleotides that target HBV RNA, it can rapidly reduce HBV transcripts and antigen expression through RNA-level intervention while exerting a long-term functional silencing effect through base editing.

[0088] In one embodiment, the technical solution of the present invention can be used in cell models containing HBV cccDNA, cccDNA-like templates, HBV replicons, HBV integration sequences, or HBV plasmids, including but not limited to HepG2-HBV / loxPCells, including HepAD38 cells, HepG2-NTCP infected cells, and PLC / PRF / 5 cells; can be used for animal models of HBV infection or HBV-related diseases, including but not limited to HBV plasmid hydrodynamic injection models, rAAV-HBV1.3 models, rAAV-cccDNA / rAAV-Cre models, HBV transgenic mouse models, and HBV-infected humanized liver mouse models; can also be used to treat subjects with HBV infection-related diseases, including but not limited to patients with chronic hepatitis B, HBV-related liver fibrosis or cirrhosis, and subjects with persistent HBV antigen expression or persistent cccDNA transcriptional activity.

[0089] (a) The necessity of S14, X11 and the combination of S14+X11 The present invention selects S14 and X11 in combination not simply to increase the number of sgRNAs or to increase the overall editing volume, but based on the functional complementarity of the two sgRNAs in different HBV templates and different virological endpoints.

[0090] In HepG2-HBV / loxP In the cccDNA model, S14 treatment alone reduced HBsAg by 86.8%, but only HBeAg by 11.2%, and its effect on pgRNA and pgRNA / cccDNA levels was relatively limited. This indicates that S14's main role is in HBsAg expression and secretion, but it cannot fully address the persistent cccDNA transcription problem. Conversely, X11 treatment alone reduced HBeAg by 59.1% and decreased pgRNA and pgRNA / cccDNA levels, indicating that X11 can effectively inhibit cccDNA transcriptional activity.

[0091] In the HBV integrated cell model PLC / PRF / 5, S14 treatment alone reduced HBsAg by 66.7%, while X11 treatment alone only reduced HBsAg by 21.7%, further demonstrating that X11 cannot replace S14 in addressing the persistent expression of HBsAg derived from HBV integrated DNA. Combined treatment with S14 and X11 in HepG2-HBV / loxP In the model, HBsAg and HBeAg levels decreased by 99.5% and 70.2%, respectively, while pgRNA and pgRNA / cccDNA levels also decreased. The editing efficiency of the two target sites reached 90% and 92%, respectively, indicating that the co-delivery of dual sgRNAs did not significantly weaken their respective editing activities.

[0092] Therefore, the technical effect of the S14 and X11 combination described in this invention is mainly reflected in "functional complementarity" rather than simply increasing the inhibitory effect of a single virological indicator: S14 is responsible for directly reducing the expression or secretion of cccDNA and HBsAg derived from HBV integrated DNA, while X11 is responsible for weakening HBx function and inhibiting cccDNA transcription. Without S14, the direct inhibitory ability on HBsAg derived from HBV integration is limited; without X11, the inhibition of HBx-dependent cccDNA transcriptional activity is insufficient. Only by simultaneously including both HBs and HBx functional targets can the two independent but jointly affecting HBV functional cure be simultaneously covered: "persistent HBsAg expression / secretion" and "persistent cccDNA transcription."

[0093] Therefore, the technical contribution of the combined application of S14 and X11 in this invention does not depend on proving that the two have a mathematically significant superaddition and synergistic effect at a single endpoint, but rather on forming a complementary dual-pathway HBV functional silencing system through two targets with clear mechanistic division of labor.

[0094] (II) Stability of chemically modified sgRNA and its basis for in vivo application This invention preferably uses chemically synthesized full-length S14 sgRNA and X11 sgRNA, and introduces 2′-O-methyl (2′-O-Me) modification and phosphorothioate (PS) backbone modification at the 5′ and 3′ ends of the sgRNA. The above modification methods are common stabilization modification strategies used in therapeutic CRISPR guide RNAs.

[0095] Unmodified RNA molecules are susceptible to degradation by exonucleases and other nucleases after entering the bloodstream or cells. The 5′ and 3′ ends of RNA molecules are key regions attacked by exonucleases. 2′-O-methyl modification, by altering the chemical properties of the 2′ hydroxyl group of the ribose, can improve the RNA's tolerance to nuclease degradation. Phosphorothioate modification, by replacing the non-bridging oxygen atom in the phosphodiester bond with a sulfur atom, improves the oligonucleotide backbone's tolerance to nuclease hydrolysis. Combining 2′-O-methyl modification with terminal phosphorothioate modification can further protect the sgRNA ends and prolong its effective existence time in the biological environment, thereby increasing the chance of sgRNA forming an effective editing complex with base editor proteins generated from mRNA translation. Introducing combined 2′-O-methyl and phosphorothioate modifications at the 5′ and 3′ ends of full-length sgRNA can improve the stability of synthesized guide RNA and its gene-editing activity when co-delivered with Cas mRNA. Furthermore, studies on therapeutic CRISPR systems have shown that chemically modified sgRNAs can improve their in vivo stability, intracellular efficacy, and functional assembly with editor proteins. Therefore, the S14 and X11 chemical modifications employed in this invention have a clear basis in similar guide RNA stabilization technologies.

[0096] Furthermore, this invention preferably encapsulates chemically modified S14 sgRNA and X11 sgRNA with ABE mRNA in lipid nanoparticles. LNPs can further reduce the direct exposure of exogenous RNA to blood nucleases during systemic circulation and promote nucleic acid delivery to the liver and hepatocytes. Therefore, sgRNA terminal chemical modification combined with LNP encapsulation can improve the feasibility of using S14 and X11 for in vivo HBV editing from both the RNA molecule itself and the delivery vector level.

[0097] It should be noted that this invention has not yet directly measured the pharmacokinetic parameters, half-life, or residual time of intact RNA of S14 and X11 chemically modified sgRNA in animal plasma, liver tissue, or hepatocytes. Therefore, no numerical limit is made on the specific in vivo half-life of S14 or X11. However, the temporary presence of sgRNA and ABE mRNA in vivo does not mean that their efficacy lasts only until the RNA is cleared. The mechanism of action of S14 and X11 is to form base changes at the HBV DNA level; once the target HBV DNA forms a stable edited product, the base changes of the HBV DNA that have been formed can persist even if the sgRNA and ABE mRNA are subsequently degraded. Therefore, the duration of efficacy of this invention depends primarily on the persistent presence of the edited HBV DNA and the replenishment of the unedited HBV template, rather than entirely on the in vivo half-life of the sgRNA itself.

[0098] (III) Off-target risk assessment of the sgRNA of this invention To evaluate the off-target risks of S14, X11 and other candidate sgRNAs, this invention employs a method of "whole-genome bioinformatics prediction + candidate site targeted high-throughput sequencing verification" for preliminary safety evaluation.

[0099] First, Cas-OFFinder was used to search for potential off-target sites based on human genome sequences, with the number of mismatches and bulges between sgRNA and candidate genome sequences as screening criteria. Under the condition that the total number of bulges and mismatches does not exceed 3, S14, X11, and X15 predicted 19, 91, and 2 potential off-target sites, respectively.

[0100] Subsequently, specific amplification primers were designed for the predicted potential off-target sites, and PCR amplification was performed on the genomic DNA of HepG2-NTCP cells treated with ABE mRNA and corresponding sgRNA. Amplicon-Seq high-throughput sequencing was then used to evaluate the actual base editing rate at the candidate sites. The results showed that S14 identified one detectable off-target site, S14-OT5, located in an intron region among the predicted sites. X11 detected 10 detectable off-target sites, mainly located in introns, intergenic regions, or lncRNA regions. No clearly identified off-target sites located in protein-coding exons were found within this detection range.

[0101] Therefore, the off-target experiment of this invention is an off-target evaluation method based on the calculation and prediction of whole genome sequence and the targeted Amplicon-Seq verification of predicted candidate sites. It can be used to evaluate the actual editing of predicted high-risk sites and provide preliminary safety basis for the selection of candidate drugs for S14 and X11.

[0102] It should be noted that the above experiments are not unbiased whole-genome experimental off-target screenings in the sense of GUIDE-seq, CHANGE-seq-BE, Digenome-seq, or whole-genome sequencing. Therefore, the results are not presented as "no whole-genome off-target effects were found" or "proving that S14 / X11 has no off-target risk." In subsequent drug development, CHANGE-seq-BE, ABE Digenome-seq, ONE-seq, or other unbiased off-target site discovery methods suitable for base editors can be used to nominate candidate sites, and rhAmpSeq or other targeted deep sequencing methods can be combined to quantitatively validate the candidate sites to further evaluate the genomic safety of S14 and X11.

[0103] (iv) Basis for selecting HBx as a secondary functional target This invention selects the HBx open reading frame, rather than the Precore open reading frame, as the second functional target for co-editing with the HBs open reading frame. This is not an arbitrary selection of different open reading frames of HBV, but rather a determination based on the different virological barriers that need to be addressed for the functional cure of HBV and the specific function of HBx in the transcriptional regulation of cccDNA.

[0104] The Precore open reading frame is primarily involved in the production of Precore protein and HBeAg. HBeAg plays an important immunomodulatory role and is associated with the establishment and maintenance of chronic HBV infection, but Precore / HBeAg is not essential for HBV DNA replication. Clinically, persistent HBV replication can occur in Precore-deficient or HBeAg-negative states. Therefore, simply reducing HBeAg expression by disrupting the Precore open reading frame primarily addresses HBeAg production and its related immunomodulatory effects, but cannot directly block the key viral regulatory mechanisms that maintain the overall transcriptional activity of cccDNA.

[0105] HBx, however, is different. HBx is an important viral regulatory protein that maintains effective transcription of HBV cccDNA. Previous studies have shown that the host SMC5 / 6 complex can bind to HBV cccDNA and inhibit its transcription, while HBx can promote the degradation of the SMC5 / 6 complex through the DDB1-CUL4-related pathway, thereby relieving the host's transcriptional restriction on cccDNA. Therefore, HBx occupies a crucial upstream position in the "viral protein-host restriction factor-cccDNA transcription" regulatory axis. Weakening HBx function can not only affect the expression of a single viral protein but also has the potential to inhibit the production of multiple cccDNA transcripts by restoring the host's SMC5 / 6 restriction function.

[0106] The experimental results of this invention further support the above target selection. In HepG2-HBV / loxP In the cccDNA model, S14 primarily reduced HBsAg, with relatively limited effects on pgRNA and pgRNA / cccDNA; while X11 treatment decreased HBsAg, HBeAg, pgRNA, and pgRNA / cccDNA. Further functional experiments showed that X11 corresponded to HBx functional mutations accompanied by weakened HBx signaling and restored SMC6 nuclear signaling; ChIP-qPCR results further showed increased enrichment of Nse4 on the cccDNA-like template, increased repressive histone modification H3K9me3, while decreased enrichment of activating histone modification H3K27Ac and RNA polymerase II.

[0107] Therefore, this invention selects HBx as the second target in combination with HBs. Its purpose is not simply to further reduce another HBV antigen, but rather to utilize the upstream role of HBx in cccDNA transcriptional regulation to functionally complement the "persistent HBsAg expression / secretion" problem addressed by the first target S14 and the "persistent cccDNA transcription" problem addressed by the second target X11. This target combination is substantially different from the "HBs+Precore" approach, which separately disrupts the expression of two viral proteins.

[0108] (v) In vivo administration method and in vivo pharmacodynamic verification of the present invention The base editing composition of this invention not only has editing activity and antiviral effect in HBV-related cell models, but has also been delivered in vivo and evaluated pharmacodynamically in acute and chronic HBV cccDNA mouse models, thereby verifying the feasibility of achieving HBV-targeted editing and antigen inhibition in vivo after ABE mRNA and sgRNA such as S14 and X11 are co-delivered via lipid nanoparticles.

[0109] In one embodiment, ABE mRNA is co-encapsulated with one or more HBV-targeting sgRNAs in lipid nanoparticles (LNPs) and delivered via tail vein administration to the liver. For single sgRNA delivery, the ABE mRNA:sgRNA ratio can be approximately 1:1. For combined S14 and X11 delivery, the ABE mRNA:S14 sgRNA:X11 sgRNA ratio can be approximately 1:0.8:0.8. Depending on the animal model, delivery vector, and expected editing intensity, single or multiple administration may be used. In animal experiments of this invention, a single total RNA dose in the range of 2–4 mg / kg was used for evaluation, with a two-dose regimen three days apart.

[0110] In an acute HBV cccDNA mouse model, an HBV cccDNA-related mouse model was established by hydrodynamic tail vein injection of pCMV-cccDNA / pCMV-Cre plasmid. S14, X11, X15, S14+X11, S14+X15, and PCSK9 positive editing controls, as well as a PBS control group, were set up. Each ABE-treated group received LNPs containing ABE mRNA and corresponding sgRNA at a dose of 2.5 mg / kg twice daily on days 0 and 3. Serum HBsAg and HBeAg levels were dynamically monitored during the experiment. Mice were sacrificed on day 10, and liver tissue was harvested to assess the editing efficiency of the corresponding HBV target sites.

[0111] The results showed that base editing at the S14 and HBx target sites could be detected in mouse liver tissue after LNP delivery, proving that the ABE mRNA / sgRNA-LNP system of this invention can achieve in vivo liver delivery and targeted editing of HBV-related DNA. There were some individual differences in editing efficiency and antigen reduction among different animals, suggesting that in vivo efficacy is affected by factors such as LNP delivery efficiency and individual animal differences. Significant HBsAg reductions were observed in some animals in the S14, X11, and X15 single-target administration groups; both X11 and X15 treatments induced HBsAg reduction. Considering the HBx site editing efficiency, HBeAg inhibition effect, and the aforementioned in vitro HBx-SMC5 / 6-cccDNA mechanism verification results, X11 has sufficient evidence for on-target editing and its mechanism of action; therefore, X11 is preferred as the HBx-targeting sgRNA for combined use with S14.

[0112] Furthermore, this invention utilizes rAAV-rcccDNA / rAAV-Cre to establish a chronic mouse model of cccDNA that can maintain HBV antigen expression for a relatively long period, and evaluates the dosage and delivery system of the preferred combination S14+X11. The following groups were established: S14+X11 2 mg / kg group, S14+X11 4 mg / kg group, S14+X11 4 mg / kg group delivered using an ALC-0315 lipid formulation, PCSK9 editing control group, PBS control group, and VIR-2218 positive antiviral control group. The S14+X11 group received two LNP treatments on days 0 and 3, while VIR-2218 received a single 2.5 mg / kg dose. Serum HBsAg and HBeAg levels were measured weekly after administration.

[0113] Interim efficacy results showed that the S14+X11 dual-target combination exhibited a clear in vivo antiviral effect in a chronic cccDNA mouse model, showing a dose-dependent trend. At week 3 post-administration, HBsAg levels decreased by approximately 3.54 log10 in the 4 mg / kg S14+X11 group compared to pre-administration levels, while the 2 mg / kg group showed a decrease of approximately 1.20 log10; HBeAg levels decreased by approximately 1.80 log10 and 1.20 log10, respectively, indicating that increasing the dosage enhanced the inhibitory effect of the S14+X11 dual-target combination on HBV antigen.

[0114] Significant antiviral effects were observed after delivering 4 mg / kg S14+X11 using different LNP formulations. Specifically, the ALC-0315 formulation resulted in a 3.62 log10 decrease in HBsAg, similar to the approximately 3.54 log10 decrease observed in another LNP delivery system, indicating that the S14+X11 combination maintains significant HBsAg inhibition across different LNP delivery systems. The varying degrees of HBeAg inhibition among different LNP formulations suggest that the delivery system may affect the effective editing of HBx target sites.

[0115] It is noteworthy that, under the same experimental conditions, the 4 mg / kg S14+X11 dual-target ABE group showed an inhibition of HBsAg that reached or exceeded that of the VIR-2218 positive control group, and maintained a low serum HBsAg level during the observation period up to week 3. This indicates that it forms stable site-specific base changes in the target HBV DNA and shows the potential to obtain a more durable antiviral effect.

[0116] In summary, the in vivo experimental results of this invention demonstrate that ABE mRNA, along with S14 and X11 sgRNA, can be co-delivered to the mouse liver via LNP and exert HBV-targeted editing and antigen inhibition effects. An acute model validated the in vivo editability of the S14 and HBx target sites; a chronic model further demonstrated that the S14+X11 combination has a clear dose-dependent anti-HBV effect, with strong HBsAg and HBeAg inhibition achieved by administering 4 mg / kg twice at 3-day intervals. Therefore, the S14+X11 combination of this invention not only has in vitro editing and mechanistic evidence but also in vivo pharmacodynamic experimental support, providing further evidence for its application as a therapeutic base-editing composition for HBV.

[0117] It should be noted that the chronic mouse experiment is still in the follow-up phase, and the above results are interim efficacy results obtained up to week 3 after drug administration. The predetermined endpoint will be further examined for indicators such as editing efficiency of the S14 and X11 target sites in liver tissue, off-target effects, and cccDNA epigenetic status. Therefore, the results at this stage are not intended to limit the long-term editing efficiency, long-term safety, or cccDNA epigenetic endpoint that have not yet been obtained.

[0118] Example 1: sgRNA sequence screening and synthesis This embodiment relates to the design, synthesis, and chemical modification of candidate sgRNAs targeting HBV according to the present invention. Multiple sequence alignment of the HBV genome (serotype ayw, genotype D) was performed to design candidate spacer sequences in the HBs open reading frame, HBx open reading frame, and conserved regulatory element regions. After conservation and human genome homology screening, a biotechnology company synthesized the full-length sgRNA, and 2′-O-methyl and phosphate thioester backbones were introduced at the 5′ and 3′ ends to obtain stable candidate sgRNA molecules. The results are shown in Table 1, and are detailed below: Experimental design diagram as follows Figure 1 As shown in Part A, the sgRNA target region of this invention and its location in the HBV genome are as follows: Figure 1 As shown, the design principles of sgRNA are: within the nCas9 editing window (nucleotides 3 to 12 in the protospacer, counted from the PAM end to the PAM proximal end); PAM type 5'-NGG-3' adapted to nCas9; total conservation of the target sequence in HBV genotype >70%; homology with the host sequence <20 nt.

[0119] Multiple sequence alignment was performed on the HBV AH genotype. The designed sgRNA targets highly conserved HBV sequences, specifically HBV regulatory elements, HBs ORF, and HBx ORF. Priority was given to screening for CAG / CAA / CGA sequences (which can be converted into stop codons) that meet CBE substrate requirements, and AAT / AGA sequences (which can achieve key amino acid missense mutations) that meet ABE (adenine base editor) substrate requirements, with the target bases falling within the base editing window. Sequence alignment showed that the sgRNA sequences did not contain any homologous sequences longer than 20 bases with human or mouse genome sequences. The sgRNA was directly synthesized by Suzhou Genewiz Biotechnology Co., Ltd. The distribution of the target sequences and target regions of the sgRNA on HBV DNA is shown below. Figure 1 The B-D portions are shown; the sgRNA spacer sequence is shown in Table 1. Uppercase letters C, G, U, A, and T represent the base composition of the nucleotide; Table 1 sgRNA spacer sequence listing During the synthesis of the aforementioned spacer sequence, it was converted into the corresponding RNA sequence and then linked with a Cas9 sgRNAscaffold to form a gRNA that can be recognized by the Cas9 / base editor. To improve the in vivo stability and resistance to nuclease degradation of the sgRNA, 2′-O-methyl modified nucleotides were introduced at the 5′ and 3′ ends of the synthesized sequence, along with modifications to the phosphate thioester backbone. The nucleic acid sequences of the chemically synthesized sgRNA are shown in SEQ ID NO: 33~SEQ ID NO: 64; the specific sequence structures of the chemically synthesized sgRNA are shown in Table 2.

[0120] Table 2 shows the sequences where uppercase letters C, G, U, A, and T represent the base composition of nucleotides. T appears only in the original DNA spacer sequence, and U is used in the sgRNA sequence in RNA form. The lowercase letter m to the left of the base indicates that the 2′-hydroxyl group of the ribose group of the nucleotide is replaced by a methoxy group, i.e., 2′-O-methyl modification. The symbol * between two nucleotides indicates that the phosphodiester bond between adjacent nucleotides is replaced by a phosphothioate (PS) backbone modification.

[0121] Table 2. Specific sequence structure of chemically synthesized sgRNA After the sgRNA preparation according to the present disclosure is completed, it is lyophilized into a solid powder for later use. When using, it can be reconstituted into a solution of the desired concentration using, for example, water for injection, normal saline (NS), phosphate buffer (PB), or phosphate buffered saline (PBS).

[0122] The obtained modified sgRNA was purified by the supplier DSL, dissolved in nuclease-free water to a concentration of 1 μg / μL, aliquoted, and stored at -80°C to avoid repeated freeze-thaw cycles. The sgRNA was synthesized by Suzhou Genewiz Biotechnology Co., Ltd. Transfection of the sgRNA was performed using the TransBoost™ RNA Ultra System (Shanghai Beston Biotechnology Co., Ltd.).

[0123] Example 2: Preparation of base editing system and lipid nanoparticle formulation This embodiment relates to the preparation of the base editing system and lipid nanoparticle delivery carrier of the present invention. The mRNA encoding the adenine base editor (ABE) is synthesized via in vitro transcription, and then co-encapsulated with sgRNA in lipid nanoparticles containing ALC-0315 using microfluidic mixing technology. Liver-targeted modification is achieved via GalNAc-DBCO click chemical coupling to obtain a base editing drug formulation suitable for in vitro and in vivo delivery, as detailed below: This embodiment uses an adenine base editor (ABE) as the HBV genome editing tool. The amino acid sequence of the ABE protein (SEQ ID NO: 65) is shown below:

[0124] The mRNA encoding the ABE protein was obtained using in vitro transcription (IVT). The IVT reagent was purchased from Shanghai Weihuan Biotechnology Co., Ltd., catalog number K1066, product name All inOne mRNA Synthesis Kit II. This kit is used for the rapid in vitro synthesis of EZ Cap Reagent AG (3'OMe) capped and poly(A) tailed mRNA. Using T7 RNA polymerase, the capping reagent (EZ Cap Reagent AG (3'OMe), catalog number B8178) was co-transcribed into the 5' end of the mRNA to form a Cap1 structure. The addition of EZ Cap Reagent AG (3'OMe) protects the mRNA from degradation and ensures high translation efficiency. After a brief DNase I treatment to remove template DNA, the capped mRNA can be tailed at the 3' end using poly(A) polymerase. Polyadenylation (i.e., the addition of the poly(A) tail) stabilizes the mRNA and improves the translation initiation efficiency. The obtained mRNA was adjusted to a concentration of 1 μg / μL and stored at -80℃ for later use. The resulting ABE mRNA was used for subsequent encapsulation and delivery of lipid nanoparticles (LNPs).

[0125] (II) Preparation and characterization of lipid nanoparticles (LNPs) Lipid nanoparticles (LNPs) encapsulating ABE mRNA and sgRNA were prepared using microfluidic mixing technology.

[0126] First, materials were prepared including ABE mRNA encoding the adenine base editor, HBV-targeting sgRNA, cholesterol (Cholesterol), 1,2-distearyl-SN-glycerol-3-phosphocholine (DSPC), PEGylated lipids (1,2-dimyristoyl-rac-glycerol methoxy polyethylene glycol 2000 (DMG-PEG2000), ALC-0315, 1,2-distearyl-sn-glycerol-3-phosphoethanolamine-polyethylene glycol 2000-azide (DSPE-PEG2000-N3), anhydrous ethanol, 50 mmol / L sodium citrate buffer (pH 4.0), PBS, GalNAc-DBCO, and an Amicon® Ultra-15 centrifuge filter (100 kDa, 15 mL, catalog number UFC9100, Millipore). The raw materials for LNP synthesis were purchased from Aivit (Shanghai) Pharmaceutical Technology Co., Ltd.

[0127] Working solutions of cholesterol, DSPC, ALC-0315, DMG-PEG2000, and DSPE-PEG2000-N3 were prepared using anhydrous ethanol, with a concentration of 8 mg / mL for each solution. The organic phases were prepared according to the lipid molar percentages shown in Table 3 below. Table 3. Lipid composition of ABE mRNA / sgRNA lipid nanoparticle formulation ABE mRNA and sgRNA were diluted in 50 mmol / L sodium citrate buffer (pH 4.0) to form an aqueous phase. For delivery of a single sgRNA, ABE mRNA and sgRNA were mixed at a mass ratio of 1:1; for delivery of two sgRNAs, ABE mRNA, sgRNA1, and sgRNA2 were mixed at a mass ratio of 1:0.8:0.8. Multiple sgRNAs were allocated in equal volumes. LNPs were then prepared using a microfluidic mixing device. The organic and aqueous phases were loaded into syringes and mixed at an organic phase:water flow rate ratio of 1:3 and a total flow rate of 8 mL / min. Immediately after mixing, PBS was added for dilution, followed by concentration and washing using 100 kDa ultrafiltration centrifuge tubes to remove ethanol and free RNA.

[0128] To improve liver-targeted delivery efficiency, GalNAc-DBCO was conjugated to DSPE-PEG2000-N3 on the surface of LNPs. GalNAc-DBCO was added to the LNPs at a molar ratio of 2:1 to DSPE-PEG2000-N3, and incubated at room temperature for 2 h, achieving GalNAc conjugation via click chemistry. After conjugation, the mixture was concentrated and washed using a 100 kDa ultrafiltration centrifuge tube to obtain the GalNAc-modified ABE mRNA / sgRNA-LNP complex.

[0129] The ABE mRNAs used in Examples 1-10 of this invention are all from the same batch of in vitro transcription products. Their ORF sequences are shown in SEQ ID NO: 65, with a Cap1 cap structure at the 5' end, a poly(A) tail (100 nt) at the 3' end, and a 5' UTR sequence (SEQ ID NO: 505). AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC.

[0130] 3' UTR sequence (SEQ ID NO: 506): CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCA CGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC.

[0131] All cell and animal experiments used the same batch of ABE mRNA to ensure comparability of experimental results.

[0132] Example 3: Screening of sgRNA sequences This embodiment involves the in vitro functional screening and validation of HBV base editing candidate sgRNAs. Chemically synthesized sgRNAs and ABE mRNAs were transfected into HepG2-HBV / EGFP and HepG2-HBV / loxP cell models. After Ad-Cre induction to form cccDNA, ELISA was used to detect HBsAg and HBeAg levels in the cell supernatant. Sanger sequencing was combined to analyze target site editing efficiency and multi-genotype sequence conservation, in order to screen preferred sgRNAs targeting the HBs and HBx open reading frames from a large number of candidate sequences. The details are as follows: The HepG2-HBV / EGFP system was constructed by the inventors' team in their previous work. For details, please refer to [Zai W, Yang M, Jiang K, et al. Optimized RNA interference therapeutics combined with interleukin-2 mRNA for treating hepatitis B virus infection. Signal TransductTarget Ther. 2024;9(1):150. Published 2024 Jun 21. doi:10.1038 / s41392-024-01871-8]. This stable cell line, stably integrated with multiple copies of the HBV genome (serotype: ayw; genotype: D; GenBank Accession number: V01460.1) carrying the EGFP reporter gene using the Sleeping Beauty transposon system, does not express EGFP fluorescent protein under normal conditions. However, after transduction with adenovirus expressing Cre recombinase (Ad-Cre), it can be cleaved and circularized to form recombinant cccDNA, which expresses EGFP fluorescent protein. This system can be used to indicate the presence and transcription status of cccDNA. HepG2-HBV / EGFP cells were cultured in DMEM medium containing 10% FBS and incubated at 37°C with 5% CO2. 2 They are cultured in an incubator.

[0133] HepG2-HBV / loxP Constructed by the inventors' team in previous work, details can be found in [Wu M, Li J, Yue L, et al. Establishment of Cre-mediated HBV recombinant cccDNA (rcccDNA) cellline for cccDNA biology and antiviral screening assays. Antiviral Res. 2018;152:45-52. doi:10.1016 / j.antiviral.2018.02.007], based on Cre / loxP The strategy for mediating site-specific rcccDNA generation utilizes the Sleeping Beauty transposon system to transfer transposons with ends bearing... loxPA single copy of the HBV genome (serotype: ayw; genotype: D; GenBank Accession number: V01460.1) was integrated into a stable cell line constructed from HepG2 cells. The Cre enzyme was introduced into HepG2-HBV / loxP cells using Ad-Cre. Under the action of the Cre enzyme, the HBV genome fragments at both ends... loxP The site can be identified and cleaved, releasing the linear HBV genome from the integration site, which then circularizes to generate recombinant cccDNA, or rcccDNA. HepG2-HBV / loxP Cells were cultured in DMEM medium containing 10% FBS and incubated at 37°C with 5% CO2. 2 They are cultured in an incubator.

[0134] HepG2-HBV / EGFP or HepG2-HBV / loxP Cells were spaced at 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 1 cell / well into 24-well cell culture plates and incubated at 37 ℃ with 5% CO2. 2 Cells adhered to the incubator overnight. Once the cells reached 70-80% confluence, they were transfected using the TransBoost RNA transfection reagent. TM The RNA Ultra System transfection reagent co-transfected chemically synthesized sgRNA and AccuBase® ABEmRNA (adenine base editor) into cells, using HBV-NC-sgRNA as a negative control. Fresh medium was added 6-8 hours after transfection. Ad-Cre was added the following day, and fresh medium was added again after 6 hours. Three days after Ad-Cre transduction, HBV antigen levels in the supernatant were detected using an ELISA kit (Antu Bio). Cells were washed with PBS, trypsinized, and a small amount of cells was centrifuged to remove the supernatant. 30-50 μL of lysis buffer (cell lysis buffer catalog number: CL101000) was added to the cell pellet for direct lysis. Editing efficiency was then confirmed by PCR and Sanger sequencing. The results are shown in Table 4.

[0135] Table 4. Antigen reduction and editing efficiency of ABE-sgRNA in the HepG2-HBV / loxP recombinant cccDNA-like model. Note: " / " indicates that no edits were detected.

[0136] The ABE / sgRNA transfection procedure should be followed according to the transfection reagent instructions. Taking one well of a 24-well plate as an example: For transfection of a single sgRNA: Take a nuclease-free Eppendorf tube, mix 1.5 μL of reagent B with 0.75 μL (0.75 μg) ABE mRNA (Shanghai Beston Biotechnology Co., Ltd.) and 0.75 μL (0.75 μg) sgRNA by pipetting. Then add 7.5 μL of reagent A1 and mix quickly by pipetting. Incubate at room temperature for 5 min, then add 400 μL of fresh culture medium. Discard the old culture medium from the plate and add the pre-mixed transfection solution to the plate. Replace with fresh culture medium 6-8 hours after transfection.

[0137] like Figure 1 As shown in Part B, based on the HBV genome structure and the distribution of HBV-related transcripts, multiple candidate sgRNAs targeting regulatory elements such as Epsilon, XP / ENI, and CP / ENII were designed. Experimental results showed that different sgRNAs had significantly different effects on HBsAg secretion levels in HepG2-HBV / EGFP cells. Some sgRNAs failed to effectively reduce HBsAg levels, and even showed a trend of increasing HBsAg secretion levels; while some candidate sgRNAs located near the HBV S region could reduce HBsAg expression levels to some extent. These results suggest that different functional regions of HBV have significantly different effects on base editing-mediated antigen inhibition. Simply targeting regions shared by HBV cannot guarantee a stable antigen inhibition effect; therefore, further refined screening focusing on the HBs and HBx functional regions is needed.

[0138] like Figure 1 As shown in Part C, multiple HBV-Smut series sgRNAs were further designed and screened targeting the HBs open reading frame (ORF). Experimental results showed that different HBV-Smut sgRNAs exhibited significantly different inhibitory effects on HBsAg secretion levels. Among them, HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, and HBV-Smut_17 all reduced HBsAg levels to varying degrees in HepG2-HBV / EGFP cells, with HBV-Smut_14 and HBV-Smut_15 showing stronger HBsAg inhibitory effects. Further studies in HepG2-HBV / loxP Model validation revealed that HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, and HBV-Smut_17 could all significantly inhibit HBsAg secretion, with HBV-Smut_14 showing the most prominent inhibitory effect.

[0139] Meanwhile, the aforementioned HBV-Smut series sgRNAs have a relatively limited impact on HBeAg secretion levels. Comparing the distribution of their target sequences in the HBV genome and HBV transcripts reveals that the HBV-Smut series sgRNAs primarily target HBs ORFs. Their main function is likely to influence HBsAg expression, processing, or secretion by inducing missense mutations in the HBs protein-coding region, rather than directly inhibiting HBx-mediated cccDNA transcriptional activity. Therefore, the HBV-Smut series sgRNAs are more suitable as candidate sequences for targeting cccDNA and the expression and secretion of integration-derived HBsAg.

[0140] like Figure 1 As shown in section D, multiple HBV-Xmut series sgRNAs were further designed and screened targeting the HBx open reading frame. Experimental results showed that in HepG2-HBV / loxP In the model, the inhibitory effects of different HBV-Xmut sgRNAs on HBsAg and HBeAg secretion levels varied significantly. HBV-Xmut_11 significantly reduced both HBsAg and HBeAg secretion levels simultaneously, exhibiting a strong and relatively consistent antigen-inhibiting effect. HBV-Xmut_15 also reduced HBsAg and HBeAg levels, but its overall inhibitory effect was weaker than HBV-Xmut_11. The remaining HBV-Xmut sgRNAs showed weak or unstable inhibitory effects on HBsAg or HBeAg. Comparison with the target region distribution of the HBV-Xmut series of sgRNAs revealed that these sgRNAs primarily target HBxORF. HBx is a key viral regulatory protein maintaining cccDNA transcriptional activity; therefore, base editing targeting the HBx region may not only directly affect HBx protein expression or function but may also further weaken cccDNA transcriptional activity, thereby simultaneously reducing the expression of HBsAg and HBeAg derived from cccDNA.

[0141] Further analysis was conducted on the conservation of the sgRNA targeting different HBV genotype sequences (union of at least one matching sgRNA). The proportion of 11,185 HBV genomes containing a 20-nt sequence that completely matches the sgRNA targeting sequence was used as an indicator of conservation. The results are shown in Table 5 below. The conservation of the designed sgRNAs was all above 70%, and the conservation of candidate sequences HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, HBV-Smut_17, HBV-Xmut_11, and HBV-Xmut_15 was above 75%, which can effectively cover the HBV genomes of different genotypes.

[0142] Table 5. Conservation analysis of sgRNA targeting HBV genome sequences In summary, the above screening results indicate that highly conserved sgRNAs targeting HBs ORF, namely HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, and HBV-Smut_17, can effectively inhibit HBsAg secretion and are suitable for reducing the expression load of cccDNA and integrated HBV DNA-derived HBsAg. HBV-Xmut_11 and HBV-Xmut_15 targeting the HBx open reading frame can simultaneously and efficiently inhibit the secretion of both HBsAg and HBeAg, suggesting that they may further limit cccDNA transcriptional activity by interfering with HBx-related functions.

[0143] Example 4: Screening of sgRNA combinations targeting HBV This embodiment involves validating the functional complementarity of HBV-targeting sgRNA combinations. By delivering HBV-Smut and HBV-Xmut sgRNAs alone or in combination in cccDNA models (HepG2-HBV / loxP), HBV integration models (PLC / PRF / 5), and HBV replication models (HepAD38), the levels of HBsAg, HBeAg, pgRNA, and pgRNA / cccDNA in each model were detected to evaluate the combined inhibitory effects of different target combinations on viral antigen expression and cccDNA transcriptional activity. The details are as follows: Previous studies have shown that HBs and HBx targets correspond to two different mechanisms of action: HBsAg expression inhibition and cccDNA transcriptional regulation, respectively. Therefore, combining HBV-Smut_sgRNA and HBV-Xmut_sgRNA may achieve combined inhibition of HBV antigen expression and cccDNA transcriptional activity. The proportions of different HBV genotype sequences targeted by the two sgRNA combinations (the proportion of at least one of the two sgRNAs being a complete match) were further calculated, as shown in Table 6 below. Table 6. Conservation analysis of combined sgRNA targeting HBV genomic sequences 1. CCCDNA model transfection HepG2-HBV / EGFP or HepG2-HBV / loxP Cells were spaced at 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 1 cell / well into 24-well cell culture plates and incubated at 37 ℃ with 5% CO2. 2Cells adhered to the incubator overnight. Once cells reached 70-80% confluency, chemically synthesized sgRNA and AccuBase® ABE mRNA (adenine base editor) were transfected into the cells using the TransBoost™ RNA Ultra System transfection reagent (ABE mRNA was mixed with the first and second sgRNAs at a mass ratio of 1:0.8:0.8). HBV-NC-sgRNA was used as a negative control. The culture medium was replaced with fresh medium 6-8 hours after transfection. The next day, Ad-Cre was added for treatment, and the culture medium was replaced with fresh medium 6 hours later. Three days after Ad-Cre transduction, the HBV antigen level in the supernatant was detected using an ELISA kit (Antu Bio). Cells were washed with PBS, trypsinized, and a small amount of cells was centrifuged to remove the supernatant. 30-50 μL of lysis buffer (cell lysis buffer catalog number: CL101000) was added to the cell pellet for direct lysis. Subsequently, PCR and Sanger sequencing were performed to confirm the editing efficiency.

[0144] For HepG2-HBV / loxP Cells were analyzed using real-time quantitative PCR (Q-PCR) to detect intracellular HBV pgRNA, cccDNA, housekeeping gene GAPDH mRNA, and mitochondrial DNA levels. Primers used for Q-PCR are shown in Table 7 below.

[0145] Table 7. Q-PCR Primer Sequence List The antigen reduction and editing efficiency of the above sgRNA combinations in the cccDNA model are shown in Table 8. The results of antigen reduction and editing efficiency of single sgRNA combinations in the cccDNA model are also included for comparison.

[0146] Table 8. Antigen reduction and editing efficiency of single and combined sgRNAs in the cccDNA model. Note: Editing efficiency for combined HBs and HBx is separated by " / ". The ABE / sgRNA transfection procedure should be followed according to the transfection reagent instructions. Taking one well of a 24-well plate as an example: For transfecting two sgRNAs: Take a nuclease-free Eppendorf tube, and mix 1.95 μL of reagent B with 0.75 μL (0.75 μg) ABE mRNA (Shanghai Beston Biotechnology Co., Ltd.), 0.6 μL (0.6 μg) sgRNA1, and 0.6 μL (0.6 μg) sgRNA2 by pipetting. Then add 9.75 μL of reagent A1 and mix quickly by pipetting. Incubate at room temperature for 5 min, then add 400 μL of fresh culture medium. Discard the old culture medium from the plate and add the pre-mixed transfection solution to the plate. Replace with fresh culture medium 6-8 hours after transfection.

[0147] 2. Integrated model transfection PLC / PRF / 5 cells are a clinically isolated and constructed human hepatocellular carcinoma cell line containing integrated HBV DNA. They can be used to evaluate the functional silencing effect of ABE / sgRNA targeting integrated HBV DNA (intHBV). PLC / PRF / 5 cells were cultured at a density of 2.5 × 10⁻⁶ cells / year. 5 Cells were seeded at a density of 1 cell / well into 24-well cell culture plates and incubated at 37 ℃ with 5% CO2. 2 Cells adhered to the incubator overnight. Once cells reached 70%–80% confluency, chemically synthesized sgRNA and AccuBase® ABE mRNA (adenine base editor) were transfected into the cells using the TransBoost™ RNA Ultra System transfection reagent (ABE mRNA was mixed with the first and second sgRNAs at a mass ratio of 1:0.8:0.8). HBV-NC-sgRNA was used as a negative control. Fresh medium was added 6–8 hours after transfection. The ABE / sgRNA transfection procedure was performed according to the transfection reagent instructions; please refer to the preceding content for details. Three days after transfection, the HBV antigen level in the supernatant was detected using an ELISA kit (Antu Bio). The results are shown in Table 9.

[0148] Table 9. Antigen reduction of combined sgRNAs in the integration model 2. Copy model transfection HepAD38 is a stable cell line integrating 1.1 copies of the HBV genome (serotype: ayw, genotype: D). This cell line can regulate the transcription of HBV pgRNA and subgenomic RNAs from the integrated HBV genome through the tet-off element, and translate and express various viral proteins. This cell line can also support viral replication and the assembly of complete viral particles. For details, please refer to [Ladner SK, Otto MJ, Barker CS, Zaifert K, Wang GH, Guo JT, Seeger C, KingRW. Inducible expression of human hepatitis B virus (HBV) in stablytransfected hepatoblastoma cells: a novel system for screening potential inhibitors of HBV replication. Antimicrob Agents Chemother. 1997 Aug;41(8):1715-20. doi: 10.1128 / AAC.41.8.1715.]. HepAD38 cells were cultured in DMEM medium containing 10% FBS and DOX. HepAD38 cells used for transfection experiments were passaged in DMEM medium containing 10% FBS and DOX removed for at least two weeks to allow HBV to be stably transcribed and replicated.

[0149] HepAD38 cells were divided into groups of 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 1 cell / well into 24-well cell culture plates and incubated at 37 ℃ with 5% CO2. 2 Cells adhered to the incubator overnight. Once cells reached 70-80% confluency, chemically synthesized sgRNA and AccuBase® ABE mRNA (adenine base editor) were transfected into the cells using the TransBoost™ RNA Ultra System transfection reagent (ABE mRNA was mixed with the first and second sgRNAs at a mass ratio of 1:0.8:0.8). HBV-NC-sgRNA was used as a negative control. Fresh medium was added 6-8 hours after transfection. The ABE / sgRNA transfection procedure was performed according to the transfection reagent instructions; please refer to the preceding content for details. Three days after transfection, the HBV antigen level in the supernatant was detected using an ELISA kit (Antu Bio). The results are shown in Table 10.

[0150] Table 10. Antigen reduction of combined sgRNAs in the replication model. Note: The replication model only tested the antigen reduction for highly conserved candidate combinations. The overall results of sgRNA and its combinations are as follows: Figure 2 As shown, further functional screening of candidate sgRNAs and their combinations was conducted in different HBV cell models to evaluate the effects of different target combinations on HBV antigen expression, cccDNA levels, and cccDNA transcriptional activity.

[0151] like Figure 2 As shown in Part A and Table 8, in HepG2-HBV / loxP In the cell model, the RNA transfection reagent TransBoost™ RNA Ultra System (Shanghai Beston Biotechnology Co., Ltd.) was used to deliver HBV-Smut-sgRNA targeting the HBs open reading frame and HBV-Xmut-sgRNA targeting the HBx open reading frame, either alone or in combination. For specific procedures, please refer to the HBV-Smut-sgRNA or HBV-Xmut-sgRNA delivery procedures in Example 3. Experimental results showed that HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, and HBV-Smut_17 all reduced HBsAg levels in the cell supernatant to varying degrees, with HBV-Smut_14 exhibiting a strong HBsAg inhibitory effect. HBV-Xmut_11 and HBV-Xmut_15, when used alone, mainly reduced HBeAg levels and also had some inhibitory effect on HBsAg. Further combination of HBV-Smut-sgRNA with HBV-Xmut_11 or HBV-Xmut_15 resulted in varying degrees of decrease in HBsAg and HBeAg levels in the cell supernatant. Notably, the combined treatment with HBV-Smut_14 and HBV-Xmut_11 effectively reduced both HBsAg and HBeAg levels, suggesting that this combination can simultaneously inhibit HBsAg expression and regulate HBx-related transcription.

[0152] like Figure 2 As shown in Part B, HBV-Smut_14, HBV-Xmut_11, and combinations thereof were further selected in HepG2-HBV / loxP The assay was performed in cells, and cccDNA content and its transcriptional activity indicators were detected. For HepG2-HBV / loxPSince pgRNA originates entirely from the transcription of cccDNA, the pgRNA / cccDNA ratio reflects the transcriptional activity of cccDNA. Experimental results showed that HBV-Smut_14 treatment alone significantly reduced HBsAg secretion levels (p<0.0001), but had relatively limited effects on HBeAg, pgRNA, and pgRNA / cccDNA levels. HBV-Xmut_11 treatment alone reduced HBsAg, HBeAg, pgRNA, and pgRNA / cccDNA levels, suggesting that it inhibits cccDNA transcriptional activity. Combined treatment with HBV-Smut_14 and HBV-Xmut_11 further reduced HBsAg, HBeAg, pgRNA, and pgRNA / cccDNA levels. Meanwhile, no significant decrease in total cccDNA was observed in any of the treatment groups, suggesting that the above treatments mainly exert their effects by affecting viral antigen expression and cccDNA transcriptional activity, rather than directly reducing the cccDNA copy number. The results of target site editing assays showed that both HBV-Smut_14 and HBV-Xmut_11 could produce high levels of editing efficiency in their respective target gene regions, and the combined delivery did not affect the editing effect of their respective target sites.

[0153] like Figure 2 As shown in Section C and Table 9, the effects of different sgRNA combinations on the expression of HBsAg from integration were further evaluated in the HBV integration cell model PLC / PRF / 5. The results showed that HBV-Smut_14, HBV-Smut_15, HBV-Smut_16, and HBV-Smut_17, which target the HBs open reading frame, could all reduce the level of HBsAg in the supernatant of PLC / PRF / 5 cells to varying degrees; while treatment with HBV-Xmut_11 and HBV-Xmut_15 alone had a weak inhibitory effect on HBsAg from integration. Since the integration model has a complete HBs ORF and a truncated HBx ORF, and HBV-Xmut-sgRNA mainly regulates cccDNA, the above results are in line with expectations. When HBV-Smut-sgRNA is combined with HBV-Xmut_11 or HBV-Xmut_15, its inhibitory effect on HBsAg mainly depends on the HBV-Smut-sgRNA sequence itself, suggesting that sgRNAs targeting the HBs open reading frame are a key component in reducing the expression of HBV integration-derived HBsAg. Furthermore, when targeting different regions simultaneously, HBV-Xmut-sgRNA does not affect the effect of HBV-Smut-sgRNA acting alone.

[0154] like Figure 2As shown in Part D and Table 10, the effects of candidate sgRNAs and their combinations on HBsAg secretion were further examined in the HepAD38 cell model. The results showed that HBV-Smut_14, HBV-Smut_16, and HBV-Smut_17 could all reduce HBsAg levels in the supernatant of HepAD38 cells; HBV-Xmut_11 and HBV-Xmut_15 alone could not effectively reduce HBsAg levels. Further combination of HBV-Smut-sgRNA with HBV-Xmut_11 or HBV-Xmut_15 significantly reduced HBsAg secretion levels compared to the negative control, and achieved a stronger HBsAg inhibition effect than HBV-Smut-sgRNA alone. Since HBsAg in HepAD38 cells mainly originates from integration, with a small amount originating from cccDNA, it is speculated that after HBV-Smut-sgRNA reduces HBsAg from integration, HBV-Xmut-sgRNA further reduces HBsAg from cccDNA. The combination containing HBV-Smut_14 showed a relatively stable HBsAg inhibition effect.

[0155] In summary, the above results indicate that HBV-Smut_14 targeting the open reading frame of HBs can be effective against HepG2-HBV / loxP The study found that HBV-Smut14 effectively reduced HBsAg expression in different models, including PLC / PRF / 5 and HepAD38, suggesting that it can simultaneously act on HBsAg expression from both cccDNA-derived and HBV integration-derived sources. HBV-Xmut11, targeting the HBx open reading frame, reduced HBsAg, HBeAg, pgRNA, and pgRNA / cccDNA levels, indicating its ability to inhibit cccDNA transcriptional activity; however, its inhibitory effect on integration-derived HBsAg is limited when used alone. Therefore, the combined application of HBV-Smut14 and HBV-Xmut11 can exert effects at two levels: HBsAg expression and secretion inhibition, and HBx-dependent cccDNA transcriptional regulation, respectively. These combinations exhibit functional complementarity and can be considered a preferred sgRNA combination for subsequent HBV base editing silencing strategies.

[0156] Example 5: Effects of candidate sgRNAs and their combinations on HBV replication intermediates and viral RNA levels This embodiment involves an in-depth evaluation of the effects of preferred sgRNAs and their combinations on HBV replication intermediates and viral transcription levels. The levels of HBV DNA replication intermediates (rcDNA, dslDNA, ssDNA) and nucleocapsid DNA were detected in HepAD38 cells using Southern blot and qPCR, while the levels of pgRNA and total HBV RNA were detected in HepG2-HBV / loxP cells using Northern blot and qPCR. Simultaneously, antigen expression levels were detected using ELISA to clarify the comprehensive inhibitory effect of the combined application of S14 and X11 on viral replication and transcription. The details are as follows: To further evaluate the effects of candidate sgRNAs and their combinations on HBV replication intermediates and viral RNA levels, experiments were conducted on HepAD38 and HepG2-HBV / loxP The study detected the expression levels of HBV DNA replication intermediates, viral RNA, and viral antigens. HepAD38 cells, which can induce HBV replication after DOX removal, are suitable for evaluating the effects of different sgRNA treatments on HBV replication intermediates and viral RNA levels; HepG2-HBV / loxP Cells treated with Ad-Cre can be induced to form HBV cccDNA-like circular templates, suitable for evaluating the effects of different sgRNA treatments on cccDNA-derived viral transcripts and antigen expression. In this experiment, the small interfering RNA drug VIR-2218, which has entered the clinical research stage, was used as a positive control. It targets HBV transcripts through an RNA interference mechanism, effectively reducing HBsAg and other viral RNA levels, and was used to compare and evaluate the antiviral efficacy of candidate sgRNAs. VIR-2218 was synthesized by GenePharma (Shanghai GenePharma Technology Co., Ltd.), dissolved in enzyme-free water at a concentration of 20 μM, aliquoted into nuclease-free centrifuge tubes, and stored at -80 ℃, avoiding repeated freeze-thaw cycles.

[0157] The VIR-2218 transfection procedure should be followed according to the transfection reagent instructions. Taking one well of a 24-well plate as an example: Take a nuclease-free Eppendorf tube, mix 1 μL of reagent B with 1 μL (20 pmol) of VIR-2218 by pipetting, then add 15 μL of reagent A and mix quickly by pipetting. Let stand at room temperature for 5 min, then add 400 μL of fresh culture medium. Discard the old culture medium in the plate and add the above transfection premix to the plate. Replace with fresh culture medium 6-8 hours after transfection.

[0158] The levels of HBV DNA and intracellular core DNA in the supernatant were detected using an HBV DNA quantification kit (Sansure kit). Intracellular HBV pgRNA, total RNA, cccDNA, housekeeping gene GAPDH mRNA, and mitochondrial DNA levels were detected using quantitative real-time PCR (Q-PCR). The nucleic acid sequence of primer total RNA-F was GCTTTCACTTTCTCGCCAAC (SEQ ID NO: 75), and the nucleic acid sequence of primer total RNA-R was GAGTTCCGCAGTATGGATCG (SEQ ID NO: 76); the remaining primers used for Q-PCR are shown in Table 7.

[0159] Southern blot was used to detect intracellular HBV DNA replication intermediates, including relaxed circular DNA (rcDNA), double-stranded linear DNA (dslDNA), and single-stranded DNA (ssDNA). The specific experimental procedures for Southern blot are as follows: 1. Synthesis of digoxigenin (DIG)-labeled DNA probes in Southern Blot (1) Kit used: PCR DIG probe synthesis kit (Roche, catalog number: 11636090910). The full-length HBV genome sequence is approximately 3.2 kb. Three pairs of primers were used for probe labeling, each pair covering approximately 1000 bp. The PCR products of the three primer pairs covered the entire HBV genome sequence. Prepare the HBV template plasmid pBR322-HBV1.3(ayw) in advance (insert 1.3 copies of the HBV DNA sequence into the EcoRI site of the pBR322 vector plasmid; serotype: ayw; genotype: D; GenBank Accession number: V01460.1). The relevant primers are shown in Table 11: Table 11 PCR Primer Sequence List (2) Prepare the PCR reaction system in the PCR tube, mix thoroughly, centrifuge briefly, and place in the PCR instrument: (3) Set PCR reaction conditions: pre-denaturation: 95℃ 2 min; denaturation: 95℃ 30 sec; annealing: 60℃ 30 sec; extension: 72℃ 40 sec; 30 cycles; final extension: 72℃ 7 min.

[0160] (4) Take 2 μL of PCR product and DNA Marker together for agarose gel electrophoresis identification: The length of PCR product is 1000 bp, but because the PCR product contains digoxigenin label, its electrophoresis rate will be slower, and its position is higher than that of 1000 bp DNA Marker. If you can see a clear band on the upper side of 1000 bp DNA Marker, it proves that the probe labeling synthesis is successful.

[0161] (5) Mix the remaining portions of the three reactions thoroughly, dispense 5 μL into each tube, and mix well. -80°C C. Freeze.

[0162] 2. Marker preparation for Southern Blot Generally, only 3.2 and 2.0 kb markers are needed. Perform PCR using the PrimeSTAR polymerase standard procedure, and recover the sample gel after completion. After quantification, mix equal masses of samples, dilute to 100 pg / μL, aliquot, and store at -80℃. Use 2 μL / well for each experiment.

[0163] Using pSBbi-Neo-HBV respectively EGFP The plasmid and pBR322-HBV1.3 (ayw) plasmid were amplified by PCR to obtain 3.2 kb and 2.0 kb markers. The primers are shown in Table 12 below: Table 12 PCR Primer Sequence List 3. Electrophoresis (1) Take 1.20 g of agarose and add it to 120 mL of 1× TAE to prepare 1.2% agarose gel and gel for 1 h.

[0164] (2) Prepare an 18-well comb and square grooves, and clean and dry them with ddH2O before use. Mix 25 μL of sample with 5 μL of 6*loading buffer immediately before use; load 28 μL of sample and 2~3 μL of marker (2 μL marker + 0.4 μL 6*loading buffer). Empty wells can be filled with an equal amount of water + 6*loading buffer. Ensure that the lanes are symmetrical and that the volume of each sample is consistent.

[0165] (3) Clean the electrophoresis tank with ddH2O, fill the tank with new 1*TAE, run the gel at 80V constant voltage for about 3 hours, and stop electrophoresis when the bromophenol blue reaches 2 / 3 of the gel. (4) After electrophoresis, remove the gel and place it in a plastic tank. Treat the gel with alkaline denaturing solution for 1 hour, and wash it three times with distilled water. Then treat it with neutralizing solution for 1 hour, changing the neutralizing solution every 30 minutes. Wash it three times with distilled water. Note that if the sample being tested is HBV cccDNA, add 0.2 M HCl to the gel for 10 minutes before denaturing treatment. At this time, bromophenol blue will turn gray. Wash it three times with distilled water before denaturing treatment. The denaturing solution does not need to be recovered.

[0166] 4. Salt bridge film transfer overnight (8 hours or more) Note: Cut filter paper (14*14cm) > Nylon membrane (13*13cm) > Glue (12*12cm), Salt bridge filter paper width 11cm (1) Place 1.5 bags of straw paper at the bottom to absorb moisture; (2) Place two parafilms horizontally and vertically, without leaving gaps, for a total of four; (3) Place three layers of filter paper moistened with 20×SSC on top; (4) Cut the nylon membrane to the appropriate size, wet it in MilliQ water, then equilibrate it in 20×SSC solution for 5 min and place it on filter paper; (5) Place the gel in 20×SSC for equilibration for 5 min, and carefully place the gel on the nylon membrane, making sure that the edge of the gel does not extend beyond the edge of the nylon membrane; (6) Place three layers of filter paper moistened with MilliQ water (the filter paper in ③ and ⑥ should not touch), and then cover it with a long filter paper salt bridge moistened with 20×SSC (the two sides are small troughs filled with half full of 20×SSC solution). At the same time, pull open the sealing film to form a medium-sized square frame so that the liquid can seep into the filter paper below to form osmotic pressure. (7) Place the glue plate and a bottle of water (a heavy object, about 500g) on ​​top and press them down. Note that the upper and lower layers of filter paper should not stick together, and the salt bridge should not directly contact the lower layer of filter paper.

[0167] 5. Prehybridization and hybridization (1) After the transfer is complete, remove the salt bridge and prepare 100 mL of 2×SSC solution (diluted from 20*SSC) to wet the nylon membrane for 5 min. Hold the edge of the membrane with tweezers and place it on filter paper (right side up). Blot the membrane dry. Reduce the UV crosslinking from 7500 J to 0 J twice; this step makes the DNA more tightly coupled to the nylon membrane.

[0168] (2) Prepare a clean hybridization tube, fill it with DEPC water, and place the cross-linked membrane face inward into the tube. Ensure that the membrane adheres to the tube wall without air bubbles, then pour out the DEPC water in the tube and add 5-8 mL of hybridization solution (DIG Easy Hyb™ hybridization particles, Roche, catalog number: 11796895001). The liquid should cover the membrane and be leak-free.

[0169] (3) The hybridization tubes were placed symmetrically, 50 C conditional prehybridization for 1 h.

[0170] (4) From -80 C. Remove the DNA probe, thaw it on ice, and then add 5 μL to 100 μL of hybridization solution. Heat in a metal bath at 95°C. Denature at 42°C for 5 min, then immediately place on ice for 2 min. Discard the original hybridization solution in the tube, add 5 mL of fresh hybridization solution, then add the probe, and incubate at 42°C. C. Conditional hybridization overnight (at least 4 hours, 8 hours recommended).

[0171] 6. Development (1) Set the hybridization oven to 25°C and wash the membrane twice at room temperature with low-temperature washing solution (2×SSC 10mL), each time for 5-10min.

[0172] (2) Replace with high-precision cleaning solution and heat to 50°C. C. Wash the membrane twice, 15 minutes each time.

[0173] (3) Replace with 1× maleic acid solution and cool to room temperature. At the same time, prepare 10 mL of blocking buffer (9 mL of 1× maleic acid solution with 1 mL of blocking buffer), add 5 mL of blocking buffer and block at room temperature for 30 min; (4) Pour out the blocking solution from the hybridization tube, add 1 μL of DIG antibody to the remaining 5 mL of blocking solution, add it to the hybridization tube, and incubate at room temperature for 1 h with a slightly slower rotation speed; (5) After pouring out the liquid, first rinse the membrane with washing buffer, then wash the membrane twice with washing buffer, 10 min each time; wash the membrane twice with 1×Detection buffer, 5 min each time; (6) Add 5-6 drops of luminescent solution to 1 mL of 1×Detection buffer to prepare the developing solution. Place the nylon membrane face up on the parafilm, and evenly drop the developing solution onto the nylon membrane. After shielding the surface of the parafilm from light, develop it using a chemiluminescence analyzer.

[0174] Meanwhile, total RNA was extracted from cells, and the levels of HBV pgRNA and preS / S RNA were detected by Northern blot. AD38 cells with DOX removed were used as markers and denoted as AD38(-).

[0175] The specific experimental procedure for Northern blot is as follows: 1. Northern Blot Synthesis of Digoxigenin-Labeled RNA Probes (1) DIG Northern Starter Kit (Roche, catalog number: 12039672910) synthesizes digoxigenin-labeled RNA probes by in vitro transcription, with pcDNA-probe-1000 as the template plasmid.

[0176] (2) Enzyme digestion: 10 μg of plasmid pcDNA-probe-1000 was linearized by single enzyme digestion (EcoRI). The EcoRI digestion product was transcribed in vitro using SP6 polymerase to synthesize the HBV antisense strand for Northern Blot detection. The enzyme digestion system was prepared and incubated at 37℃ for 30 min. (3) Gel recovery: The enzyme digestion products are subjected to agarose gel electrophoresis, and the linearized plasmid DNA is recovered by gel. The final step of eluting the DNA is to use DEPC ddH2O.

[0177] (4) Prepare the in vitro transcription system in a PCR tube without RNase: After thorough mixing, centrifuge briefly and then perform in vitro transcription in a PCR instrument: 37℃ for 2 h or 42℃ for 1 h.

[0178] (5) Remove template DNA: After the previous reaction, add 2 μl of DNase I, mix thoroughly, centrifuge briefly, and then perform the reaction in a PCR instrument at 37℃ for 15 min.

[0179] (6) Termination of reaction: After the previous reaction is completed, add 0.8 μl of 0.5 M EDTA (prepared with DEPC ddH2O) to terminate the reaction.

[0180] (7) Dilute and aliquot: Dilute the reaction system of the previous step 10 times with DEPC ddH2O, aliquot 0.7 μL into EP tubes without RNase, and store at -80℃ for later use.

[0181] 2. Gel preparation: This process involves formaldehyde, so it is carried out in a fume hood. Add 1.5 g agarose and 150 ml DEPC water to a Northern Blot-specific gel preparation bottle (including rotor), microwave on high for 5 min to completely dissolve the agarose, place the gel preparation bottle (including rotor) on a magnetic stirrer and cool it evenly at low speed for 5 min while keeping the rotor rotating, add 15 ml 10 × MOPS, 7.5 ml 40% formaldehyde, and 15 μl 10000 × nucleic acid dye, mix thoroughly, pour it into the gel preparation plate, insert the comb, and let it solidify for 1 h.

[0182] 3. Sample preparation: RNA is best extracted and used immediately when performing Northern Blot. The RNA concentration is measured using a NanoDrop micro spectrophotometer. Take 20 μg and make up the volume to 10 μl with DEPC water (the volume can be increased if the RNA concentration is low). Add an equal volume of RNA 2 × Loading, mix thoroughly, and then heat in a metal bath at 65°C for 10 min, followed by an ice bath for 5 min.

[0183] 4. Electrophoresis: Dilute 10 × MOPS in pre-cooled DEPC water at 4℃ (to a final concentration of 1 ×) to prepare Northern Blot electrophoresis buffer. Place the gel in the electrophoresis tank, add the pre-cooled electrophoresis buffer, load the sample, and electrophore at 80 V for 2 hours (to maintain a low temperature environment during electrophoresis, place biological ice packs on all sides of the electrophoresis tank). After 30 minutes of electrophoresis, take the gel to a gel imaging system and observe under UV light whether the ribosomal RNA brightness is consistent among different samples and take pictures to record the results (theoretically, if the total amount of sample loaded is the same, the brightness of its ribosomal RNA should also be consistent), as an internal control.

[0184] 5. Because RNA itself is single-stranded, Northern Blot does not have denaturation and neutralization steps. After gel running, the membrane is transferred directly. The transfer steps are the same as those for Southern Blot, the only difference being that DEPC water and 20 × SSC prepared with DEPC water are used.

[0185] 6. Pre-hybridization, hybridization, and pre-treatment: All solutions used in these steps must be RNase-free. The pre-hybridization and hybridization temperature for Northern Blot is 68°C. All probes used in Northern Blot are RNA probes. Apart from these, the remaining steps are the same as for Southern Blot.

[0186] 7. Once hybridization is complete, double-stranded RNA is formed. The subsequent washing and color development steps (including the solutions used) are the same as those for Southern blot.

[0187] Test results as follows Figure 3 as well as Figure 4 As shown. Figure 3 As shown in Part A, in HepAD38 cells, compared with the negative control group, treatment with S14, X11, X15, and their combinations resulted in varying degrees of decrease in intracellular HBV DNA replication intermediates. Southern blot results showed weakened band signals for rcDNA, dslDNA, and ssDNA, suggesting that candidate sgRNA treatment could inhibit the formation or accumulation of HBV DNA replication intermediates. Among these, the treatment groups containing X11 or X15 showed a more significant inhibitory effect on HBV DNA replication intermediates, and combined treatment with S14 and X11 or X15 also reduced intracellular HBV DNA replication intermediate levels. qPCR results further showed that the HBV DNA levels in the supernatant of each treatment group were not significantly different from the negative control group, while the intracellular HBV core DNA levels after treatment with X11, X15, and their combinations were lower than those in the negative control group, suggesting that sgRNAs targeting the HBx region and their combinations can inhibit HBV replication intermediate-related indicators. In contrast, the relative content of cccDNA in each treatment group did not decrease significantly, suggesting that under the experimental conditions, candidate sgRNA treatment mainly affected HBV replication intermediates and viral transcription or replication activity, rather than directly reducing the total amount of cccDNA template.

[0188] like Figure 3 As shown in Part B, Northern blot results revealed that HBV pgRNA and preS / S RNA band signals were significantly weakened after treatment with S14, X11, X15, and their combinations compared to the negative control group, suggesting that candidate sgRNA treatment can reduce HBV viral RNA levels in HepAD38 cells. Further qPCR results showed varying degrees of decrease in pgRNA and total RNA levels, with a more pronounced decrease observed after combined treatment with S14 and X11 or X15. These results indicate that candidate sgRNAs and their combinations can not only reduce HBV DNA replication intermediate levels but also inhibit HBV viral RNA expression or accumulation.

[0189] To further verify the effects of candidate sgRNAs and their combinations on viral transcripts derived from cccDNA-like templates, in HepG2-HBV / loxP The tests were performed in a cell model.

[0190] like Figure 4 As shown in Part A, in HepG2-HBV / loxP In the cell model, HBsAg levels were significantly lower after treatment with S14, X11, X15, and their combinations compared to the negative control group (n=2, p<0.0001), with the S14-containing treatment group showing a strong inhibitory effect on HBsAg. HBeAg detection results showed that X11, X15, and their combinations reduced HBeAg levels, suggesting that sgRNA targeting the HBx region inhibits cccDNA-like template-related transcriptional activity. Combined treatment with S14 and either X11 or X15 simultaneously reduced both HBsAg and HBeAg levels, indicating that combined treatment with HBs and HBx targets can simultaneously inhibit HBsAg expression and cccDNA-derived antigen expression.

[0191] like Figure 4 As shown in Part B, the Northern blot results indicate that after processing with S14, X11, X15 and their combinations, HepG2-HBV / loxP Intracellular HBV pgRNA and preS / S RNA band signals were weakened compared to the negative control group. qPCR results further showed that treatment with X11, X15, and their combinations decreased pgRNA and total RNA levels, with a more significant decrease in viral RNA levels observed after treatment with S14 combined with X11 or X15. These results suggest that sgRNA targeting the HBx region can reduce the level of viral RNA derived from cccDNA-like templates, and its combination with S14 can further enhance the comprehensive inhibitory effect on viral antigen expression and viral RNA levels.

[0192] In summary, the above results indicate that in the HepAD38 replication model, S14, X11, X15, and their combinations can reduce the levels of HBV DNA replication intermediates, HBV core DNA, and viral RNA to varying degrees, but have limited effect on the total cccDNA, suggesting that they mainly function by reducing viral transcription or replication activity; in the HepG2-HBV / loxP In the model, S14 primarily reduced HBsAg levels, while X11 and X15 primarily reduced HBeAg and viral RNA levels. Combined treatment with S14 and either X11 or X15 simultaneously reduced HBsAg, HBeAg, and HBV viral RNA levels. These results further support the functional complementarity of HBs and HBx targets. S14 can serve as an important candidate sgRNA for reducing HBsAg expression, while X11 can serve as a candidate sgRNA for inhibiting HBx-related viral transcriptional activity. Combined application of both is beneficial for achieving dual inhibition of HBV antigen expression and viral transcriptional replication activity.

[0193] Example 6: Prediction and Validation of Potential Off-Target Sites for Candidate sgRNAs This embodiment involves the bioinformatics prediction and experimental validation of the off-target risk of candidate sgRNAs. First, Cas-OFFinder software was used to predict potential off-target sites S14, X11, and X15 across the entire genome. Then, specific PCR primers were designed for the predicted sites, and amplicon-Seq was performed on the genomic DNA of HepG2-NTCP cells treated with ABE / sgRNA to evaluate the off-target editing of each candidate sgRNA. The results are as follows: Figure 5 As shown, the details are as follows: To evaluate the off-target risk of candidate sgRNAs in the genome, potential off-target sites for S14, X11, and X15 were predicted and validated using high-throughput sequencing. First, the Cas-OFFinder software was used to predict potential off-target sites of candidate sgRNAs in the human genome using bioinformatics. Cas-OFFinder can search for highly similar genomic sites to the target sequence across the entire genome based on the sgRNA spacer sequence and its corresponding PAM sequence, allowing for a certain number of base mismatches or bulge structures. A mismatch refers to incomplete base complementarity between the sgRNA and the genomic sequence, while a bulge refers to the presence of insertion or deletion-like mismatch structures in the sgRNA or genomic sequence. Since Cas nucleases or base editors may still generate editing events in some similar sequence regions, setting thresholds for the number of mismatches and bulges can be used to predict potential off-target risks.

[0194] In this embodiment, the total number of bulges and mismatches not exceeding 3 was used as the screening criterion to predict potential off-target sites for S14, X11, and X15. The prediction results showed that S14 obtained 19 potential off-target sites, X11 obtained 91 potential off-target sites, and X15 obtained 2 potential off-target sites. The off-target sites are shown in Tables 13 to 15 below.

[0195] Table 13 Potential off-target sites for S14 predicted by Cas-OFFinder Table 14 Potential off-target sites for X11 predicted by Cas-OFFinder Table 15 Potential off-target locations of X15 predicted by Cas-OFFinder Note: To facilitate PCR primer design, each off-target site is numbered for differentiation.

[0196] Subsequently, the 300bp sequences at both ends of the off-target sites in the genome were obtained. Amplification primers were designed for the predicted potential off-target sites to ensure that the PCR length was less than 275bp. For the same site, the same pair of primers could be used for amplification. The primers are shown in Tables 16-18 below.

[0197] Table 16 Primers for PCR amplification of S14 off-target sites Table 17 Primers for PCR amplification of X11 off-target sites Table 18 Primers for PCR amplification of off-target sites of X15 Cell lysates of HepG2-NTCP cells transfected with ABE mRNA and corresponding sgRNA were obtained, and routine PCR amplification was performed on the corresponding genomic regions. The PCR amplification conditions are shown below: High-throughput sequencing (Amplicon-Seq) was used to analyze the editing status of potential off-target sites. The actual editing level of candidate sgRNAs at predicted off-target sites was evaluated by comparing the base editing ratios at corresponding sites in untreated control samples and edited samples.

[0198] like Figure 5As shown, high-throughput sequencing validation results indicate that among the predicted potential off-target sites, S14 detected one detectable editing site, X11 detected ten detectable editing sites, and X15 did not detect any definite off-target editing sites. Specifically, the off-target site detected by S14 was S14-OT5, with an editing rate of 11.2% in the edited samples; this site is located in an intron region. The off-target sites detected by X11 included X11-OT9, X11-OT10, X11-OT49, X11-OT55, X11-OT57, X11-OT58, X11-OT62, X11-OT68, X11-OT86, and X11-OT106, with editing rates of 20.3%, 3.5%, 20.8%, 3.3%, 26.4%, 3.3%, 3.3%, 2.3%, 22.0%, and 8.5%, respectively. The off-target sites of X11 were mainly distributed in intron regions, with some sites located in intergenic regions or lncRNA regions. No off-target sites were found in protein-coding exon regions. No significant off-target editing events were detected for X15 within the detection range.

[0199] The above results indicate that the potential off-target risks of different candidate sgRNAs vary. X15 predicted fewer off-target sites and no obvious off-target editing was detected in this detection system, suggesting a relatively low off-target risk. S14 detected only one intron region off-target site. Although X11 predicted and validated a relatively large number of off-target sites, the detected off-target sites were mainly located in non-coding regions. Combining the aforementioned multi-model functional screening results, S14 showed good efficacy in reducing HBsAg expression, while X11 showed relatively stable performance in inhibiting HBeAg, pgRNA, and cccDNA transcriptional activity. Therefore, in subsequent candidate sequence selection, it is necessary to comprehensively consider editing efficiency, antiviral function, mechanism of action, and off-target risk. Among them, S14 and X11 can serve as the main candidate sequences for subsequent mechanism validation and combined editing strategies. Further, a broader off-target evaluation and functional safety analysis are needed to confirm their application safety.

[0200] Example 7: Verification of the effects of S14, X11 and X15 target editing mutations on HBs secretion and HBx function This embodiment involves verifying the mechanism by which target editing mutations at S14, X11, and X15 affect HBs protein secretion and HBx protein function. HBs and HBx expression plasmids carrying corresponding point mutations (pcDNA3.1-S14-ΔHBs, pcDNA3.1-X11-ΔHBx, etc.) were constructed and transfected into HepG2-NTCP cells. The HBsAg level in the supernatant was detected by ELISA. Immunofluorescence confocal microscopy was used to observe the expression and co-localization of HBs with the endoplasmic reticulum marker Calreticulin, as well as the expression and interaction changes of HBx with SMC6, to elucidate the molecular basis of target editing leading to HBs secretion arrest and HBx inactivation. The results are as follows: Figure 6 As shown, the details are as follows: like Figure 6 As shown in Part A, the open reading frames (with flag tags) of HBs and HBx corresponding to point mutations were generated by editing S14, X11, and X15 and inserted into pcDNA3.1, named pcDNA3.1-S14-ΔHBs, pcDNA3.1-X11-ΔHBx, and pcDNA3.1-X15-ΔHBx. The plasmid construction process is as follows: All three plasmids used pcDNA3.1(+) as the vector.

[0201] For pcDNA3.1-S14-ΔHBs, the DNA sequence (SEQ ID NO: 500) is: 5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGCTTGAATTCATGGAGAGCACAACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACcCGcGGTGGACTTCTCTCAATTTTCTAGGGGGAACACCCGTGTGTCTTGGCCAAAATTCGCAGTCCCAAATCTCCAGTCACTCACCAACCTGTTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACAACCAGCACCGGACCATGCAAAACCTGCACAACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTTTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATGCCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAA-3'.

[0202] The cloning site is EcoRV (5') — XhoI (3').

[0203] For pcDNA3.1-X11-ΔHBx, the DNA sequence (SEQ ID NO: 501) is: 5'-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGCTTGAATTCATGGCTGCTCGGGTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCGCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCCGCCTGTTCTACCGACCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCCCCCCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGAACGCCCACAGGAACCTGCCCAAGGTCTTGCATAAGAGGACTCTTGGACTTTCAGCAATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTGTGTTTAATGAGTGGGAGGAGTTGGGGGAGGAGGTTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTGTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAA-3'.

[0204] The cloning site is EcoRV (5') — XhoI (3').

[0205] For pcDNA3.1-X15-ΔHBx, the DNA sequence (SEQ ID NO: 502) is: 5'--3'.

[0206] The cloning site is EcoRV (5') — XhoI (3').

[0207] like Figure 6 As shown in Part B, S14, X11, and X15 target the HBs or HBx open reading frames in the HBV genome, respectively. S14 editing introduces base substitutions in the corresponding region of the HBs open reading frame, leading to changes in the corresponding amino acids of the small S protein; X11 and X15 editing are located in conserved functional regions of the HBx open reading frame and also cause changes in the corresponding amino acids of HBx. Based on the above main editing products, mutant expression plasmids S14-ΔHBs, X11-ΔHBx, and X15-ΔHBx were constructed, and their functions were compared with the corresponding wild-type expression plasmids. The corresponding wild-type expression plasmids without point mutations were named pcDNA3.1-Flag-HBs and pcDNA3.1-Flag-HBx.

[0208] HepG2-NTCP cells are a cell line that stably overexpresses the HBV-specific receptor NTCP. For details, please refer to [Ni Y, Lempp FA, Mehrle S, Nkongolo S, Kaufman C, Fälth M, Stindt J, Königer C, Nassal M, Kubitz R, Sültmann H, Urban S. Hepatitis B and D viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes. Gastroenterology. 2014 Apr;146(4):1070-83. doi: 10.1053 / j.gastro.2013.12.024.]. HepG2-NTCP cells were prepared at a ratio of 2.5 × 10⁻⁶. 5 The cells were seeded at a density of cells / well into 24-well cell culture plates containing cell spreaders and incubated at 37 ℃ with 5% CO2. 2 Cells adhered to the culture medium overnight. Once the cells reached 70-80% confluency, the plasmid was transfected into the cells using Lipofectamine 3000 (Thermo). Fresh medium was added 6-8 hours after transfection. An untransfected group served as a negative control. For cells transfected with the HBs plasmid, HBV antigen levels in the supernatant were detected 3 days after transfection using an ELISA kit (Antu Bio). Immunofluorescence assays were performed on cell smears to detect the localization, expression, and functional activity of HBV protein at the single-cell level.

[0209] The plasmid transfection procedure was performed according to the transfection reagent instructions: Taking one well of a 24-well plate as an example, mix 1 μg of plasmid with 1 μL of p3000, then add 25 μL of Opti-MEM (Thermo Scientific); simultaneously, mix 1.5 μL of Lipofectamine 3000 transfection reagent with 25 μL of Opti-MEM; mix the two solutions thoroughly and let stand at room temperature for 5–10 min. Slowly add the transfection reagent dropwise to the well of the plate. Replace with fresh culture medium 6 hours after transfection.

[0210] For cell slides in well plates, add 250 μL of 4% paraformaldehyde to cover the slides, fix at room temperature for 15 min, and wash three times with PBS. Cover the slides with PBS containing 0.3% Triton X-100 and incubate at room temperature for 10-15 min to lyse the cell membrane. Discard the cell lysate and add 250 μL of PBS containing 5% BSA and 0.1% Triton X-100, incubate at room temperature for 30 min to block non-specific antibody binding sites. Dilute the primary antibody 1:300 with PBS containing 20% ​​BSA and 0.1% Triton X-100 and incubate overnight at 4°C in the dark. Wash three times with Triton X-100 (final concentration 0.1%) for 10 min each time. Dilute the secondary antibody 1:1000 with Triton X-100 (final concentration 0.1%), incubate at room temperature in the dark for 1 h, then incubate on a shaker in the dark, and wash three times with PBS for 10 min each time. DAPI was diluted 1:3500 in PBS and incubated at room temperature in the dark for 15 min. The cells were then washed three times with PBS, 5 min each time. A glass slide was taken, and approximately 4 μL of mounting medium was added. Using pointed forceps, the stained slide was gently picked up, cell side down, starting from one side and slowly lowered until the mounting medium had spread across the entire slide. The slide was then inverted onto another glass slide and allowed to air dry in the dark for at least 20 min. Observation and imaging were performed using a confocal microscope.

[0211] For the ΔHBs and HBs groups, the primary antibodies were Anti-FLAG antibody (Sigma-Aldrich) and Anti-Calreticulin antibody (abcam); for the ΔHBx and HBx groups, the primary antibodies were Anti-FLAG antibody (Sigma-Aldrich) and Anti-SMC6 antibody (abcam); the secondary antibodies were Goat Anti-Mouse IgG H&L (Alexa Fluor® 488) (abcam) and CoraLite647-conjugated F(ab')2 Fragment Donkey Anti-Rabbit IgG (H+L) (proteintech).

[0212] The HBV HBs gene translates into three envelope proteins—large (L), medium (M), and small (S)—through different start codons, all sharing the C-terminal S domain. Base editing at S14 introduces substitutions at amino acids 34 and 35 (aa) in the small S protein, i.e., TCG→CCG and TGG→CGG. The first cytoplasmic loop (CYL-I) at the N-terminus is a structural and functional region associated with membrane topology, particle assembly, and secretion. Furthermore, the α antigenic determinant located in the major hydrophilic region (MHR) of 124-147aa is an antigenic recognition epitope, and point mutations at S14 do not directly affect this epitope, indicating that the decrease in secretory HBsAg caused by S14 editing is not due to antigen recognition impairment. Figure 6 As shown in Part C, for the S14-ΔHBs mutant group, the expression level of HBsAg in the cell supernatant was significantly reduced compared to the WT-HBs group (n=2, p=0.0178); the intracellular HBs signal was uneven, exhibiting perinuclear granular and punctate aggregations, and enhanced co-localization with the endoplasmic reticulum (ER). In contrast, the HBs signal in the WT-HBs group was more uniformly distributed in the cytoplasm, more diffuse and continuous, close to the distribution state of HBs protein in normal expression and processing, and the co-localization with the ER was weaker. Combined with semi-quantitative analysis of the average fluorescence intensity of cells, there was no significant difference in the intracellular HBs abundance of the S14 point mutation, but the distribution changed from relatively diffuse to more obvious perinuclear granular aggregation. Combining the immunofluorescence results and functional analysis, the point mutation caused by S14 editing may lead to the obstruction of HBs protein transport in the secretory pathway by changing the local conformation of the protein, transmembrane topological stability, or interaction with assembly-related molecules, resulting in retention in secretion-related organelles such as the ER, thus manifesting as increased intracellular retention and decreased extracellular secretion.

[0213] HBx is a small regulatory protein of 154 amino acids. Its N-terminal aa1-50 region is a negative regulatory domain, while its C-terminal aa51-154 region is a transactivation domain. The amino acid substitution sites at X11 (positions 63 and 64, i.e., TTC→CCC, TCA→CCA) and X15 (position 71, i.e., CTT→CCC) are both located within the C-terminal transactivation domain (aa51-154) of the HBx protein, and are situated in the highly conserved aa58-84 functional region. This region is adjacent to the CCCH type zinc-binding motif (C61 / C69) of HBx and is closely related to the structural stability and functional output of HBx. The X11 site, adjacent to C61 and located in a critical local structural environment between C61 and C69, is more likely to directly disrupt the local conformation of HBx or metal ion coordination-related structural features, thereby significantly weakening its functional activity. X15, located downstream of this core region, is more likely to affect HBx function through proximity perturbation effects. Figure 6As shown in section D, compared with WT-HBx, the HBx immunofluorescence signal in the X11 / X15 mutant group was significantly weakened, while the nuclear SMC6 signal was restored. This indicates that the HBx immunofluorescence signal in the X11 (n=2, p=0.0270) / / X15 (n=2, p=0.0131) mutant group was significantly weakened, while the nuclear SMC6 signal was restored. This is consistent with the weakened HBx signal and the restored nuclear SMC6 signal, suggesting that HBx protein expression, stability, or conformation is affected. The restoration of the nuclear SMC6 signal further suggests that the antagonistic effect of HBx on the host restriction factor SMC6 may be weakened, which may induce cccDNA transcriptional silencing by relieving the antagonism of HBx on SMC6.

[0214] Example 8: Effects of HBx target editing on the epigenetic state and transcriptional activity of cccDNA To further verify the effects of S14, X11, and X15 editing on cccDNA transcriptional activity and epigenetic status, this example was conducted on HepG2-HBV / loxP Chromatin immunoprecipitation (ChIP)-qPCR experiments were performed in cell models. ChIP-qPCR is a classic method for detecting the enrichment of specific proteins or histone modifications in target genomic regions. It specifically enriches protein complexes bound to chromatin with antibodies and then quantitatively analyzes the target sequence using qPCR, thereby evaluating gene transcriptional activity and epigenetic regulatory status. Details are as follows: 1. Cell Washing. ChIP requires a relatively large number of cells. Generally, 80-90% confluent cells from a 10 cm cell culture dish are sufficient for 1-2 assays. This ChIP experiment uses HepG2 cells from a 10 cm dish as an example. Discard the culture medium, wash once with PBS, add 1.5 mL of trypsin for 3-5 min, neutralize with whole culture, transfer the cells to a 15 mL centrifuge tube, centrifuge at 1000 g for 5 min, discard the supernatant, resuspend in 1 mL of PBS, transfer to a 1.5 mL EP tube, and centrifuge at 1000 g for 5 min at 4 °C.

[0215] 2. Cell lysis: Discard the supernatant. Resuspend the cells in the cell pellet with 1 ml of cell lysis buffer, then add 20 μL of 50× protease inhibitor (PI) (PI should be added fresh before use). Centrifuge at 4°C for 15 min. While waiting, prepare a 1% formaldehyde dilution solution. After centrifugation, centrifuge at 4°C, 13000g for 2 min. Discard the supernatant.

[0216] 3. Cell sample fixation. Add 400 μL of 1% formaldehyde dilution buffer (400 μL / 10 cm dish / tube), resuspend by pipetting, and incubate on ice for 30 min; centrifuge: 4℃, 13000g, 2 min. Discard the supernatant. Add 1 mL of ChIP buffer, gently pipette into small pieces, and incubate on ice for 10 min; centrifuge: 4℃, 13000g, 2 min.

[0217] Note: Different cell types may require different fixation conditions. If sonication fails to break down the DNA to less than 1000 bp, the formaldehyde concentration should be reduced or the fixation temperature lowered, such as to 4°C. 4. Animal tissue sample fixation. For the ChIP experiment, using 1 / 6 of a mouse liver (approximately 1 / 2 the size of a fingernail) as an example, remove the mouse liver from a -80℃ freezer and thaw at room temperature for 5 min. Mince the liver tissue with ophthalmic scissors and collect it in an EP tube. Add 1 ml of PBS and wash once. Centrifuge at room temperature, 800g, for 3 min. Discard the supernatant, add 1 ml of PBS solution containing 1% formaldehyde, and fix with a rotary mixer for 10 min. Add 100 μl of PBS solution containing 1.25M glycine to the EP tube, and centrifuge again for 10 min. Centrifuge at room temperature, 800g, for 3 min. Discard the supernatant, add 800 μl of PBS and 3-4 grinding beads, and grind using a cryogenic tissue homogenizer: 4℃, 4 min, 70Hz. Centrifuge at 4℃, 800g, for 3 min to obtain cell pellet.

[0218] 5. Lysis of cell nuclei: Discard the supernatant, add 320 μl of nuclear lysis buffer and 6.4 μl of 50 × PI, mix well by pipetting, place the EP tube on a tray and then lyse on ice for 15-30 min, tapping the bottom of the EP tube every 5 min to prevent cells from settling to the bottom.

[0219] Note: Do not place the tube directly on ice to prevent the precipitation of low-temperature SDS.

[0220] 6. Ultrasounding: During the time intervals between cell nucleus lysis, pre-cool the sonicator with ice. Replace the ice with an ice-water mixture during sonication, ensuring the liquid level is level with the standard line inside the sonicator. Gently tap the bottom of the EP tube to mix the sample, place it on a float, and then place it in the sonicator. The sonication conditions are: 30s on, 30s off, 4 cycles. After this, remove the sample, vortex thoroughly, and centrifuge briefly. Repeat this process every 3-4 cycles. For HepG2 cells, the sonication conditions are 19 cycles (4, 3, 3, 3, 3, 3). (When sonicating different types of cells or changing the sonicator, the sonication conditions should be explored first. The first condition is 10 cycles, and then 3 cycles are added each time. Take 20 μl of the sonication product each time, add 1 μl of proteinase K (20 mg / ml), mix thoroughly, incubate at 65°C for 6-12 h, add 1 μl of RNase A (10 mg / ml), mix thoroughly, and incubate at 37°C for 30 min. Take 10 μl for agarose gel electrophoresis to detect the size of chromatin fragments after sonication. The optimal sonication conditions are when the DNA fragments are all between 200-1000 bp.) 6. Centrifuge after sonication: 4℃, 13000 g, 10 min. Collect the supernatant and determine the concentration of the sonication solution (chromatin) using a NanoDrop micro-spectrophotometer (select dsDNA or DNA as the detection item). Before measuring the concentration, thoroughly mix by vortexing and then briefly centrifuge. Use the nuclear lysis buffer as the Blank option (the OD260 to OD280 ratio is not important) and record the concentration. The sonication solution can be directly used for immunoprecipitation experiments or stored at -80℃ first. Approximately 50~100 μg can be used as one indicator.

[0221] 7. Immunoprecipitation: When performing immunoprecipitation, there should be positive and negative controls, namely sample control and IgG control; Input: Take 1 μg of chromatin (approximately 1%, 1 input per dish), freeze at -20℃ for later use; Take 50~100 μg of chromatin / index (take as much as needed for several indicators, and divide into different Eppendorf tubes) for immunoprecipitation, use nuclear lysis buffer to make up the volume to 200 μl, add twice the volume, i.e., 400 μl of ChIP Dilution Buffer, and add 12 μl of 50 × PI. (In actual operation, the volume may exceed 200 μl when taking 100 μg of chromatin, such as 211.5 μl. In this case, you can use nuclear lysis buffer to make up the volume to 300 μl, and then add ChIP Dilution Buffer and 50 × PI according to the ratio). The final volume of each group should be consistent. Next, add 20 μl of magnetic beads (before adding, remove the magnetic beads from the 4°C freezer and invert them to mix thoroughly, or tap the bottom to mix; do not use a Vortex mixer to mix, and there is no need to remove them from the 4°C freezer beforehand), and add 6 μl of antibody. (Use 20 μl magnetic beads and 6 μl antibody each, regardless of the previous system; sequence: 100 μg chromatin → make up the volume with nuclear lysis buffer → 2 times the volume of ChIP Dilution Buffer → 50 × PI → 20 μl magnetic beads → 6 μl antibody), mix by pipetting, seal with half a strip of sealing film, and incubate at 4°C for 12-16 h (rotary mixer speed 15).

[0222] 8. Washing the magnetic beads: After immunoprecipitation, wash the magnetic beads sequentially with low-salt washing buffer, high-salt washing buffer, and TE buffer (the entire process is performed on ice). Remove the sealing film, place the EP tube containing the sample on a magnetic rack on ice, and after 3 minutes, open the cap, aspirate and discard the supernatant along the opposite side of the magnetic rack, remove the EP tube from the magnetic rack, add 500 μl of low-salt washing buffer to resuspend the magnetic beads, transfer the resuspended magnetic bead suspension to a new EP tube, incubate on ice for 5 minutes, incubate on a magnetic rack for 3 minutes, aspirate the supernatant, remove the EP tube from the magnetic rack, add 500 μl of low-salt washing buffer to resuspend the magnetic beads, incubate on ice for 5 minutes, incubate on a magnetic rack for 3 minutes; The same procedure is followed: wash twice with high-salt wash buffer, and then twice with TE buffer.

[0223] 9. Decrosslinking: Resuspend the magnetic beads in 100 μl ChIP Elution Buffer, add 100 μl ChIP Elution Buffer to each input tube, seal with sealing film, and decrosslink in a 65℃ water bath for 6-12 h (minimum 6 h).

[0224] 10. DNA Extraction: This step is performed at room temperature using the DNA Clean & Concentrator-5 (Capped) kit (ZYMO RESEARCH). Remove the sealing film, place the EP tube on a magnetic rack and let it stand at room temperature for 3 minutes. Transfer the supernatant to a new EP tube, add 500 μl of binding buffer from the kit, and mix thoroughly. Remove the input from the 65°C water bath and add 500 μl of binding buffer directly, mixing thoroughly. Add the mixed liquid to the column and centrifuge at 12000 g for 1 minute at room temperature. Discard the waste liquid in the collection tube, add 200 μl of washing buffer, centrifuge at 12000 g for 1 minute at room temperature, discard the waste liquid in the collection tube, and wash again. Centrifuge for 1 minute and wash the DNA with 30 μl of dd water.

[0225] HepG2-HBV / loxP Cells treated with Ad-Cre were induced to form HBV cccDNA-like circular templates, which were used to evaluate the effects of different sgRNA-mediated base editing on the transcriptional regulatory state of cccDNA. Figure 7 The experimental procedure shown in Part A involved transfecting cells with ABE mRNA and corresponding sgRNA after plating. HBV cccDNA-like template formation was induced using Ad-Cre, and samples were collected on day 3 post-treatment. Chromatin immunoprecipitation and qPCR were performed using antibodies targeting IgG, H3K9me3, RNA polymerase II (Pol II), H3K27Ac, ​​and the Nse4 subunit of the SMC5 / 6 complex, respectively. The antibodies used are listed in Table 19, and the qPCR primers are listed in Table 20.

[0226] IgG was used as a negative control to assess nonspecific binding background; H3K9me3, an inhibitory histone modification associated with transcriptional silencing, typically indicates chromatin repression; RNA polymerase II, a core enzyme in transcription, directly reflects transcriptional activity through its enrichment on cccDNA; H3K27Ac, ​​an activating histone modification associated with active transcription, can be used to evaluate chromatin openness and transcriptional activation status; and Nse4, an important component of the SMC5 / 6 complex, reflects the inhibitory effect of host restriction factors on HBV transcription templates through its enrichment on cccDNA. Therefore, these indicators comprehensively evaluated the transcriptional regulatory status of cccDNA from multiple dimensions, including nonspecific background, transcriptional activity, activating epigenetic modifications, inhibitory epigenetic modifications, and host restriction factor binding. The enrichment levels of each indicator on HBV cccDNA-like templates were detected by chromatin immunoprecipitation and qPCR. Simultaneously, the secretion levels of HBsAg and HBeAg in cell supernatants were measured, and the editing efficiency of corresponding target sites was analyzed by Sanger sequencing.

[0227] Table 19. List of Antibodies Used Table 20 Q-PCR Primer Sequence List like Figure 7 As shown in Part B, the enrichment levels of the IgG negative control on the HBV cccDNA-like template were low, indicating that the ChIP-qPCR detection system has good specificity. Compared with the negative control group, the enrichment levels of the repressive histone modification H3K9me3 on the HBV cccDNA-like template were significantly increased after X11 and X15 treatments, suggesting that HBx target editing can promote the conversion of cccDNA chromatin to a transcriptional repression state. Meanwhile, the enrichment levels of RNA polymerase II and the activating histone modification H3K27Ac on the cccDNA-like template decreased after X11 and X15 treatments, suggesting a decrease in the recruitment capacity and transcriptional activity of the cccDNA transcription complex. Among these, the enrichment level of the Nse4 subunit of the SMC5 / 6 complex on the cccDNA-like template was more significantly increased after X11 treatment, indicating that X11 editing may more effectively relieve the antagonistic effect of HBx on the host restriction factor SMC5 / 6 complex, allowing the SMC5 / 6 complex to rebind to the cccDNA template and participate in transcriptional repression.

[0228] like Figure 7 As shown in Part C, treatments S14, X11, and X15 can all reduce HepG2-HBV / to varying degrees. loxPThe levels of HBsAg in cell supernatant were analyzed, with S14 primarily showing an inhibitory effect on HBsAg secretion. X11 treatment further reduced HBeAg secretion levels, suggesting a strong inhibitory effect on cccDNA transcriptional activity. Target site editing assays showed that S14 produced high-level editing in the corresponding target region of the HBs open reading frame, while X11 and X15 produced high-level editing in the corresponding target region of the HBx open reading frame, indicating that the aforementioned antigen inhibition and cccDNA epigenetic changes are related to the editing of corresponding target sites.

[0229] Based on the functional verification results of the HBx mutant in Example 7, it can be seen that both X11 and X15 editing can weaken HBx protein expression, stability, or conformation, and restore SMC6 nuclear signal; further combined with Figure 7 The ChIP-qPCR results shown indicate that HBx target editing not only affects the HBx protein itself, but also promotes the re-enrichment of Nse4 in the cccDNA template by relieving the inhibition of the SMC5 / 6 complex by HBx. This causes the cccDNA chromatin state to change from a transcriptionally active state to a transcriptionally repressed state, manifested as increased enrichment of H3K9me3 and decreased enrichment of H3K27Ac and RNA polymerase II, ultimately leading to decreased cccDNA transcriptional activity and reduced HBeAg secretion.

[0230] Compared to X15, X11 showed more stable performance in reducing HBeAg secretion and promoting Nse4 enrichment on cccDNA-like templates, suggesting that X11 has a more pronounced interference effect on the HBx-SMC5 / 6-cccDNA transcriptional regulatory axis. Combined with the aforementioned multi-model screening results, S14 mainly reduces HBsAg levels by altering HBs protein expression, processing, or secretion, while X11 mainly reduces cccDNA transcriptional activity by weakening HBx function and reshaping the epigenetic state of cccDNA. Therefore, S14 and X11 act on two complementary mechanisms: HBsAg secretion and HBx-dependent cccDNA transcriptional regulation. Their combined application can achieve dual inhibition of HBV antigen expression and cccDNA transcriptional activity.

[0231] This embodiment did not perform continuous dynamic monitoring of SMC6, Nse4, H3K9me3, H3K27Ac and RNApolymerase II at different time points after X11 editing. Therefore, the existing experimental results cannot directly determine the strict chronological order of the above molecular events.

[0232] However, this invention obtained multi-layered evidence consistent with the "HBx function weakening—SMC5 / 6 restriction restoration—cccDNA transcriptional repression" mechanism through independent and mutually corroborating experiments. First, HBx mutant experiments showed that HBx mutations corresponding to X11 editing significantly weakened HBx immunofluorescence signals, accompanied by restoration of SMC6 signals in the cell nucleus, indicating that X11-mediated HBx functional alterations can weaken the antagonistic effect of HBx on the SMC5 / 6 complex. Second, in HepG2-HBV / loxP In the model, ChIP-qPCR analysis performed on day 3 post-treatment revealed increased enrichment of the SMC5 / 6 complex Nse4 subunit on the cccDNA-like template after X11 treatment, along with increased enrichment of the repressive histone modification H3K9me3, while decreased enrichment of the activating histone modification H3K27Ac and RNA polymerase II on the cccDNA-like template. Furthermore, corresponding to the aforementioned molecular changes, X11 treatment decreased the levels of HBeAg, pgRNA, and the pgRNA / cccDNA ratio, while the total cccDNA amount did not show a significant decrease.

[0233] The above results form a consistent chain of evidence from different levels, including HBx protein function, host restriction factors SMC5 / 6, cccDNA chromatin modification, transcription machinery recruitment, and viral transcripts. Combined with the known biological mechanism by which HBx maintains cccDNA transcriptional activity by antagonizing SMC5 / 6, this can be reasonably explained as follows: X11-mediated editing of key functional regions of HBx weakens HBx function, thus reducing the antagonistic effect of HBx on the SMC5 / 6 complex; the restriction effect of the SMC5 / 6 complex on cccDNA is subsequently restored, manifested by increased Nse4 enrichment on the cccDNA-like template; simultaneously, the cccDNA chromatin state shifts towards transcriptional repression, manifested by increased H3K9me3, decreased H3K27Ac, ​​and reduced RNA polymerase II recruitment, ultimately leading to decreased cccDNA transcriptional activity.

[0234] Therefore, although the current results cannot prove from a temporal dynamics perspective that the above events occur strictly in sequence, they collectively support the mechanism by which X11 induces functional silencing of cccDNA by interfering with the HBx-SMC5 / 6-cccDNA regulatory axis from multiple perspectives, including protein function, host restriction factors, epigenetic state, and viral transcription endpoints.

[0235] Example 9: In vivo efficacy evaluation of candidate sgRNA in cccDNA acute mouse model This embodiment involves evaluating the in vivo efficacy of candidate sgRNAs in an acute HBV cccDNA mouse model. An acute mouse model was established by hydrodynamic tail vein injection of pCMV-cccDNA / pCMV-Cre plasmid. Lipid nanoparticles encapsulating ABE mRNA and sgRNA were administered via tail vein. Serum HBsAg and HBeAg levels were dynamically monitored, and the base editing efficiency at target sites in liver tissue was measured at the experimental endpoint to verify the in vivo editing activity and antiviral effect of sgRNAs such as S14 and X11. Details are as follows: like Figure 8As shown in Part A, an acute mouse model of HBV cccDNA was established using hydrodynamic injection (HDI) with pCMV-cccDNA / pCMV-Cre plasmids (see [Li G, Zhu Y, Shao D, Chang H, Zhang X, Zhou D, Gao Y, Lan K, Deng Q. Recombinantcovalently closed circular DNA of hepatitis B virus induces long-term viral persistence with chronic hepatitis in a mouse model. Hepatology. 2018 Jan;67(1):56-70. doi: 10.1002 / hep.29406. Epub 2017 Nov 15.]). Two μg each of pCMV-cccDNA and pCMV-Cre plasmids were mixed and injected into mice via hydrodynamic tail vein injection. Mice were divided into serpentine groups (n=5 per group) based on HBsAg levels: ABE / S14, ABE / X11, ABE / X15, ABE / S14+X11, ABE / S14+X15, ABE / PCSK9, and a PBS control group. The ABE / PCSK9 group served as a positive control for in vivo gene editing. ABE mRNA and corresponding sgRNA were co-encapsulated in lipid nanoparticles (LNPs) to prepare the corresponding ABE-LNP formulations. Each ABE-LNP group was administered via tail vein injection twice, once on day 0 and once on day 3, for a total of two administrations, with a single dose of 2.5 mg / kg. For single sgRNA administration, the ABE mRNA:sgRNA mass ratio was 1:1; for administration of two sgRNAs, the ABE mRNA:sgRNA mass ratio was 1:0.5:0.5. Peripheral blood was collected on days 2, 4, 7, and 10 after drug administration. Serum was collected by centrifugation and HBsAg and HBeAg levels were measured. Mice were sacrificed at week 10 and livers were collected for subsequent testing of target site editing efficiency.

[0236] like Figure 8As shown in Part B, serum HBsAg levels remained high in all groups of mice during the early stages of model establishment. Following ABE / sgRNA-LNP administration, HBsAg levels changed to varying degrees in different HBV-targeting sgRNA treatment groups. Significant decreases in HBsAg were observed in some mice in the ABE / S14, ABE / X11, and ABE / X15 single-target administration groups, but individual differences existed among different animals. By day 10, HBsAg levels in some HBV-targeting editing groups were significantly lower than in the PBS control group, suggesting that the aforementioned sgRNA, delivered via LNP, can produce HBV antigen inhibition in vivo.

[0237] like Figure 8 As shown in Section C, HBeAg levels in each treatment group changed to varying degrees after drug administration. Compared with the PBS control group, HBeAg levels were reduced in some HBx-targeted editing groups, suggesting that X11 and X15, which target the HBx open reading frame, can reduce cccDNA-derived viral transcription and antigen expression in vivo by affecting HBx-related functions.

[0238] like Figure 8 As shown in Part D, the target site sequencing results of liver tissue on day 10 showed that base editing could be detected at the corresponding target sites after LNP delivery of ABE mRNA and the corresponding sgRNA. Specifically, the average editing efficiency of the HBs target site in the ABE / S14 group was approximately 23.0%; the average editing efficiency of the HBx target site in the ABE / X11 group was approximately 34.6%; and the average editing efficiency of the HBx target site in the ABE / X15 group was approximately 24.0%. Significant PCSK9 target site editing was also detected in the ABE / PCSK9 positive control group. For the ABE / S14+X11 and ABE / S14+X15 dual-target combinations, editing of the corresponding target sites of HBs and HBx could be detected simultaneously, indicating that ABE mRNA and the two HBV-targeting sgRNAs can be delivered together via LNP and achieve in vivo dual-target editing.

[0239] The above results indicate that S14, X11, and X15, screened in this invention, can be co-delivered to mouse liver via LNP with ABE mRNA, achieving in vivo base editing of HBV target sites, accompanied by a decrease in HBV antigen levels. Among them, X11 exhibits higher in vivo editing efficiency at HBx target sites. Combining the efficacy results in the aforementioned cell models and the mechanism of action of HBx-SMC5 / 6-cccDNA, X11 is preferred as the HBx-targeting sgRNA for combined use with S14.

[0240] Example 10: In vivo efficacy evaluation of the S14+X11 dual-target combination in a cccDNA chronic mouse model This embodiment is used to evaluate the in vivo antiviral effect of the preferred S14+X11 dual-target base editing combination of the present invention, delivered via lipid nanoparticles, in a chronic HBV cccDNA mouse model, and further evaluates the effects of different dosages and different LNP delivery formulations on the in vivo efficacy of S14+X11. Specifically: like Figure 8 As shown in section E, a chronic mouse model of HBV cccDNA was established using rAAV-rcccDNA / rAAV-Cre (constructed by the inventors' team in previous work, see [Hu K, Zai W, Xu M, Wang H, Song X, Huang C, Liu J, Chen J, DengQ, Yuan Z, Chen J. Augmented epigenetic repression of hepatitis B virus covalently closed circular DNA by interferon-α and small-interfering RNAsynergy. mBio. 2024 Dec 11;15(12):e0241524. doi: 10.1128 / mbio.02415-24. Epub2024 Nov 21.]). rAAV-rcccDNA and rAAV-Cre were mixed at 2.5*10⁻⁶ ppm each. 10 Mice were administered GE at a dose of 6 per mouse. After serum HBsAg and HBeAg levels stabilized, mice were divided into serpentine groups based on HBsAg levels. Each group consisted of six mice: S14+X11 (2 mg / kg), S14+X11 (4 mg / kg), S14+X11 (ALC-0315 prescription, 4 mg / kg), ABE / PCSK9 (2 mg / kg), PBS control group, and VIR-2218 (2.5 mg / kg) positive control group.

[0241] ABE mRNA and corresponding sgRNA were co-encapsulated in lipid nanoparticles (LNPs) to prepare the corresponding ABE-LNP formulations. Except for the S14+X11 (ALC-0315, 4 mg / kg) group, which was delivered using an LNP formulation containing ionizable lipids of ALC-0315, the other ABE dosing groups were delivered using an SHT-LNP formulation (the composition of which differs from the ALC-0315 lipid nanoparticles described in Example 2; it was constructed by the inventors' team in previous work, as detailed in [Guan J, Zai WJ, Fan LF, Yang XY, MaYY, Guo ZW, et al Discovery of an Ionizable Lipid for Lipid Nanoparticle-Mediated Gene Editing Therapy against Chronic Hepatitis B. APSB 2026(Accepted).]). The mass ratio of ABE mRNA, S14 sgRNA, and X11 sgRNA in the S14+X11 combination was 1:0.8:0.8. The S14+X11 (2 mg / kg) group and the ABE / PCSK9 group were administered total RNA at 2 mg / kg; the S14+X11 (4 mg / kg) group and the S14+X11 (ALC-0315, 4 mg / kg) group were administered total RNA at 4 mg / kg. Each ABE-LNP group received two doses via tail vein injection on days 0 and 3. VIR-2218 was administered subcutaneously at 2.5 mg / kg on day 0 as a positive control for HBV antigen inhibition using siRNA.

[0242] Peripheral blood was collected weekly after drug administration, serum was collected by centrifugation, and HBsAg and HBeAg levels were measured, while animal body weight was monitored. The experiment was planned to be followed up until week 12, at which time mice were sacrificed and livers were collected for subsequent analysis of S14 and X11 target site editing efficiency, candidate off-target sites, and cccDNA-related epigenetic modifications. The results presented in this embodiment represent interim efficacy results obtained up to week 3 after drug administration.

[0243] like Figure 8As shown in section F, administration of the S14+X11 dual-target ABE-LNP significantly reduced serum HBsAg levels in a cccDNA chronic mouse model, exhibiting a clear dose-response effect. In the first week after administration, HBsAg levels in the 4 mg / kg S14+X11 group decreased significantly and remained at a low level throughout the subsequent observation period. By week 3, serum HBsAg levels in the S14+X11 (4 mg / kg) group decreased by approximately 3.54 log10 compared to pre-administration levels, while those in the S14+X11 (2 mg / kg) group decreased by approximately 1.20 log10, indicating that the 4 mg / kg dose had a significantly stronger inhibitory effect on HBsAg (P = 0.0043) than the 2 mg / kg dose.

[0244] Further comparison of different LNP prescriptions, such as Figure 8 As shown in section F, after delivering 4 mg / kg S14+X11 using SHT-LNP and LNP containing ALC-0315, serum HBsAg decreased by approximately 3.54 log10 and 3.62 log10, respectively, by week 3, indicating that both LNP delivery systems could support the significant HBsAg inhibitory effect of S14+X11 in vivo. The HBsAg reduction in the 4 mg / kg S14+X11 dual-target ABE-LNP group reached or exceeded that in the VIR-2218 positive control group, and maintained a low HBsAg level by week 3.

[0245] like Figure 8 As shown in section G, serum HBeAg levels also decreased significantly after S14+X11 administration, exhibiting a certain dose-dependent effect. By week 3, HBeAg levels in the S14+X11 (4 mg / kg) group decreased by approximately 1.80 log10 compared to pre-administration levels, while those in the S14+X11 (2 mg / kg) group decreased by approximately 1.20 log10. Following delivery of 4 mg / kg S14+X11 using SHT-LNP and LNP containing ALC-0315, HBeAg levels decreased by approximately 1.80 log10 and 0.96 log10, respectively, suggesting that different LNP delivery formulations may have varying antiviral effects related to the HBx target.

[0246] like Figure 8 As shown in section H, the overall body weight of mice in each group showed a steady increasing trend after administration, and no significant and sustained weight loss was observed during the observation period up to week 3, suggesting that the animals in each ABE-LNP administration group had good overall tolerance in the short term under the administration conditions of this experiment.

[0247] The above results demonstrate that the preferred S14+X11 dual-target base editing combination of this invention, delivered via LNP, can significantly reduce HBsAg and HBeAg levels simultaneously in a chronic HBV cccDNA mouse model, exhibiting a clear dose-dependent effect. Specifically, the S14+X11 combination administered twice at 4 mg / kg with a 3-day interval showed strong HBV antigen inhibition. Furthermore, significant HBsAg inhibition was achieved using different LNP formulations for S14+X11 delivery, further supporting the feasibility of using the S14+X11 dual-target combination for in vivo HBV therapy.

[0248] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. A combination of sgRNAs targeting HBV, characterized in that, include: A first sgRNA that targets the HBV HBs open reading frame, wherein the spacer sequence of the first sgRNA contains a sequence as shown in any one of SEQ ID NO: 13-16, or a sequence having at least 90% sequence identity with a sequence shown in any one of SEQ ID NO: 13-16, or containing at least 16 consecutive amino acids of a sequence shown in any one of SEQ ID NO: 13-16; A second sgRNA that targets the HBV HBx open reading frame, wherein the spacer sequence of the second sgRNA contains the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28, or containing at least 16 consecutive amino acids of the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28; The first sgRNA is used to reduce HBsAg expression or secretion, and the second sgRNA is used to inhibit HBx-dependent cccDNA transcriptional activity; the two functions are complementary.

2. The sgRNA combination according to claim 2, characterized in that, The first sgRNA is HBV-Smut_14, and its spacer sequence is shown in SEQ ID NO: 13; the second sgRNA is HBV-Xmut_11, and its spacer sequence is shown in SEQ ID NO:

27.

3. The sgRNA combination according to claim 1, characterized in that, The first sgRNA and / or the second sgRNA are full-length sgRNAs, which include the spacer sequence located at the 5′ end and the Cas9 sgRNA backbone sequence attached to its 3′ end; Wherein, the full-length sgRNA sequence of the first sgRNA is shown in any one of SEQ ID NO: 45~48, and the full-length sgRNA sequence of the second sgRNA is shown in SEQ ID NO: 59 or SEQ ID NO: 60; The sgRNA contains chemically modified nucleotides, including 2'-O-methyl modification and / or phosphate thioester backbone modification.

4. The sgRNA combination according to claim 3, characterized in that, The first sgRNA is HBV-Smut_14, and its full-length sgRNA sequence is shown in SEQ ID NO: 45; the second sgRNA is HBV-Xmut_11, and its full-length sgRNA sequence is shown in SEQ ID NO: 59; The sgRNA contains a 2′-O-methyl modification in the first 3 nucleotides at the 5′ end and the last 3 nucleotides at the 3′ end, and the phosphodiester bonds between each pair of the first 4 nucleotides at the 5′ end and between each pair of the last 4 nucleotides at the 3′ end are thiophosphate bonds.

5. An sgRNA targeting HBV, characterized in that, The sgRNA can target the open reading frame of HBs or HBx. The spacer sequence of the sgRNA targeting the HBs open reading frame comprises a sequence as shown in any one of SEQ ID NO: 13-16, or a sequence having at least 90% sequence identity with any one of SEQ ID NO: 13-16, or comprising at least 16 consecutive amino acids of the sequence shown in any one of SEQ ID NO: 13-16; when the sgRNA is used in conjunction with a base editor, it can introduce base editing mutations into the HBs open reading frame, thereby reducing the expression or secretion of HBsAg; and / or The spacer sequence of the sgRNA targeting the HBx open reading frame comprises the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28, or comprising at least 16 consecutive amino acids of the sequence shown in SEQ ID NO: 27 or SEQ ID NO: 28; when used in conjunction with a base editor, the sgRNA can introduce base editing mutations into the HBx open reading frame, thereby inhibiting HBx-dependent cccDNA transcriptional activity.

6. A base editing system, characterized in that, Include: (1) an adenine base editor, or a nucleic acid molecule encoding said base editor; and (2) The combination of sgRNAs as described in any one of claims 1-4 or the sgRNA as described in claim 5.

7. The base editing system according to claim 6, characterized in that, The adenine base editor comprises a Cas9nickase domain and an adenine deaminase domain; and / or The nucleic acid molecule encoding the adenine base editor is mRNA; and / or The amino acid sequence of the adenine base editor is shown in SEQ ID NO:

65.

8. A pharmaceutical composition, characterized in that, include: (1) The sgRNA combination according to any one of claims 1-4 or the sgRNA according to claim 5; (2) The base editing system according to any one of claims 6 or 7; (3) Pharmaceutically acceptable carrier.

9. The pharmaceutical composition according to claim 8, characterized in that, The carrier is lipid nanoparticles; and / or The mass ratio of the base editing system to a single sgRNA is 1:(0.1~10). The mass ratio of the base editing system, the first sgRNA, and the second sgRNA is 1:(0.1~2):(0.1~2). The lipid nanoparticles comprise ionizable lipids, auxiliary lipids, cholesterol, and polyethylene glycol-modified lipids; The lipid nanoparticles are coupled with liver-targeting ligands on their surface.

10. Use in the preparation of a medicament for treating HBV infection or chronic hepatitis B, according to any one of claims 1-4, the sgRNA of claim 5, the base editing system of any one of claims 6-7, or the pharmaceutical composition of any one of claims 8 or 9.

Images