Rice blast resistance gene p57ts, protein encoded by the gene and use thereof

Abstract

This invention discloses a gene for resistance to rice blast. Pi57TS Its encoded protein and applications. The rice blast resistance gene... Pi57TS The nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 3. This gene and its alleles... Pi57 In comparison, this gene exhibits a differentiated resistance spectrum against rice blast fungus, making it an excellent resistance gene resource for genetic breeding of rice blast resistance. The resistant rice lines and their progeny seeds obtained through genetic transformation using this gene can be used for conventional sexual hybridization techniques to achieve... Pi57TS Stable transfer and generational transmission of genes in various breeding materials can significantly shorten the breeding cycle and effectively solve the technical bottleneck of linkage burden between target superior genes and unfavorable trait genes in traditional hybridization breeding. Because... Pi57TS Pi57TS It possesses broad-spectrum resistance to rice blast, and new rice varieties bred based on this gene exhibit outstanding disease resistance, making them valuable for large-scale promotion and industrial application.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology and relates to a gene for resistance to rice blast. Pi57TS Its encoded proteins and applications. Background Technology

[0002] Crop diseases are one of the main factors causing crop yield losses. Against the backdrop of continuous global population growth, cultivating disease-resistant crop varieties, stabilizing grain production capacity, and strengthening the food security defense line have extremely strong practical value and strategic significance. Rice, as one of the world's most important food crops, feeds more than half of the world's population. Diseases caused by the rice blast fungus... Magnaporthe oryzae Rice blast, caused by infection, is the most widespread and damaging fungal disease in major rice-producing areas worldwide. Infected fields typically experience yield reductions of 10% to 30%, with severely affected fields suffering total crop failure, significantly hindering the improvement of rice yield and quality. Practical experience shows that breeding and promoting disease-resistant varieties is the most economical, efficient, and environmentally friendly way to control rice blast, and the discovery, analysis, and development of blast-resistant genes are the core foundation for conducting rice disease-resistant breeding.

[0003] Domestic and international research teams have identified and located over 100 rice blast resistance genes from rice germplasm through extensive genetic studies. Nearly half of these genes are concentrated on chromosomes 6, 11, and 12 of rice, either as gene clusters or multiple alleles. More than 30 resistance genes have been cloned. The vast majority of cloned resistance genes encode nucleotide-binding site-leucine repeat (NBS-LRR) structural proteins, which are also the most important protein type in plant resistance genes. However, the rice blast pathogen exhibits high genetic variation and physiological race diversity in the field. The continuous emergence of new pathogenic races easily leads to the rapid degradation and loss of resistance in cultivated varieties, greatly limiting the continued application of existing resistance genes in breeding. At the same time, traditional conventional hybridization breeding has significant technical shortcomings: superior resistance genes are often genetically linked to genes for undesirable agronomic traits, easily leading to linkage baggage; most reported rice blast resistance genes have narrow resistance spectra, making it difficult to simultaneously achieve the breeding goal of high resistance and excellent comprehensive agronomic traits, and the problem of easy loss of varietal resistance has long existed. Therefore, exploring and expanding germplasm resources resistant to rice blast, discovering new resistance genes with broad-spectrum resistance characteristics and applying them to variety breeding are key technical issues that urgently need to be addressed in rice disease resistance breeding.

[0004] With the iterative upgrades of high-throughput sequencing technology, crop genome data has become increasingly abundant, and a large number of functional genes controlling important agronomic traits have been successfully cloned. Allele mining technology based on known disease resistance gene sequences has become a highly efficient method for discovering superior functional alleles. The genus *Oryza* contains 23 species, including 21 wild rice species and 2 cultivated rice species; among them, *Oryza sativa* is related to Asian cultivated rice (…). Oryza sativaWild relatives of the AA genome (L.) include common wild rice, Niwara wild rice, long-male wild rice, short-tongued wild rice, spreading-bristle wild rice, southern wild rice, and African cultivated rice, collectively forming a natural gene pool for improving Asian cultivated rice. Asian cultivated rice can be further divided into tropical japonica rice, temperate japonica rice, indica rice, and... aus and basmati The five subgroups are rich in genetic variation resources.

[0005] Allele mining can not only analyze the genetic evolution of target disease resistance genes and identify the key functional amino acid sites that interact with the avirulence genes of pathogens, but also obtain excellent allelic variations of resistance spectrum differentiation. The discovered disease resistance genes can be introduced into susceptible rice materials through gene aggregation to directionally improve the comprehensive disease resistance of varieties, or new broad-spectrum resistance genes can be created by fusing different resistance spectrum alleles, significantly improving the efficiency of disease resistance breeding.

[0006] This study identified and obtained resistance-resistant genetically modified rice germplasm TIEN SOM through sequence analysis, gene amplification, genetic transformation, and transgenic plant resistance identification. Pi57 A novel functional allele of the gene, named Pi57TS Based on current technological searches, there are currently no results. Pi57TS Publicly available reports on rice blast resistance gene sequences and related applications. Summary of the Invention

[0007] To address the above technical problems, this invention provides a gene for resistance to rice blast. Pi57TS Its encoded proteins and applications.

[0008] The technical solution of the present invention is as follows: A gene for resistance to rice blast Pi57TS The aforementioned rice blast resistance gene Pi57TS The nucleotide sequence is shown in SEQ ID NO: 1.

[0009] This invention also protects the rice blast resistance gene. Pi57TS The cDNA coding region sequence, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0010] This invention also protects the rice blast resistance gene. Pi57TS The encoded protein, the rice blast resistance gene Pi57TS The amino acid sequence encoding the protein is shown in SEQ ID NO: 3.

[0011] This invention also protects the aforementioned rice blast resistance gene. Pi57TS The preparation method uses the genomic DNA of the disease-resistant parent rice variety TIEN SOM as a template, according to... Pi57TSGene-specific primers were designed based on allele sequence information, and the gene was amplified by PCR. After amplification, the fragment was detected by 1% agarose gel electrophoresis, recovered, and sequenced for verification, yielding the rice blast resistance gene as shown in SEQ ID NO: 1. Pi57TS The base sequence of the forward primer of the specific primer is shown in SEQ ID NO: 4: GGTGTTTAGCGGAGGAAGGATCG and the base sequence of the reverse primer is shown in SEQ ID NO: 5: ATCAAGAGATACAACACGCGTTGGGA.

[0012] Furthermore, the PCR amplification was performed using PrimeSTAR. ® GXL DNA Polymerase, amplification system of 25 μL, including 5×PrimeSTAR ® GXL Buffer 5 μL, dNTP Mixture (2.5 mM each) 2 μL, forward primer 1 μL, reverse primer 1 μL, 50 ng / μL template DNA 1 μL, PrimeSTAR ® 0.5 μL of GXL DNA Polymerase was added, and the remainder was made up to 25 μL with Milli-Q sterile ultrapure water. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 98℃ for 10 s, and 68℃ annealing extension for 10 min, for a total of 30 cycles.

[0013] The rice blast resistance gene can also be directly synthesized using DNA chemical synthesis methods based on the nucleotide sequence disclosed in this paper. Pi57TS .

[0014] This invention also protects a gene for resistance to rice blast. Pi57TS The method for preparing the cDNA coding region sequence involves using reverse transcribed cDNA from the disease-resistant parent rice variety TIEN SOM as a template, and performing PCR amplification with specific primers to obtain the cDNA sequence shown in SEQ ID NO: 2. Pi57TS The cDNA coding region sequence, the forward primer of the specific primer is shown in SEQ ID NO: 4, and the reverse primer is shown in SEQ ID NO: 5.

[0015] This invention also protects the aforementioned rice blast resistance gene. Pi57TS Or the rice blast resistance gene prepared by the method described above. Pi57TS Applications in breeding rice varieties resistant to rice blast and in the detection of rice blast resistance.

[0016] Furthermore, the aforementioned rice blast resistance gene... Pi57TSThe cDNA coding region sequence fragment was transferred into rice varieties susceptible to rice blast to obtain transgenic rice plants with rice blast resistance; the transgenic rice plants can stably inherit the resistance gene and have broad-spectrum resistance to rice blast strains.

[0017] This invention also protects a method utilizing the aforementioned rice blast resistance gene. Pi57TS The method for cultivating rice resistant to rice blast includes the following steps: S1 was obtained by amplification using specific primers with cDNA from the disease-resistant rice variety TIEN SOM as a template. Pi57TS The cDNA coding region sequence fragment of the gene; the specific primers are vector-specific primers, the forward primer is shown in SEQ ID NO: 6, and the reverse primer is shown in SEQ ID NO: 7; S2 construct contains rice blast resistance gene Pi57TS Plant expression vectors, using Asc I and Bam The vector PU1301 was double-digested with HI, the linearized vector fragment was recovered, and then combined with the amplified and purified... Pi57TS The cDNA coding region sequence fragment was seamlessly cloned and ligated to obtain a recombinant plant expression vector; S3 uses Agrobacterium-mediated genetic transformation to transfer the plant expression vector into a susceptible rice recipient variety to obtain transgenic plants; S4 uses the gene-specific primers to perform PCR identification on transgenic plants and screens positive plants; the specific primers are: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 8: ACACTACATGGCGTGATTTCAT, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9: TCCACTATCGGCGAGTACTTCT. S5 was obtained by continuous self-pollination of positive, disease-resistant plants to obtain homozygous carriers. Pi57TS Rice lines with resistance genes and stable resistance to rice blast.

[0018] Compared with the prior art, the present invention has the following beneficial technical effects: 1. The resistance gene of this invention Pi57TS Alleles at this locus Pi57 It exhibits different resistance spectrum characteristics against rice blast fungus, representing a novel rice blast resistance gene and an excellent resistance source for rice blast resistance breeding.

[0019] 2. Utilizing the rice blast resistance gene provided by this invention Pi57TSThis gene can be introduced into susceptible rice varieties using genetic transformation technology, enabling the targeted creation of new rice germplasm and varieties resistant to rice blast. Cloning this resistance gene overcomes the technical bottleneck of gene exchange and transfer between species in traditional breeding. Through genetic engineering transformation, not only can the breeding cycle be significantly shortened, but the breeding difficulties caused by the linkage and burden between superior target genes and undesirable trait genes in traditional breeding can also be avoided. The disease-resistant rice plants and their offspring seeds obtained through gene transformation according to this invention can be used for conventional sexual hybridization to achieve… Pi57TS Stable transfer and generational inheritance of rice blast resistance genes into breeding materials. Given... Pi57TS It possesses broad-spectrum resistance to rice blast, and new rice varieties bred using this gene exhibit excellent disease resistance, making them suitable for large-scale planting and industrial application. Attached Figure Description

[0020] Figure 1 For rice Pi57TS Electrophoresis diagram of T0 generation plants with gene overexpression: Lane M represents the molecular marker DL2000, and lanes 1-15 represent plants transformed with PU1301- Pi57TS Using genomic DNA from different T0 generation transgenic plants as templates, hygromycin gene markers were selected for screening. hpt The amplified PCR products are shown in lanes 16, 17, and 18. Lane 18 contains the DNA amplification results of the transformed recipient rice resistance single-gene line IRBLks-F5. Pi57TS plasmid PU1301- Pi57TS Amplification results used as a positive control; Figure 2 The images show the phenotypic and molecular identification results of the transgenic plants. The transgenic positive plants (T0 generation) and the transgenic susceptible recipient rice resistance single-gene line IRBLks-F5 (containing the rice blast resistance gene) were inoculated with rice blast fungus 09BSH-10-5A. Pik- s Phenotypic response diagrams and corresponding molecular identifications of the blast-resistant rice variety TIEN SOM and its donor rice variety. Numbers 1-15 are related to... Figure 1 The numbers correspond to leaves of different transgenic T0 generation plants. Number 16 represents a leaf of the IRBLks-F5 rice resistance single-gene line, a variety transformed from a susceptible recipient. Number 17 represents a leaf of the rice blast resistance gene. Pi57TS The leaves of the resistance donor variety TIEN SOM showed that varieties 2, 5, and 14 were susceptible to the disease, varieties 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, and 15 were resistant, variety 16 (IRBLks-F5) was susceptible to the disease, and variety 17 (TIEN SOM) was resistant to the disease. Figure 3This is a diagram illustrating the co-segregation analysis of transgenic T1 generation plants inoculated with rice blast fungus 09BSH-10-5A. Figure 3 In section a, TIEN SOM is a leaf of a resistant donor rice variety containing the blast resistance gene Pi57TS (number 2), IRBLks-F5 is a leaf of a susceptible recipient transformed variety (number 3), and the T1 generation transgenic plants are 12 different T1 generation transgenic single plants (numbered 4-15). Among them, the resistant donor variety TIEN SOM (number 2) showed a disease resistance response, the transgenic recipient variety IRBLks-F5 (number 3) showed a disease susceptibility response, and the transgenic plants numbered 4-5 are transgenic... Pi57TS T1 represents the leaves of currently infected plants, and numbers 7-15 are genetically modified. Pi57TS T1 represents the leaves of plants that are currently resistant to the disease; Figure 3 b shows the amplification results using gene-specific primers (SEQ ID NO: 10 and SEQ ID NO: 11), with a fragment length of 470 bp. Fragment number 1 carries the rice blast resistance gene. Pi57TS The gene plasmid PU1301- Pi57TS As positive controls, numbers 2-15 are used as comparisons with... Figure 1 The corresponding results of plant amplification. Detailed Implementation

[0021] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] Biomaterials involved in the examples: The rice resistance monogenic line IRBLks-F5 is disclosed in the non-patent literature "Tsunematsu et al. Development of monogenic lines of rice for blast resistance. Breeding Science, 2000, 50: 229-234", and holds [a patent / license]. Pik-s Gene.

[0024] The PU1301 vector and reagents involved in the examples are all commercially available, while the rice variety TIEN SOM and the single-spore strain of rice blast fungus 09BSH-10-5A are preserved in units.

[0025] The susceptible control variety, Lijiang Xintuanheigu (abbreviated as LTH), is a local variety sold in Yunnan.

[0026] The rice resistance donor variety TIEN SOM is disclosed in the non-patent literature “Wang et al. Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature, 2018, 557: 43–49 (Supplementary Data 1)”.

[0027] The rice resistance monogenic line IRBLta2-Pi was disclosed in the non-patent literature "Tsunematsu et al. Development of monoigenic lines of rice for blast resistance. Breeding Science, 2000, 50: 229-234", and is held by [the relevant authority]. Pita-2 Gene.

[0028] Rice introgression line IL-E1454: In the non-patent literature "Dong et al. Fine mapping of Pi57 (t)conferring broad spectrum resistance against Magnaporthe oryzae inintrogression line IL-E1454 derived from Oryza longistaminata . PLOS ONE, 2017, 12(10): e0186201; Xu et al. Identification and mapping of a novel blastresistance gene Pi57 (t) in Oryza longistaminata "Euphytica, 2015, 205(1): 95-102." This report discloses that the rice introgression line IL-E1454 carries a gene for resistance to rice blast. Pi57 .

[0029] Rice blast strains CH0999, CH1019, CH1419, 2011-1-11-2, and 08-9-3a-1 are disclosed in the non-patent literature “Pathogenicity analysis and mating type distribution of rice blast fungus populations in Yunnan Province, Journal of Plant Protection, 2023, 50(2): 316-324”.

[0030] strain HN09-1C-7 is mentioned in the non-patent literature "Xu et al. Identification and mapping of anovel blast resistance gene". Pi57 (t) in Oryza longistaminata Euphytica, 2015, 205(1): 95-102.

[0031] Rice blast strain 09BSH-10-5A is mentioned in the non-patent literature "Dong et al. Identification and finemapping of Pi69 (t), a new gene conferring broad-spectrum resistance against Magnaporthe oryzae from Oryza glaberrima Steud. Frontiers in Plant Science. 2020, 11: 1190.” Published.

[0032] Rice blast fungus Y363 is mentioned in non-patent literature "Liu Shufang et al., holding..." Pi9 Differences in resistance of the single-gene rice line IRBL9-W to rice blast fungus at seedling and adult stages. Chinese Journal of Rice Science, 2021, 35(3): 303-310”.

[0033] The above-mentioned rice biological materials include: rice variety TIEN SOM, rice resistance single-gene line IRBLks-F5, and rice resistance single-gene line IRBLta2-Pi. Pi57TS -T2-6, rice infiltration line IL-E1454, and rice blast strains: CH0999, CH1419, 2011-1-1-11-2, 08-9-3a-1, HN09-1C-7, 09BSH-10-5A, CH1019, and Y363 are kept by the applicant's research group. The applicant's contact address is: Institute of Agricultural Environment and Resources, Yunnan Academy of Agricultural Sciences, No. 2238 Beijing Road, Panlong District, Kunming, Yunnan Province, 650205, China.

[0034] Example 1 Gene Pi57TS Amplification and Analysis

[0035] 1.1 Pi57TS Obtaining genomic DNA The inventor based on the cloned Pi57 Based on the genome and cDNA sequence of the gene, a pair of specific primers were designed to amplify the full-length coding region sequence of the allele. The base sequence of the forward primer is shown in SEQ ID NO: 4: GGTGTTTAGCGGAGGAAGGATCG, and the base sequence of the reverse primer is shown in SEQ ID NO: 5: ATCAAGAGATACAACACGCGTTGGGA. These primers were used for allele amplification analysis. PCR amplification was performed using the long-chain high-fidelity enzyme PrimeSTAR. ® The amplification reaction was performed using GXL DNA Polymerase in a 25 μL volume, specifically consisting of 5×PrimeSTAR... ® GXL Buffer 5 μL, dNTP Mixture (2.5 mM each) 2 μL, forward primer (10 μM) 1 μL, reverse primer (10 μM) 1 μL, PrimeSTAR ® 0.5 μL (0.625 U) of GXL DNA Polymerase, 1 μL (50 ng / μL) of DNA template, and finally Milli-Q sterile ultrapure water to a final volume of 25 μL were added. The PCR reaction conditions were: 95℃ pre-denaturation for 3 min, followed by 30 cycles of amplification at 98℃ for 10 s and 68℃ for 10 min. After the PCR reaction, the PCR products were electrophoresed on a 1% agarose gel and sent to a sequencing company for sequencing. The alleles of the rice variety TIEN SOM were finally obtained. Pi57TS The DNA sequence is shown in SEQ ID NO: 1.

[0036] 1.2 Genes Pi57TS Obtaining the cDNA coding region sequence Total RNA was extracted from the young leaves of rice seedlings of the TIEN SOM variety after they reached the 4-leaf stage; and further RNA was extracted using a kit (PrimeScript). TM Using 2 μg of total RNA as a template, the TIEN SOM rice variety TIEN 1OM was reverse transcribed according to the kit's instructions to obtain its first-strand cDNA.

[0037] Using the aforementioned forward primer SEQ ID NO: 4 and reverse primer SEQ ID NO: 5, PCR amplification was performed to obtain... Pi57TS The cDNA coding region sequence of a gene; Pi57TSThe cDNA coding region sequence is shown in SEQ ID NO: 2, with a sequence length of 2568 bp. The long-chain high-fidelity enzyme PrimeSTAR was used. ® GXL DNA Polymerase was used for amplification. The PCR amplification reaction conditions were as follows: 25 μL of PCR amplification reaction system containing 5× PrimeSTAR... ® GXL Buffer 5 μL, dNTP Mixture (2.5 mM each) 2 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, first-strand cDNA template obtained from reverse transcription 1 μL, PrimeSTAR ® 0.5 μL (0.625 U) of GXL DNA Polymerase and 14.5 μL of ddH2O were used for PCR amplification. The reaction conditions were: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, and 68℃ extension for 3 min, for a total of 30 cycles; and a final extension at 72℃ for 5 min.

[0038] Electrophoresis detection: 3 μL of the PCR amplification product was electrophoresed on a 1% agarose gel to confirm whether the PCR product was amplified and whether the size of the amplified fragment was as expected. The PCR amplification product fragment length was 2592 bp; the sequence is shown in SEQ ID NO: 12. Pi57TS The gene cDNA coding region is 2568 bp in length, and its sequence is shown in SEQ ID NO: 2. The fragment size is consistent with the experimental expectation, indicating that this experiment successfully obtained cDNA from the rice variety TIEN SOM. Pi57TS Complete cDNA coding region sequence of the gene.

[0039] The gene can also be directly synthesized using DNA chemical synthesis methods based on its nucleotide sequence to obtain the rice blast resistance gene. Pi57TS or Pi57TS The cDNA coding region sequence of a gene.

[0040] 1.3 Genes Pi57TS Sequence analysis pass Pi57TS cDNA coding region sequence and Pi57TS Comparative analysis of genome sequences, Pi57TS The coding region of the genome sequence contains two introns and three exons: exon 1 is located at 1–262 bp, exon 2 at 6755–8681 bp, and exon 3 at 8999–9401 bp; Pi57TS In the cDNA sequence, the gene Pi57TSThe cDNA coding region sequence length is 2568 bp (24~2591 bp), gene Pi57TS It encodes a protein consisting of 855 amino acids, the amino acid sequence of which is shown in SEQ ID NO: 3.

[0041] Example 2: Rice blast resistance gene Pi57TS Genetic transformation complementation verification experiment

[0042] 1. Rice blast resistance gene Pi57TS amplification of the cDNA coding region sequence Total RNA was extracted from the 4-leaf stage leaves of the disease-resistant parent rice variety TIEN SOM, and first-strand cDNA was obtained by reverse transcription. Using the obtained cDNA as a template, according to... Pi57TS Gene-specific primers are designed using allele sequence information, and restriction endonucleases are added to the primer sequences. Asc I restriction enzyme site and Bam The HI restriction site was used for PCR amplification to obtain the rice blast resistance gene. Pi57TS The specific primers Pi57TSCDS-AscI-Fw (whose base sequence is shown in SEQ ID NO: 6: GCCGGTACCGGCGCGCCGGTGTTTAGCGGAGGAAGGATCG) and Pi57TSCDS-BamHI-Rv (whose base sequence is shown in SEQ ID NO: 7: GGACTCTAGAGGATCCATCAAGAGATACAACACGCGTTGGGA).

[0043] Using the long-chain high-fidelity enzyme PrimeSTAR ® Amplification was performed using GXL DNA Polymerase. The PCR amplification reaction conditions were as follows: 25 μL of PCR amplification reaction mixture was used, containing 5× PrimeSTAR... ® GXL DNA Polymerase 0.5 μL (0.625 U), GXL Buffer 5 μL, dNTP Mixture (2.5 mM each) 2 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, first-strand cDNA template obtained from reverse transcription 1 μL, PrimeSTAR ® 0.5 μL (0.625 U) of GXL DNA Polymerase and 14.5 μL of ddH2O were used for PCR amplification. The reaction conditions were: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, and 68℃ extension for 3 min, for a total of 30 cycles; and a final extension at 72℃ for 5 min.

[0044] Electrophoresis detection: Take 3 μL of PCR amplification product and perform electrophoresis on a 1% agarose gel to confirm whether the PCR product has been amplified and whether the size of the amplified fragment is the expected fragment.

[0045] 2. Genes Pi57TS Construction of genetic transformation vectors 2.1 Preparation of target fragments and vectors The PCR amplification products with confirmed fragment sizes were electrophoresed on a 1% agarose gel, then excised and the fragments were recovered using a kit to obtain purified fragments. Pi57TS The target gene fragment is measured for DNA concentration and then stored at low temperature for later use.

[0046] Using NEB (NEB Corporation) restriction endonucleases Asc I and Bam The PU1301 vector (commercially available) was subjected to double enzyme digestion using HI. The digestion method is as follows: enzyme digestion buffer (rCutSmart) TM 5 μL, PU1301 vector 4 μL (~500 ng), restriction endonuclease Asc I 1μL, restriction endonuclease Bam Add 1 μL of HI and double-distilled water to make up to 50 μL of reaction solution. Digest at 37℃ for 60 min. Then, after 1% agarose gel electrophoresis, the gel containing the linearized vector is excised and the fragment is purified using a gel extraction kit to obtain the enzyme containing... Asc I and Bam HI double digestion of linearized PU1301 vector;

[0047] 2.2 Ligation reaction and cloning: The fragment and vector were ligated and transformed using the In-Fusion HD Cloning Kit from Takara Bio USA. The specific method is as follows: 10 μL reaction system containing 135 ng of linearized PU1301 vector fragment and purified... Pi57TS 50 ng of the target gene fragment was added to 2 μL of 5X In-Fusion HD Enzyme Premix, and the volume was increased to 10 μL with double-distilled water. The ligation reaction was then performed at 50℃ for 15 min. The ligation product was then precipitated with anhydrous ethanol, eluted once with 70% ethanol, and dissolved in ddH2O. The ligation product was electroporated into *E. coli* DH10B competent cells, plated, and screened to obtain positive clones (PU1301-). Pi57TSAfterwards, sequencing analysis was performed to verify the correctness of the sequence.

[0048] 3. Genetic transformation of rice callus and acquisition of transgenic plants Agrobacterium-mediated genetic transformation was employed (Hiei Y, Ohta S, Komari T, et al. Efficient transformation of rice ( Oryza sativa L.) mediated by Agrobacterium andsequence analysis of the boundaries of the T-DNA. The Plant Journal, 1994, 6: 271-282). Pi57TS Genetic transformation experiments will involve using genes carrying the target gene. Pi57TS The overexpression vector PU1301- Pi57TS The bacteria were transformed into Agrobacterium strain EHA105, and the callus tissue of the rice resistance single gene line IRBLks-F5, a recipient rice variety susceptible to rice blast, was further infected with Agrobacterium. After co-culture, resistance screening, differentiation and rooting culture, T0 generation transgenic rice plants were obtained.

[0049] 4. Molecular identification of transgenic plants The obtained T0 generation transgenic plants were treated with the hygromycin gene ( hpt Specific primers were used for molecular identification, and rice blast fungus 09BSH-10-5A was used for inoculation to identify resistance. The identified transgenic plants were then self-pollinated to obtain T1 generation seeds.

[0050] DNA was extracted from the leaves of transgenic T0 generation plants as a template, and then... hpt PCR molecular identification was performed using specific primer pairs (hptFw / hptRv). hpt The base sequence of the forward primer hptFw of the specific primer is shown in SEQ ID NO: 8: ACACTACATGGCGTGATTTCAT. hptThe base sequence of the reverse primer hptRv, the specific primer, is shown in SEQ ID NO: 9: TCCACTATCGGCGAGTACTTCT. The total PCR reaction volume was 20 µL, containing 10 µL of 2X ES Taq Master Mix, 1 µL (10 µM) each of the forward and reverse primers, 1 µL (10 ng) of genomic DNA extracted from the transgenic plant, and double-distilled sterile water to a final volume of 20 µL. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, followed by a final extension at 72℃ for 7 min. After PCR amplification, 3 µL of the PCR product was electrophoresed on a 1% agarose gel (120 V, 40 min, Dured staining). The electrophoretic pattern was observed using a gel imaging system to identify transgenic positive plants. The PCR amplification product was 557 bp in size, and the molecular identification electrophoresis results are shown in Figure 1.

[0051] To verify the association between the resistance and susceptibility phenotypes and genotypes of transgenic T1 generation disease-resistant plants, a pair of primers (PU1301SPFw and Pi57SPRv) were designed based on the PU1301 vector backbone sequence and target gene sequence for genotype identification of transgenic materials overexpressing the PU1301 vector. PU1301SPFw (CCATTTACGAACGATAGCCGGT, SEQ ID NO: 10) is located on the vector backbone sequence, while Pi57SPRv (GTAGAGCAGGAACAGCGGACAC, SEQ ID NO: 11) is a conserved sequence shared by alleles of the rice blast resistance gene, which can specifically amplify the target gene cloned into the PU1301 vector. Pi57TS DNA was extracted from the leaves of transgenic T1 generation plants as a template for PCR amplification and identification. The total PCR reaction volume was 20 µL, containing 10 µL of 2X ES Taq Master Mix, 1 µL (10 µM) of forward and reverse primers, 1 µL (10 ng) of genomic DNA extracted from the transgenic plants, and double-distilled sterile water to a final volume of 20 µL. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, followed by a final extension at 72℃ for 7 min. After PCR amplification, 3 µL of the PCR product was electrophoresed on a 1% agarose gel (120 V, 40 min, Dured staining). The gel image was observed using a gel imaging system to identify transgenic positive plants. The primer amplification product was 470 bp after PCR amplification identification.

[0052] Electrophoresis images of T0 generation transgenic plants are shown below. Figure 1 Lanes 1-15 used hygromycin gene-specific primers (hptFw / hptRv) to amplify the transgenic T0 generation plants, resulting in 15 positive plants with the 557 bp target fragment. Lane 16 served as a water-based blank control (no 557 bp band amplified). Lane 17 represented the transgenic recipient rice resistance single-gene line IRBLks-F5 (no 557 bp band amplified). Lane 18 represented a plant cloned with the gene... Pi57TS plasmid PU1301- Pi57TS As a positive control, a 557 bp target fragment was amplified.

[0053] 5. Identification of resistance in transgenic plants Fifteen T0 generation transgenic plants were inoculated with rice blast fungus 09BSH-10-5A. The results showed that... Figure 1 Of the 15 transgenic positive plants, 12 (numbered 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, and 15) showed resistance, and 3 showed susceptibility (numbered 2, 5, and 14). The resistance donor variety TIEN SOM showed resistance, while the transgenic recipient variety, the rice resistance single-gene line IRBLks-F5 (numbered 16), showed susceptibility. Figure 2 ).

[0054] Seeds of the T1 generation were obtained by propagating disease-resistant transgenic plants. After sowing, the seeds were inoculated with rice blast fungus 09BSH-10-5A at the 3.5-leaf stage. The results showed that... Figure 3 Plants exhibiting susceptible or resistant phenotypes in group a, and Figure 3 Does b carry Pi57TS The molecular identification results of the gene correspond to, i.e., not holding. Pi57TS The T1 generation plants (numbered 4-6) of the gene showed susceptibility to the disease, while those holding the gene... Pi57TS The T1 generation plants (numbered 7-15) of the gene exhibited disease resistance, indicating that they possessed the gene. Pi57TS Plants carrying the gene exhibit disease resistance, while plants lacking the gene are susceptible. The cosegregation of genotype and phenotype indicates this. Pi57TS It is a gene with disease resistance function (see results). Figure 3 ).

[0055] In summary, regarding the T0 conversion... Pi57TS Plants carrying the gene were inoculated with rice blast fungus 09BSH-10-5A for identification. The results showed that most positive plants exhibited resistance, while some showed susceptibility. Further co-segregation analysis of resistance phenotype and genotype was performed on T1 generation plants obtained from self-pollinating T0 generation plants that showed resistance. The results indicated that... Pi57TSPlants carrying the gene (producing the target band via PCR) all exhibited disease resistance, while plants not carrying the gene (producing no amplified band) all showed susceptibility. The disease resistance phenotype was consistent with that of exogenous plants. Pi57TS The PCR amplification results of the gene showed complete cosegregation, indicating that the disease resistance of the T1 generation plants was derived from the integration of the gene into the genome. Pi57TS Gene-mediated, demonstrating that the gene was successfully expressed and conferred resistance to rice blast fungus 09BSH-10-5A in plants. Pi57TS The gene is a functional gene that controls the resistance of rice to rice blast fungus 09BSH-10-5A, and this resistance trait can be stably inherited.

[0056] Example 3 Pi57TS Gene resistance spectrum assay For analysis Pi57TS Its alleles Pi57 and Pita-2 Whether they are the same, the resistant donor parent TIEN SOM and the transgenic T2 generation... Pi57TS Homozygous single plants Pi57TS-T2-6, IL-E1454, IRBLta2-Pi, IRBLks-F5, and the susceptible control variety LTH were sown, and then inoculated with eight strains of rice blast fungus for identification. The identification results are shown in Table 1. Among them, Pi57TS-T2-6 was cloned into the overexpression vector PU1301 through Agrobacterium-mediated genetic transformation using the same method of this invention. Pi57TS Genes were introduced into the susceptible rice resistance single-gene line IRBLks-F5, and homozygous carriers were obtained after continuous self-pollination and resistance phenotype identification. Pi57TS The genetically modified material is stored in our research group's laboratory.

[0057] The results showed that Pi57TS , Pi57 and Pita-2 The gene pair showed different resistance responses to the eight inoculated strains, which could be distinguished by their resistance or susceptibility responses, indicating that... Pi57TS This is a novel gene for resistance to rice blast. The resistance and susceptibility responses of different genes to eight strains are shown in Table 1.

[0058] Table 1 Pi57TS , Pi57 and Pita-2 Gene resistance spectrum analysis against 8 rice blast strains

[0059] Note: R indicates resistance response, S indicates susceptibility response.

[0060] The results showed that carrying Pi57TSThe TIEN SOM gene and the transgenic line Pi57TS-T2-6 exhibited completely consistent disease resistance spectra, both showing resistance to six strains: 09BSH-10-5A, 2011-1-1-11-2, HN09-1C-7, 08-9-3a-1, CH1019, and Y363, and susceptibility to CH1419 and CH0999. Their resistance spectra were consistent with those of strains holding the TIEN SOM gene. Pi57 IL-E1454 of the gene and its holder Pita-2 The significant differences in IRBLta2-Pi indicate that Pi57TS This is a novel functional allele with a different resistance spectrum. The recipient rice variety, the single-gene line IRBLks-F5, and the susceptible control LTH both showed susceptibility to all strains, demonstrating... Pi57TS The gene is the key gene determining resistance to rice blast in donor materials, and its resistance spectrum is similar to that reported. Pi57 Significant differences exist in genes, indicating Pi57TS It has unique disease resistance specificity.

Claims

1. A gene for resistance to rice blast Pi57TS Its characteristics are, The aforementioned rice blast resistance gene Pi57TS The nucleotide sequence is shown in SEQ ID NO:

1.

2. The rice blast resistance gene as described in claim 1 Pi57TS Its characteristics are, The rice blast resistance gene Pi57TS The cDNA coding region sequence is shown in SEQ ID NO:

2.

3. A gene for resistance to rice blast Pi57TS The encoded protein is characterized by: The rice blast resistance gene Pi57TS The amino acid sequence encoding the protein is shown in SEQ ID NO:

3.

4. The rice blast resistance gene as described in claim 1 Pi57TS The preparation method is characterized by: Using the genomic DNA of the disease-resistant parent rice variety TIEN SOM as a template, according to Pi57TS Gene-specific primers were designed based on allele sequence information, and the gene was amplified by PCR. After amplification, the fragment was detected by 1% agarose gel electrophoresis, recovered, and sequenced for verification, yielding the rice blast resistance gene as shown in SEQ ID NO:

1. Pi57TS The base sequence of the forward primer of the specific primer is shown in SEQ ID NO:4 and the base sequence of the reverse primer is shown in SEQ ID NO:

5.

5. The preparation method according to claim 4, characterized in that: The PCR amplification was performed using PrimeSTAR. ® GXLDNA Polymerase, amplification system of 25 μL, including 5×PrimeSTAR ® GXL Buffer 5 μL, dNTP Mixture (2.5 mM each) 2 μL, forward primer 1 μL, reverse primer 1 μL, 50 ng / μL template DNA 1 μL, PrimeSTAR ® Add 0.5 μL of GXL DNA Polymerase and make up the rest with Milli-Q sterile ultrapure water to a final volume of 25 μL. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 98℃ for 10 s, 68℃ annealing extension for 10 min, for a total of 30 cycles.

6. A gene for resistance to rice blast Pi57TS The method for preparing cDNA coding region sequences is characterized by: Using the reverse transcribed cDNA of the disease-resistant parent rice variety TIEN SOM as a template, PCR amplification was performed using specific primers to obtain the cDNA shown in SEQ ID NO:

2. Pi57TS The cDNA coding region sequence, the forward primer sequence of the specific primer is shown in SEQ ID NO: 4, and the reverse primer sequence is shown in SEQ ID NO:

5.

7. The rice blast resistance gene as described in any one of claims 1-2 Pi57TS Or, the rice blast resistance gene prepared using the preparation method described in any one of claims 4-5. Pi57TS Applications in breeding rice varieties resistant to rice blast and in the detection of rice blast resistance.

8. The application as described in claim 7, characterized in that: The rice blast resistance gene described in claim 2 Pi57TS The cDNA coding region sequence was transferred into rice varieties susceptible to rice blast to obtain transgenic rice plants with rice blast resistance; the transgenic rice plants can stably inherit the resistance gene and have stable resistance to rice blast strains.

9. A method utilizing the rice blast resistance gene of claim 1 Pi57TS The method for cultivating rice resistant to rice blast includes the following steps: S1 was obtained by amplification using specific primers with cDNA from the disease-resistant parent rice variety TIEN SOM as a template. Pi57TS Amplified fragment of gene cDNA coding region sequence; the specific primers are vector-specific primers, the forward primer is shown in SEQ ID NO: 6, and the reverse primer is shown in SEQ ID NO: 7; S2 construct contains rice blast resistance gene Pi57TS Plant expression vectors, using Asc I and Bam The vector PU1301 was double-digested with HI, the linearized vector fragment was recovered, and then combined with purified... Pi57TS The amplified cDNA coding region sequence fragment was seamlessly cloned and ligated to obtain a recombinant plant expression vector; S3 uses Agrobacterium-mediated genetic transformation to transfer the plant expression vector into a susceptible rice recipient variety to obtain transgenic plants; S4 uses the specific primer pair described above to perform PCR identification on transgenic plants and screen for positive plants; the specific primer pair is as follows: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9; S5 was obtained by continuous self-pollination of positive, disease-resistant plants to obtain homozygous carriers. Pi57TS Rice lines with resistance genes and stable resistance to rice blast.

Images