Limonium bicolorum gene lbmyb4 and application thereof

Abstract

This invention belongs to the field of plant genetic engineering and provides the LbMYB4 gene from *Limonium bicolor* and its applications. By obtaining stably expressed *Limonium bicolor* overexpression lines and VIGS lines, this invention measured salt gland development, salt secretion capacity, and salt tolerance. It was found that compared with the control, the LbMYB4 overexpression lines in *Limonium bicolor* showed increased salt gland density, significantly improved salt secretion capacity, and salt tolerance, while the silencing lines exhibited the opposite phenotype. This indicates that LbMYB4 plays a positive regulatory role in salt gland development. This invention lays the foundation for exploring the role of the MYB transcription factor family in salt gland development and opens up new pathways for breeding salt-tolerant crops (including species without salt glands).

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, and specifically relates to the LbMYB4 gene of Limonium bicolor and its application. Background Technology

[0002] Soil salinization is a significant factor contributing to the decline in arable land productivity. Conservative estimates suggest that salinization affects at least 800 million hectares of land globally, approximately one-quarter of the world's arable land area (Mokrani S, Nabti Eh, Cruz C. Current Advances in Plant Growth Promoting Bacteria Alleviating Salt Stress for Sustainable Agriculture [J / OL] 2020, 10(20):10.3390 / app10207025). Every year, 10 million hectares of agricultural land are damaged by salt accumulation. Furthermore, factors such as improper irrigation, rising groundwater levels with high salinity, and inappropriate fertilization are causing the area of ​​salinized soil to continuously increase (Ouhibi C, Attia H, Rebah F, et al. Salt stress mitigation by seed priming with UV-C in lettuceplants: growth, antioxidant activity and phenolic compounds [J]. PlantPhysiol Biochem, 2014, 83: 126-33.). The ever-increasing soil salinization is severely impacting crop growth and production, jeopardizing global food security. Improving and fully utilizing saline-alkali land to enhance agricultural productivity is therefore of paramount importance. In this context, fully elucidating the salt tolerance mechanisms of plants, cultivating salt-tolerant crop germplasm, and promoting its cultivation on saline-alkali land are the most ideal and fundamental biological improvement methods.

[0003] Halophytes can thrive in environments with NaCl concentrations exceeding 200 mM, and higher salinity promotes their growth. They are excellent materials for studying the high salt tolerance of plants, providing a natural candidate germplasm resource with great potential for biological improvement of saline-alkali land, and are also a treasure trove of salt tolerance genes (Flowers TJ, Colmer TD. Salinity tolerance inhalophytes [J]. New Phytol, 2008, 179(4): 945-63). Limonium bicolor is a typical halophyte with salt glands that secrete salt. In an environment of 200-300 mM NaCl, it can desalinate the plant and maintain a high photosynthetic rate (Yuan F, Leng BY, Wang BS. Progress in studying salt secretion from the salt glands in recretohalophytes: How do plants secrete salt? [J]. Front Plant Sci, 2016, 7: 977). Research on the development of salt glands and salt tolerance mechanisms in salt-secreting plants can help discover salt tolerance-related genes and provide resources for breeding salt-tolerant crops.

[0004] MYB transcription factors are one of the largest transcription factor superfamily in the biological world. All MYB proteins contain a highly conserved MYB domain at their N-terminus, consisting of 1–4 incomplete repeats (R). Each repeat (R) contains approximately 50–53 amino acids, folded into three α-helices, with the second and third helices forming a helix-turn-helix (HTH) conformation, inserting into the major groove of DNA to recognize and bind to target sequences. Each repeat contains regularly spaced tryptophan residues, forming a hydrophobic core to maintain structural stability. It plays a central role in the regulation of secondary metabolism, cell differentiation and organ development, and cell cycle regulation. It is the core hub for regulating plant-specific growth and development and adaptation to adversity (Gubler F, Kalla R, Roberts JK, et al. Gibberellin-regulated expression of a myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pI alpha-amylase gene promoter[J].The Plant Cell, 1995, 7(11): 1879-1891.).

[0005] The LbMYB4 regulatory factor identified in this invention can significantly increase salt gland density and enhance plant salt tolerance after overexpression, providing valuable candidate gene resources for the genetic improvement of crop salt tolerance. Summary of the Invention

[0006] The purpose of this invention is to provide the LbMYB4 gene of *Limonium bicolor* and its applications.

[0007] This invention studies the LbMYB4 transcription factor family of Limonium bicolor, obtains its overexpression lines and VIGS (Virus-induced gene silencing) lines, and explores the role of the LbMYB4 gene in the development of salt glands in Limonium bicolor.

[0008] The objective of this invention and the solution to its technical problems can be achieved through the following technical solutions.

[0009] In a first aspect, the present invention provides the LbMYB4 gene of *Limonium bicolor*, which is a gene encoding either protein (a) or (b):

[0010] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2; or

[0011] (b) A protein derived from (a) with one or more amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID NO:2 and having an equivalent function.

[0012] In an embodiment of the present invention, the nucleotide sequence of the *Limonium bicolor* gene LbMYB4 is shown in SEQ ID NO:1.

[0013] Secondly, the present invention provides the LbMYB4 protein from *Limonium bicolor*. In an embodiment of the present invention, the amino acid sequence of the LbMYB4 protein is shown in SEQ ID NO:2.

[0014] Thirdly, the present invention provides biological materials containing the LbMYB4 gene of *Limonium bicolor*.

[0015] In embodiments of the present invention, the biological materials include, but are not limited to, recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or non-renewable plant parts.

[0016] Fourthly, this invention provides the application of the LbMYB4 gene of *Limonium bicolor* or biological materials containing the LbMYB4 gene in the preparation of transgenic plants.

[0017] Fifthly, the present invention provides any of the following applications of the Limonium bicolor gene LbMYB4 or biological materials containing the gene LbMYB4: (1) for regulating the growth and development of salt glands in halophytes; (2) for regulating the salt secretion capacity of halophytes; (3) for regulating the stress resistance of halophytes; (4) for plant variety improvement.

[0018] In the embodiments of the present invention, the regulation described in (1)-(3) is positive regulation, such as positive regulation of the number of salt gland cells, promoting the differentiation of meristematic cells into the initial structure of multicellular salt glands, etc.

[0019] In an embodiment of the present invention, the preferred plant is *Limonium bicolor*.

[0020] In a sixth aspect, the present invention provides a method for reducing the number of salt gland cells and causing abnormal salt gland development in *Limonium bicolor*, including using genetic engineering to weaken the *Limonium bicolor* gene LbMYB4 to obtain a gene-weakened strain.

[0021] In embodiments of the present invention, attenuation includes knocking out or reducing gene expression.

[0022] In a seventh aspect, the present invention provides a method for promoting the development of plant salt glands (including increasing the number of salt gland cells, promoting the differentiation of meristematic cells into the initial structure of multicellular salt glands, etc.), wherein the method is selected from the following 1) or 2): 1) causing the plant to express the protein encoded by the Limonium bicolor gene LbMYB4; 2) overexpressing the Limonium bicolor gene LbMYB4 in the plant.

[0023] In an embodiment of the present invention, the plant is a halophyte that secretes salts, preferably *Limonium bicolor*.

[0024] In embodiments of the present invention, the overexpression method is selected from any one of (1) to (5) or a combination thereof:

[0025] (1) By introducing a plasmid containing the gene; (2) by increasing the copy number of the gene on a plant chromosome; (3) by altering the promoter sequence of the gene on a plant chromosome; (4) by operatively linking a strong promoter to the gene; (5) by introducing an enhancer.

[0026] Eighthly, the present invention provides any one of the following applications of the transgenic plants obtained by the above method: i. for plant breeding; ii. for planting in saline-alkali land.

[0027] In embodiments of the present invention, breeding methods include, but are not limited to, transgenic, hybrid, backcross, self-cross, or asexual reproduction.

[0028] This invention marks the first time that the gene LbMYB4 has been cloned from *Limonium bicolor*, and its biological functions have been investigated. The study found that overexpression of LbMYB4 enhances the plant's salt tolerance by increasing salt gland density and salt secretion capacity. LbMYB4-overexpressing lines exhibited significantly increased salt gland density, salt secretion, and salt tolerance, while silenced lines showed the opposite phenotype. This invention not only deepens our understanding of the hormone regulatory network for salt gland development in halophytes but also provides important theoretical basis and candidate genes for improving crop salt tolerance through genetic engineering, and opens new pathways for cultivating salt-tolerant crops (including species lacking salt glands). Attached Figure Description

[0029] Figure 1 Molecular identification and observation of leaf epidermal and tissue structure of LbMYB4 overexpressing lines in a preferred embodiment of the present invention. A: LbMYB4 overexpressing lines OE-LbMYB4-1 to OE-LbMYB4-19 (labeled 1-19 in the figure). Figure 1 PCR identification (with the same meaning in D and F). Marker size: 2000 bp. B: Relative expression level of LbMYB4. The expression level of LbMYB4 was detected using RT-qPCR with the control group (WT) as a control. C: Salt gland density and morphology of leaves of *Limonium bicolor* in LbMYB4 control (1300) and overexpression lines. Images were taken under UV light at 380 nm, scale bar = 50 μm. D: Statistical count of salt glands on individual leaf discs. E: Scanning electron microscopy images of salt glands in LbMYB4 overexpression and control lines, scale bar = 200 μm. F: Epidermal cell leaf area statistics. G, H: Longitudinal and transverse sections of salt glands in LbMYB4 overexpression and control lines, scale bar = 50 μm. Data in the figures are expressed as mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences at the Duncan multiple test level (P < 0.05).

[0030] Figure 2 This is a preferred embodiment of the invention for obtaining LbMYB4 silencing lines and observing their salt glands. A: LbMYB4 silencing lines TRV::LbMYB4-1 to TRV::LbMYB4-7 (labeled 1-7 in the figure). Figure 2The relative expression level of LbMYB4 in (C: with the same meaning as the annotations in the diagram) was determined. The transcriptional level of LbMYB4 was detected using RT-qPCR. Different lowercase letters indicate significant differences between groups (P < 0.05). B: Salt gland density and morphology of *Limonium bicolor* leaves under UV light. Scale bar = 50 μm. C: Statistical count of salt glands in a single leaf disc. Data in the figures are expressed as mean ± standard deviation (n = 3 biological replicates). Different lowercase letters indicate significant differences at the Duncan multiple test level (P < 0.05).

[0031] Figure 3 This is a preferred embodiment of the invention showing the effect of LbMYB4 overexpression on the salt tolerance of *Limonium bicolor*. A: 1300 vector control (1300) and LbMYB4 overexpression lines (OE-LbMYB4-7, OE-LbMYB4-15, OE-LbMYB4-2, labeled as 7, 15, and 2 in the figure). Figure 3 (D and E have the same meaning) Representative photos before irrigation with 200 mM NaCl and 2 weeks after treatment. B: Changes in total leaf area before and after NaCl treatment in the control and LbMYB4 overexpression lines. C: Representative photos demonstrating the salt-secreting capacity of plants using the leaf disc method (the size of droplets on the leaf disc surface reflects the salt-secreting intensity). DE: Salt-secreting volume and NaCl content. + Secretion rate statistics. FG: Na content in leaves of control and LbMYB4 overexpressing lines as measured by NMT. + Secretion rate. Data in the figure are presented as mean ± standard deviation (n = 3 biological replicates). Different lowercase letters indicate significant differences at the Duncan multiple test level (P < 0.05).

[0032] Figure 4 This is a preferred embodiment of the invention showing the effect of LbMYB4 silencing on the salt tolerance of *Limonium bicolor*. A: Representative photographs of the TRV::0 control line and the LbMYB4-silenced line before irrigation with 200 mM NaCl and 14 days after treatment. B: TRV::0 control line and LbMYB4-silenced lines (TRV::LbMYB4-7, TRV::LbMYB4-6, TRV::LbMYB4-3, labeled 7, 6, and 3 in the figure). Figure 4 (D and E have the same meaning) Changes in total leaf area before and after NaCl treatment. C: Representative photographs demonstrating the plant's salt-secreting capacity using the leaf disc method (droplet size on the leaf disc surface reflects the intensity of salt secretion). DE: Salt-secreting volume and NaCl... + Secretion rate statistics. Data in the figure are expressed as mean ± standard deviation (n = 3 biological replicates). Different lowercase letters indicate significant differences at the Duncan multiple test level (P < 0.05).

[0033] Figure 5 This is a preferred embodiment of the present invention showing the physiological response to salt stress and the expression of related genes in LbMYB4 overexpression and silencing lines. A–D: Physiological indicators of LbMYB4 overexpression lines and control line (1300) under 0 and 200 mM NaCl treatment. A: Na + Content (mmol·g) -1 FW), B:K + Content (mmol·g) -1 FW), C: Malondialdehyde (MDA) content (mmol·g) -1 FW), D: Proline content (μg·g) -1 FW). E–H: Physiological parameters of LbMYB4 silenced lines and control lines (TRV::0) under 0 and 200 mM NaCl treatment. E: Na + Content (mmol・g⁻¹ FW), F:K + Content (mmol·g) -1 FW), G: Malondialdehyde (MDA) content (mmol·g) -1 FW), (H)proline content (μg·g) -1 FW). IP: Analysis of reactive oxygen species (ROS) accumulation in LbMYB4 overexpression and silencing lines under salt stress. DAB staining was used to detect H2O2, and NBT staining was used to detect O2. 2- Data in the figure are expressed as mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences at the Duncan multiple test level (P < 0.05). Detailed Implementation

[0034] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2012), or as recommended by the manufacturer's instructions.

[0035] Example

[0036] 1. Experimental Materials and Methods

[0037] 1.1. Experimental Materials

[0038] The seeds of *Limonium bicolor* were collected in October 2023 from the saline-alkali land in the Yellow River Delta in Dongying City, Shandong Province, China. After rubbing the seeds out, large, plump, and uniformly sized seeds were selected and stored in a refrigerator at 4°C for 6 months before use to minimize individual differences between seeds.

[0039] 1.2. Experimental Methods

[0040] 1.2.1 Cultivation of Limonium bicolor

[0041] Remove the preserved seeds and evenly spread them on nutrient soil (Jiaheng Seedling Substrate Processing Plant, Shouguang City, Shandong Province). After sealing with a film, place them in the culture environment under the following conditions: 26 / 22℃ (day / night), photoperiod 16 / 8 h (day / night), light intensity 600 μmol / m². 2 Cultivated in a greenhouse ( / s), the plant grew its sixth true leaf after about a month and was used for experiments.

[0042] 1.2.2 Cloning of the LbMYB4 gene

[0043] RNA was extracted from the leaves of *Limonium bicolor* using the FastPure Plant Total RNA Isolation Kit RC401-01 (Nanjing Novizan Biotechnology Co., Ltd.), and cDNA templates were obtained by reverse transcription using the HiScript III 1stStrand cDNA Synthesis Kit (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd.).

[0044] Based on the nucleotide sequence of the LbMYB4 gene (SEQ ID NO:1), amplification primers were designed (Table 1) for PCR.

[0045] Table 1 Primers used for cloning the 5' flanking sequence of the LbMYB4 gene.

[0046] Primer name Sequence (5'-3') LbMYB4-5 ATGAGACAACCATGTTGTG LbMYB4-3 TCAAGTCCGCTGACCCAAGC

[0047] The reaction was performed using high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus) P525-01 / 02 / 03 (Nanjing Novizan Biotechnology Co., Ltd.), with leaf cDNA as a template. The reaction steps are as follows:

[0048] (1) PCR reaction: PCR reaction was performed using LbMYB4-5 as the upstream primer and LbMYB4-3 as the downstream primer.

[0049] ① Prepare the PCR reaction solution according to the following components:

[0050] cDNA 1-5 μL 2 × Phanta Max Master Mix (Dye Plus) 25 μL LbMYB4-5 (10 μM) 2 μL LbMYB4-3 (10 μM) 2 μL <![CDATA[ddH2O]]> Add to 50 μL

[0051] ② The PCR reaction conditions are as follows: 35 cycles.

[0052] 95℃ 3 min 95℃ 15 sec 58℃ 15 sec 72℃ 1 min 72℃ 5 min

[0053] (2) Take 50 μL of each PCR reaction solution and perform electrophoresis with 1% agarose gel.

[0054] (3) After DNA electrophoresis, the clear electrophoretic bands were quickly cut off with a blade under ultraviolet light for gel recovery. The gel recovery method was based on the FastPure Gel DNA Extraction Mini Kit DC301 (Nanjing Novizan Biotechnology Co., Ltd.). The PCR products were sequenced using LbMYB4-5 and LbMYB4-3 primers. The DNA samples with correct sequencing were used for the next step of the experiment.

[0055] 1.2.3 Construction and infection of VIGS vectors

[0056] (1) Based on the pTRV2 vector (Hunan Fenghui Biotechnology Co., Ltd.), a non-conserved sequence of approximately 300 bp of the LbMYB4 gene was selected as the target (shown in SEQ ID NO:3), and ligation primers were designed:

[0057] Table 2. Ligation primers used for the VIGS vector

[0058] Primer name Sequence (5'-3') LbMYB4-VIGS-5 gtgagtaaggttaccgaattcATGAGACAACCATGTTGTGA LbMYB4-VIGS-3 gagacgcgtgagctcggtaccGTCGGTTCTGCCTGGTAGTCTT

[0059] (2) PCR amplification of the insert fragment, in the following system (50 μl):

[0060] LbMYB4 PCR recovery product 1-5 μL 2 × Phanta Max Master Mix (Dye Plus) 25 μL LbMYB4-VIGS-5 (10 μM) 2 μL LbMYB4-VIGS-3 (10 μM) 2 μL <![CDATA[ddH2O]]> Add to 50 μL

[0061] PCR reaction procedure: 35 cycles.

[0062] 95℃ 3 min 95℃ 15 sec 58℃ 15 sec 72℃ 1 min 72℃ 5 min

[0063] (3) The pTRV2 vector was digested using New England Biolabs (NEB) restriction enzymes and the corresponding buffer. The reaction mixture was 50 μL as follows:

[0064] pTRV2 vector 10 μL <![CDATA[EcoRI-HF ® ]]> 1 μL <![CDATA[KpnI-HF ® ]]> 1 μL <![CDATA[rCutSmart TM Buffer]]> 5 μL <![CDATA[ddH2O]]> 33 μL

[0065] Reaction conditions: 37°C for 2-3 hours; after completion, the enzyme digestion product was purified and recovered.

[0066] (4) The PCR product was purified and recovered, and the pTRV2 vector was ligated using the ClonExpress Ultra One Step Cloning Kit V3 (Nanjing Novizan Biotechnology Co., Ltd.). The reaction system was as follows (10 μL):

[0067] PCR product recovery 2~3 μL pTRV2 vector 2~3 μL 2 x CE Mix V3 5 μL

[0068] Reaction conditions: 50°C for 15 min.

[0069] (5) Take 5 μL of the ligation product and transform it into Escherichia coli DH5α (Shanghai Beyotime Biotechnology Co., Ltd.). Spread it on LB solid medium containing 50 μg / mL kanamycin (Beijing Cooler Technology Co., Ltd.). After incubating at 37℃ for one day, pick single colonies. After identifying positive single clones using primers LbMYB4-VIGS-5 and LbMYB4-VIGS-3, expand the positive colonies and extract plasmids using FastPure Plasmid Mini Kit DC201 (Nanjing Novizan Biotechnology Co., Ltd.). Transform the correctly sequenced recombinant plasmid into K599 Agrobacterium rhizogenes (Beijing Cooler Technology Co., Ltd.).

[0070] (6) Agrobacterium-mediated genetic transformation of *Limonium bicolor*: Single clones of *Agrobacterium* positive for the target gene were selected and cultured by shaking. Simultaneously, pTRV1 and pTRV2 (Hunan Fenghui Biotechnology Co., Ltd.) bacterial suspensions were cultured. After culturing at 29°C for 16-18 h, 1 mL of each bacterial suspension was transferred to a fresh 50 mL YEB liquid medium (with final concentrations of kanamycin 50 μg / mL, rifampin 50 μg / mL, and 100 μM acetylsylgenone, reagents purchased from Beijing Coollife Technology Co., Ltd.) for activation, and then cultured again at 29°C for 16-18 h. The bacterial suspension was enriched by centrifugation in 50 mL centrifuge tubes at 3000 rpm for 10 min. The supernatant was discarded after centrifugation. A resuspension solution (MgCl2 2.033 mg / mL, acetylsylgenone 500 μM, MES 2.132 mg / mL) was prepared, and the bacterial suspension was resuspended to OD200. 600 = 1.0, and subsequent infection experiments were conducted after 3 hours of darkness and stillness.

[0071] (7) Infection of *Limonium bicolor*: pTRV1 resuspension and pTRV2 resuspension containing the target gene fragment (experimental group), and pTRV1 and pTRV2 resuspension (control group) were mixed at a 1:1 ratio. *Limonium bicolor* seedlings with consistent growth were selected, and the mixed bacterial solution was injected onto the underside of their leaves until the solution penetrated the entire leaf. After injection, the plants were treated in the dark for 48 h. Leaves from mature *Limonium bicolor* seedlings that had been cultured for two weeks were collected to determine the silencing efficiency (RT-qPCR experiment). Total RNA was extracted using the FastPure Plant Total RNA Isolation Kit RC401-01 (Nanjing Novizan Biotechnology Co., Ltd.) according to the kit instructions. To eliminate genomic DNA contamination, the RNA was reverse transcribed into a cDNA template using HiScriptIII RT SuperMix for qPCR (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd.). The reagent used was ChamQ Universal SYBR qPCR Master Mix Q711 (Nanjing Novizan Biotechnology Co., Ltd.).

[0072] Table 3 Primers and internal controls used for LbMYB4 silencing efficiency assay

[0073] Primer name Sequence (5'-3') qMYB4-5 ATTGATTGCTGGAAGACTAC qMYB4-3 TAAGGTGTTGGTGTGGTT qTubulin-5 GGTTGAGTGAGCAGTTCAC qTubulin-3 GATAACCAGCCACACCTTAGC

[0074] 1.2.4 Construction and infection of LbMYB4 expression vector

[0075] (1) Based on the sequence shown in SEQ ID NO:1, the stop codon was removed, ligation primers were designed, and the pCAMBIA1300 vector (Beijing Cooler Master Technology Co., Ltd.) was ligated. The vector was transformed into *E. coli* DH5α, and the plasmid was extracted using the FastPure Plasmid Mini Kit DC201 (Nanjing Novizan Biotechnology Co., Ltd.). The correctly sequenced recombinant plasmid was then transformed into *Agrobacterium rhizogenes* K599. The construction process was the same as that for the VIGS vector construction described above. The primers used are shown in Table 4.

[0076] Table 4 Primers and internal controls used in the construction of the LbMYB4 overexpression vector

[0077] Primer name Sequence (5'-3') LbMYB4-OE-5 cggggatcctctagagtcgacATGAGACAACCATGTTGTGAGAAAG LbMYB4-OE-3 gcccttgctcaccatgtcgacAGTCCGCTGACCCAAGCG qTubulin-5 GGTTGAGTGAGCAGTTCAC qTubulin-3 GATAACCAGCCACACCTTAGC

[0078] (2) Stable genetic transformation of *Limonium bicolor*

[0079] Separate the leaves (retaining the petioles) and roots of *Limonium bicolor* that have been grown for 1-2 months (rinse the roots with water to remove soil and other impurities), and cut 2-3 cm root segments with a scalpel. Incubate with K599 *Agrobacterium rhizogenes* suspension (cultured for approximately 12-16 hours, OD...) 600 > 1.0) Soak roots for 30 minutes. Alternatively, apply agar plates to the cut surfaces of roots or petioles to allow a certain amount of fungal cells to adhere to the wounds. Place the roots on moist vermiculite, spreading them flat, with the petioles inserted 2-3 cm into the vermiculite, and cover with a film. Roots will sprout around week 3, and roots will grow from the petioles. Buds will root in 5-6 weeks. Roots will sprout in 7-8 weeks.

[0080] (3) PCR identification of positive strains

[0081] Adventitious buds that have formed new root systems and root segments that have produced regenerated buds were transferred to culture soil (Jiaheng Seedling Substrate Processing Plant, Shouguang City, Shandong Province) and cultured to a height of approximately 10 cm. Genomic DNA was extracted from the leaves using the CTAB method. First, the ground *Limonium bicolor* leaf samples were thoroughly lysed using 2×CTAB extraction buffer (Beijing Solarbio Science & Technology Co., Ltd.) preheated to 65℃. Then, an equal volume of chloroform and isoamyl alcohol mixture (chloroform:isoamyl alcohol ratio 24:1, both purchased from Sinopharm Chemical Reagent Co., Ltd.) was added to extract and remove proteins and impurities. After centrifugation, the supernatant was collected. Isopropanol (Sinopharm Chemical Reagent Co., Ltd.) was then added to precipitate the DNA, and the precipitate was washed with 70% ethanol (Sinopharm Chemical Reagent Co., Ltd.) to remove salts. Finally, the DNA precipitate was dried in a fume hood and dissolved in water. After determining the concentration of the extracted DNA, it was stored at −20℃.

[0082] Using extracted DNA as a template, primers were designed based on the restriction enzyme sites used in the pCAMBIA1300 vector (Beijing Cooler Master Technology Co., Ltd.) to identify positive strains. The pCAMBIA1300 vector sequence is referenced in the product instructions. The primers are shown in Table 5.

[0083] Table 5 Primers used for identifying positive strains

[0084] Primer name Sequence (5'-3') pCAMBIA1300-5 AGAGAACACGGGGGACGAGCTCGGTA pCAMBIA1300-3 CGGTGGTGCAGATGAACTTCAGGGT

[0085] The reaction was performed using high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus) P525-01 / 02 / 03, with the extracted DNA as a template. The reaction steps are as follows:

[0086] PCR reaction: PCR reaction was performed using the primers in Table 5.

[0087] Prepare the PCR reaction solution according to the following components:

[0088] Genomic DNA 1-5 μL 2 × Phanta Max Master Mix (Dye Plus) 25 μL pCAMBIA1300-5 (10 μM) 2 μL pCAMBIA1300-3 (10 μM) 2 μL <![CDATA[ddH2O]]> Add to 50 μL

[0089] The PCR reaction conditions were as follows: 35 cycles.

[0090] 95℃ 3 min 95℃ 15 sec 58℃ 15 sec 72℃ 1 min 72℃ 5 min

[0091] Take 50 μL of each PCR reaction solution and perform electrophoresis on a 1% agarose gel. Positive seedlings will show bands of corresponding length.

[0092] (4) RT-qPCR identification of positive strains

[0093] Leaf samples were collected, and total RNA was extracted using the FastPure Plant Total RNA Isolation Kit RC401-01 (Nanjing Novizan Biotechnology Co., Ltd.) according to the kit instructions. To eliminate genomic DNA contamination, the RNA was reverse transcribed into a cDNA template using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd.).

[0094] The primers used for RT-qPCR are shown in Table 6. ChamQ Universal SYBR qPCR Master MixQ711 (Nanjing Novizan Biotechnology Co., Ltd.) was used, and the reaction system was based on the reagent instructions.

[0095] Table 6 Primers used for LbMYB4 RT-qPCR detection

[0096] Primer name Sequence (5'-3') qMYB4-5 ATTGATTGCTGGAAGACTAC qMYB4-3 TAAGGTGTTGGTGTGGTT qTubulin-5 GGTTGAGTGAGCAGTTCAC qTubulin-3 GATAACCAGCCACACCTTAGC

[0097] The transgenic positivity rate and site editing were identified using PCR and analyzed by RT-qPCR. Positive lines were screened and propagated in culture soil (Jiaheng Seedling Substrate Processing Plant, Shouguang City, Shandong Province) to obtain transgenic *Limonium bicolor* plants.

[0098] 1.2.5 Observation of salt glands in leaves of *Limonium bicolor* under ultraviolet excitation light

[0099] The leaves of *Limonium bicolor* were washed with deionized water to remove salt from the leaf surface. They were then fixed using a fixative (ethanol:acetic acid = 3:1, reagent purchased from Sinopharm Chemical Reagent Co., Ltd.). Transparent leaves were placed on glass slides and observed using a fluorescence microscope under ultraviolet light (330-380 nm) with differential interference microscopy (DIC, ECLIPSE 80i, Nikon, Japan). Three leaves from each strain were selected to calculate the number of salt glands. Five different fields of view were observed on each leaf, and the average value of these three leaf observations was taken as the number of salt glands on each leaf.

[0100] 1.2.6 Determination of Salt Secretion Capacity (Leaf Disc Method)

[0101] Leaves of *Limonium bicolor* with similar developmental stages were selected. The leaves were rinsed with distilled water to remove surface salts. 10 mm diameter discs were prepared at the same location on each leaf using a perforator. After drying the leaves on filter paper, they were placed in petri dishes containing 200 mM NaCl solution, with the leaf back facing upwards and floating on the solution. The leaf discs were then covered with mineral oil (Beijing Coollab Technology Co., Ltd.). After standing for 18-24 h, salt droplets were collected from the leaf surface and centrifuged. The volume of secreted fluid above the surface of each leaf disc was measured using a micropipette. The collected salt droplets were diluted appropriately, and the Na+ content in the secreted fluid was determined using a flame photometer. + concentration.

[0102] 1.2.7 Reactive Oxygen Species Staining

[0103] Dichromatic Limonium leaf discs with a diameter of 1 cm were prepared using a perforator and stained with DAB (3,3'-diaminobenzidine) and NBT (nitroblue tetrazolium) respectively. DAB staining solution was prepared by dissolving 0.1 g of DAB powder (Beijing Cooler Technology Co., Ltd.) in 100 mL of deionized water (pH = 5.8) and staining for 8 h in the dark. NBT staining solution was prepared by dissolving 0.05 g of NBT powder (Beijing Cooler Technology Co., Ltd.) in 100 mL of 10 mM phosphate buffer (PBS, pH = 7.6, Beijing Cooler Technology Co., Ltd.) and staining for 3 h in the dark. After staining, the samples were destained with 80% alcohol (Sinopharm Chemical Reagent Co., Ltd.) and finally observed and images were acquired under a stereomicroscope.

[0104] 1.2.8 Statistical Analysis

[0105] To ensure the reliability and reproducibility of the experimental results, at least three biological replicates were performed. Data were statistically analyzed using SPSS Statistics 17.0 software and Excel. The Shapiro-Wilk test was used to assess the normality of the residuals for each group (p > 0.05 was considered to be normally distributed). One-way ANOVA was used if there was only one independent variable; two-way ANOVA was used if two independent variables and their interaction were involved. For the experimental data, the mean ± standard deviation was calculated to represent the average level and range of fluctuation of the data. Duncan's multiple test was used, and p < 0.05 indicated a significant difference. Data graphs were created using tools such as Excel.

[0106] 2. Experimental Results

[0107] To verify the biological function of LbMYB4 in salt gland development, LbMYB4 overexpression and gene silencing vectors were constructed. Through Agrobacterium-mediated genetic transformation, three LbMYB4 overexpression lines (OE-LbMYB4-2, 7, 15) and three virus-induced gene silencing lines (TRV::LbMYB4-3, 6, 7) were obtained. DNA-level identification was performed... Figure 1 A) and RT-qPCR were used to screen positive lines and lines with high silencing efficiency for further research. Figure 1 B, Figure 2 A).

[0108] Phenotypic observation revealed that, compared with the control, the density and number of salt glands in LbMYB4 overexpressing lines were significantly increased. Figure 1 CD), while the number of salt glands in silent strains was significantly reduced ( Figure 2 BC). To observe whether LbMYB4 affects the structure of salt glands, we performed scanning electron microscopy and paraffin section observation on leaf salt glands. The results showed that overexpression of LbMYB4 did not change the external morphology, epidermal cell size, or internal structure of the salt glands. Figure 1 EH). This indicates that LbMYB4 mainly regulates the initiation and differentiation of salt glands, but does not affect their structure.

[0109] LbMYB4 overexpressing and silenced lines were subjected to 200 mM NaCl salt stress for 2 weeks, and related physiological indicators were measured. Figure 3 , Figure 4 This study investigated the contribution of LbMYB4-mediated salt gland development to plant salt tolerance. Regarding growth phenotype, overexpressing lines showed a greater leaf area expansion rate than control lines, while the silenced lines showed the opposite. Figure 3 AB, Figure 4(AB) This indicates that LbMYB4 overexpression significantly enhances the salt tolerance of *Limonium bicolor*, while silencing it reduces its salt tolerance. Further analysis using salt gland secretion assays showed that the salt secretion volume of the LbMYB4-overexpressing lines was significantly greater than that of the control group (AB). Figure 3 CD), while the salt secretion volume of the silent strain was significantly reduced ( Figure 4 CD). The Na content of individual salt glands in each strain was measured. + The secretion rate was found to have not changed significantly. Figure 3 E, Figure 4 E), NMT assay results in the overexpression lines also indicated that Na + The secretion rate was found to have not changed significantly. Figure 3 The presence of FG indicates that LbMYB4 primarily affects overall salt secretion capacity by regulating the number of salt glands rather than the secretory efficiency of individual salt glands.

[0110] Ion steady-state analysis showed that, under 200 mM NaCl treatment, the Na content in the leaves of the overexpression lines decreased. + The content was significantly lower than the control, while K + The content was significantly higher than that of the control ( Figure 5 AB); the silent strains showed the opposite trend ( ). Figure 5 (EF). This result indicates that LbMYB4 overexpression helps maintain ion balance under salt stress and reduces Na+. + Accumulate and promote K + Absorption, thereby alleviating ion toxicity. Osmotic regulation and oxidative damage assessments showed that the overexpression lines accumulated more proline, exhibiting enhanced osmotic regulation, while malondialdehyde (MDA) levels were significantly reduced, alleviating membrane lipid peroxidation damage. Figure 5 CD). Silent strains show the opposite trend ( Figure 5 GH). DAB and NBT staining further confirmed that the overexpressing lines had lower levels of reactive oxygen species accumulation and milder oxidative damage under salt stress, while the silenced lines suffered more severe oxidative damage. Figure 5 These results indicate that LbMYB4 overexpression can enhance the plant's reactive oxygen species scavenging capacity and alleviate oxidative stress damage. This preliminarily reveals the mechanism by which LbMYB4 enhances plant salt tolerance by promoting Na+ oxidative stress reduction. + External discharge, while maintaining K + This helps maintain a stable state, thereby improving the overall salt tolerance of the plant.

[0111] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The LbMYB4 gene of *Limonium bicolor*, characterized in that, It is a gene encoding either protein (a) or (b) as follows: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2; or (b) A protein derived from (a) with one or more amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID NO:2 and having the same function.

2. The LbMYB4 gene of *Limonium bicolor* is characterized by, The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. The LbMYB4 protein of *Hylocereus divaricata*, characterized in that... The amino acid sequence of the protein is shown in SEQ ID NO:

2.

4. A biological material containing the gene LbMYB4 as described in claim 1, wherein the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, or engineered bacteria.

5. The use of the gene LbMYB4 of claim 1 or the biomaterial of claim 4 in the preparation of transgenic plants.

6. Any of the following applications of the gene LbMYB4 of claim 1 or the biomaterial of claim 4: (1) Used to regulate the growth and development of salt glands in halophilic plants; (2) Used to regulate the salt-secreting capacity of halophytes; (3) Used to regulate the stress resistance of halophytes that secrete salts; (4) Used for plant variety improvement; in, The regulation described in (1)-(3) is positive regulation.

7. The application according to claim 6, characterized in that, The plant in question is *Limonium bicolor*.

8. A method for increasing the number of plant salt gland cells and promoting salt gland development, characterized in that, The method is selected from either 1) or 2): 1) To induce the expression of the protein encoded by the LbMYB4 gene of *Limonium bicolor* in plants; 2) Overexpress the LbMYB4 gene of *Limonium bicolor* in plants; Wherein, the LbMYB4 gene of the two-color blood-nourishing herb is as described in claim 1; The overexpression mode is selected from any one of (1) to (5) or a combination thereof: (1) By introducing a plasmid containing the gene; (2) By increasing the copy number of the genes described on the plant chromosomes; (3) By altering the promoter sequence of the genes described on plant chromosomes; (4) By operatively linking a strong promoter to the gene; (5) By introducing enhancers.

9. Any one of the following applications of the transgenic plant obtained by the method according to claim 8: i. Used in plant breeding; ii. Used for planting in saline-alkali land.

Images