Chloris virgata salt-tolerant CvNC1 gene, molecular marker and application

Abstract

This invention provides a salt-tolerant tiger tail grass CvNC1 Genes, molecular markers, and their applications belong to the field of molecular breeding technology. The described *Tigertail* grass is salt-tolerant. CvNC1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, which encodes an HKT transporter protein, the amino acid sequence of which is shown in SEQ ID NO.2. This transporter protein has Na+... + This study enhanced the absorption activity and significantly improved the salt tolerance of Arabidopsis thaliana. Furthermore, a 132-bp insertion variation was observed in the promoter of this candidate gene, significantly increasing the transcriptional level and reducing Na+ absorption in the upper part of *Arabidopsis thaliana*. + Accumulation of this mutation regulates the plant's salt stress adaptation. This variation is significantly linked to salt tolerance in *Hypericum esculentum* and can serve as a molecular marker for assessing salt tolerance in *Hypericum esculentum*. Furthermore, this mutant promoter can be used to enhance the expression of its wheat homolog, TaHKT1,5-D, in the stele tissue and improve wheat salt tolerance.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, and specifically relates to a salt-tolerant variety of *Gnaphalium affine*. CvNC1 Genes, molecular markers, and applications. Background Technology

[0002] Global climate change and improper human management have exacerbated soil salinization, severely hindering sustainable agricultural development. According to FAO statistics, the global area of ​​saline soils has reached 1.381 billion hectares, covering more than 100 countries and regions, resulting in crop yield losses exceeding 70%. Salt stress causes soil moisture imbalances, making it difficult for plants to absorb water, while also causing ion toxicity, oxidative damage, and nutrient deficiencies, severely reducing crop yield and quality. Therefore, identifying key salt-tolerant genes and cultivating new salt-tolerant varieties is not only an urgent need to ensure food security but also a crucial pathway to maintaining sustainable agricultural development.

[0003] Plants adapt to salt stress mainly through an early osmotic stress stage and a later ion toxicity stage. Salt stress leads to a decrease in soil water potential, which hinders root water absorption and causes osmotic stress. Plants then absorb excess sodium. + and Cl - The plant first uses inorganic salts to balance the osmotic pressure, and then synthesizes organic substances such as osmotic regulators to balance the osmotic pressure. Simultaneously, excess Na+ accumulates in the plant tissue. + and Cl - Toxic ions inhibit plant growth. The SOS signaling pathway and HKT1 family proteins in plants have been widely reported to participate in root Na+ production. + External drainage, segregation, and long-distance transport enhance the salt tolerance of plants. For example, in wheat... TaHKT1,5-D Encoding a Na+ localized in the plasma membrane + Selective transport proteins, by transporting Na+ in xylem sap... + Unloading into surrounding thin-walled cells reduces Na+. + Long-distance transport to the aboveground parts of the plant reduces leaf sodium. + Accumulates and enhances salt tolerance. Tiger tail grass ( Chloris virgata *Gnaphalium affine*, an annual herbaceous plant of the Poaceae family, is one of the main forage grasses in saline-alkali areas of my country. It possesses extremely strong salt and alkali tolerance and environmental adaptability, making it an ideal material for research on salt tolerance genes and molecular mechanisms. Currently, research on the salt tolerance mechanism of *Gnaphalium affine* mainly focuses on physiological aspects, while its key salt tolerance genes and molecular mechanisms of salt stress adaptation remain to be elucidated. Therefore, cloning the major QTL gene for salt tolerance in *Gnaphalium affine*, developing molecular markers for screening salt-tolerant *Gnaphalium affine* germplasm, and successfully applying excellent promoters to improve wheat salt tolerance are of great significance for accelerating the screening of salt-tolerant Poaceae forage germplasm and improving crop salt tolerance. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a salt-tolerant tiger tail grass. CvNC1 Genes, molecular markers, and applications.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a salt-tolerant tiger tail grass CvNC1 Genes, the ones mentioned CvNC1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0006] The present invention also provides the salt-tolerant tiger tail grass. CvNC1 A gene-encoded protein, the amino acid sequence of which is shown in SEQ ID NO. 2.

[0007] The present invention also provides the salt-tolerant tiger tail grass described above. CvNC1 Application of genes in improving plant salt tolerance: Overexpression of salt tolerance in *Gnaphalium affine* CvNC1 Genes enhance the salt tolerance of plants.

[0008] Preferably, the plants include Arabidopsis thaliana and wheat.

[0009] The present invention also provides a primer pair for amplifying the salt tolerance molecular marker of *Gnaphalium affine*, the primer pair comprising Ins-272-F and Ins-272-R, the nucleotide sequences of Ins-272-F and Ins-272-R being shown in SEQ ID NO. 3 and SEQ ID NO. 4; the molecular marker being located on the nucleic acid fragment of chromosome 3 at chr3: 11456694-11457162.

[0010] The present invention also provides a kit for identifying the salt tolerance of *Gnaphalium affine*, comprising the aforementioned primer pair.

[0011] This invention also provides a method for identifying the salt tolerance of *Gnaphalium affine*, comprising the following steps: (1) Extract genomic DNA from the *Gnaphalium affine* to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair or the kit, and sequence the PCR amplification product. (3) Make a judgment based on the sequencing results of step (2).

[0012] Preferably, if the amplified fragment of the sequencing result is the nucleotide sequence shown in SEQ ID NO.5 and has a length of 468 bp, it is haplotype I, i.e., strong salt tolerance; if the amplified fragment of the sequencing result is the nucleotide sequence shown in SEQ ID NO.6 and has a length of 336 bp, it is haplotype II, i.e., weak salt tolerance.

[0013] This invention also provides an in situ overexpression of wheat homologous genes. CvNC1 The promoter, the CvNC1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 9.

[0014] The present invention also provides the aforementioned CvNC1 Application of promoters in improving wheat salt tolerance.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention relates to salt-tolerant tiger tail grass. CvNC1 The gene encodes an HKT transporter protein with Na+. + This study enhanced the absorption activity and significantly improved the salt tolerance of Arabidopsis thaliana. Furthermore, a 132-bp insertion variation was observed in the promoter of this candidate gene, significantly increasing the transcriptional level and reducing Na+ absorption in the upper part of *Arabidopsis thaliana*. + Accumulation of this mutation regulates the plant's salt stress adaptation. This variation is significantly linked to salt tolerance in *Hypericum esculentum* and can serve as a molecular marker for assessing salt tolerance in *Hypericum esculentum*. Simultaneously, this mutant promoter can be used to enhance the expression of its wheat homolog, TaHKT1,5-D, in the stele tissue and improve wheat salt tolerance. The major QTL for salt tolerance in *Hypericum esculentum*, along with its related genes, molecular markers, and applications provided by this invention, can be used for improving crop salt tolerance and identifying salt-tolerant *Hypericum esculentum* germplasm resources. Attached Figure Description

[0016] Figure 1 It is the upper part of the tiger tail grass Na + Genome-wide association analysis (GWAS), candidate gene association analysis, and haplotype analysis of the content (where A is Na+ in the upper part of the tiger tail grass). + A) GWAS analysis results of Na+ content; B) Candidate gene association analysis; C) Sequence characteristics of the variant site with the highest effect value in the candidate gene association analysis; D) Molecular marker detection to identify the variant site; E) Haplotype analysis based on the variant site, detecting Na+ in the roots and aboveground parts of two haplotypes of *Gnaphalium affine* under salt stress. + (Differences in content) Figure 2 Candidate genes CvNC1 Na in yeast + and K + Transfer function verification (where A represents unloaded vehicle (EV)). CvNC1 Homologous genes with maize and wheat in Na + and K + Differences in salt tolerance and K+ overexpression in transport-deficient yeast + The results of the supplementary experiment were analyzed; B~C represent the intracellular Na+ of yeast cells from different transformants. + and K +The results of the determination of the content; trk1 and trk2 are K + Transport-deficient yeast strains, ant5 is Na + (Transportation-defective yeast strains); Figure 3 It's a gene. CVNC1 Salt phenotype analysis of Arabidopsis thaliana overexpression materials driven by their own promoters (where A is the map of plant expression vectors used for Arabidopsis thaliana transgenesis; B is the map of empty vectors used for transgenesis). GFP )and CvNC1 Genes were overexpressed in Arabidopsis thaliana, and their salt tolerance differences under salt stress were detected; C represents the fresh weight of the aboveground parts and Na+ of different transgenic materials under control and salt treatment conditions. + Content, K + Content and Na + / K + (Determination of ratio) Figure 4 yes CvNC1 Superior promoters drive wheat homologous genes TaHKT1,5-D Salt tolerance analysis of overexpression materials (where A is the plant expression vector map used for wheat transgenic; B is the phenotype of wheat overexpression materials under 100 mM NaCl treatment; C is the percentage of biomass reduction; D is the overexpression level; and E is the Na+ content in the aboveground parts). Detailed Implementation

[0017] This invention provides a salt-tolerant tiger tail grass CvNC1 Genes, the salt-tolerant tiger tail grass CvNC1 The gene is located on chromosome 3 at position 11,454kb–11,456kb. CvNC1

[0018] The present invention also provides the salt-tolerant tiger tail grass. CvNC1 The gene encodes a protein, the amino acid sequence of which is shown in SEQ ID NO. 2. Specifically, the protein is expressed in the root stele tissue; it mediates Na+ under salt stress. + The transport of sap from the xylem to the roots reduces Na in the aboveground parts. + Content and regulation of salt tolerance in tiger tail grass.

[0019] The present invention also provides the salt-tolerant tiger tail grass described above. CvNC1 Application of genes in improving plant salt tolerance: Overexpression of salt tolerance in *Gnaphalium affine* CvNC1 Genes enhance the salt tolerance of plants.

[0020] In this invention, the plants include Arabidopsis thaliana and wheat.

[0021] The present invention also provides a primer pair for amplifying the salt tolerance molecular marker of *Gnaphalium affine*, the primer pair comprising Ins-272-F and Ins-272-R, the nucleotide sequences of Ins-272-F and Ins-272-R being shown in SEQ ID NO. 3 (CGAGGTGGATTGTCAACGTTAG) and SEQ ID NO. 4 (CGGAGGGAGAGATATCTAGATGC); the molecular marker is located in the nucleic acid fragment of chromosome 3 at chr3: 11456694-11457162.

[0022] The present invention also provides a kit for identifying the salt tolerance of *Gnaphalium affine*, comprising the aforementioned primer pair.

[0023] This invention also provides a method for identifying the salt tolerance of *Gnaphalium affine*, comprising the following steps: (1) Extract genomic DNA from the *Gnaphalium affine* to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair or the kit, and sequence the PCR amplification product. (3) Make a judgment based on the sequencing results of step (2).

[0024] In this invention, if the amplified fragment of the sequencing result is SEQ ID NO.5 (CGAGGTGGATTGTCAACGTTAGATCTGTTGCGTTACCGCGAAACATGCGCTCCGTCCCATATGTCGATTCGCATCTCAAGAACGCATTTCTTACAGGAGAAATGCACTCGACGAACCACGAGTGTGCGCGTGCACCTTACTTTTGGTCATTGCGTCCAGCACAATCGAAGATAAGCCAAACAAACGTCCCACATGTCGATTCGCATCTCAAGAACGCATTTCTTACAGGAGAAATGCACTCGACGAACCACGAGT The nucleotide sequence shown in SEQ ID NO(G) is 468 bp in length, indicating haplotype I, meaning it is highly salt-tolerant. If the amplified fragment from the sequencing result is SEQ ID NO(G)... The nucleotide sequence shown in IDNO.6 (CGAGGTGGATTGTCAACGTTAGATCTGTTGCGTTACCGCGAAACATGCGCTCCGTCCCATATGTCGATTCGCATCTCAAGAACGCATTTCTTACAGGAGAAATGCACTCGACGAACCACGAGTGTGCGCGTGCACCTTACTTTTGGTCATTGCGTCCAGCACAATCGAAGATAAGCCAAACAAACGTCCCACATGTCGATTCGCATCTCAAGAACACATTTTTACAGGAGAAATGCACTCGACGAACGACGAGTGTGCGCCTAGTGCACCTTAGCCGCTATTGTCCAGATGCACAATATATACAAGGCATATTGCATCTAGATATCTCTCCCTCCG) is 336 bp in length (with a 132 bp deletion), indicating it is haplotype II, meaning it is weakly salt-tolerant.

[0025] This invention also provides an in situ overexpression of wheat homologous genes. CvNC1 The promoter, the CvNC1 CvNC1 The promoter is located at position 11456694–1147351 kb on chromosome 3; the wheat homologous gene includes TaHKT1,5-D.

[0026] The present invention also provides the aforementioned CvNC1 Application of promoters in improving wheat salt tolerance.

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1

[0029] Cloning and functional analysis of salt-tolerant QTL genes in *Symplocos rubra*

[0030] 1. Na+ levels in the upper part of different tiger tail grasses under salt stress + Significant differences were found in Na+ content and salt tolerance. Na+ content was measured in the upper part of 225 samples of *Hedysarum tigrinum* under salt stress. + Fresh leaves were collected and subjected to genome sequencing (10G of data per sample). The genome data obtained from sequencing was aligned with the reference genome to obtain SNP data. SNP variation data were filtered according to MAF > 0.05, and a total of 561,306 SNPs were finally obtained. Genotype data were filled using Beagle 5.4 software, and genome-wide association analysis (GWAS) was performed using the default parameters of the mixed linear model (MLM) of rMVP (R PACKAGE).

[0031] Experimental results: such as Figure 1 As shown in A, a significantly correlated region was found on chromosome 3, with the highest effect value SNP being Chr3_11456971. A candidate gene was identified within this QTL interval and named... CvNC1 .

[0032] Simultaneously, candidate gene association analysis was performed on natural variations in the region near the highest effect value site, identifying a natural variation Ins-272 on the candidate gene promoter and a connection between the aboveground Na population. + Significantly correlated, haplotype analysis based on this natural variation showed that haplotype Ins-272 + Material above ground Na + The content was significantly lower than that of haplotype Ins-272 - ( Figure 1 B and Figure 1 (E in the text).

[0033] Based on the differential sequence, specific primers Ins-272-F (SEQ ID NO. 3) and Ins-272-R (SEQ ID NO. 4) were designed for PCR and agarose gel electrophoresis to detect the band differences, and to develop usable salt-tolerant molecular markers. Figure 1 CD and Figure 4 (A in the middle).

[0034] 2. In order to clone candidate genes CvNC1 We analyzed its salt tolerance regulation function and predicted the coding region and protein sequence of candidate genes based on bioinformatics data.

[0035] (1) Analysis showed that its candidate gene encodes an HKT family transporter protein with a full length of 2125 bp (from start codon to stop codon), containing 3 exons and 2 introns. The coding region sequence is 1614 bp in length, as shown in SEQ ID NO. 1, and its encoded protein sequence is shown in SEQ ID NO. 2.

[0036] (2) In order to clone candidate genes CvNC1 Using the roots of 10-day-old Chloris virgata seedlings as material, total RNA was extracted using the plant total RNA extraction kit (Cat.#DP432) from Tiangen Biotech (Beijing) Co., Ltd., and cDNA template was obtained by reverse transcription using the M5 Sprint qPCR RT kit with gDNA remover from Polymerase Biotechnology Co., Ltd. CvNC1 PCR amplification was performed using coding region-specific primers (forward primer CvNC1-gene-FATGCAGCAGATGGGTGTCTC (SEQ ID NO. 7); reverse primer CvNC1-gene-RTTAGCCTAGCCTCCATGCCT (SEQ ID NO. 8)). Products of the expected size (1614 bp) were obtained. The PCR products were recovered and purified using a gel extraction kit (Cat. #DP105-3) from Tiangen Biotech (Beijing) Co., Ltd. The recovered PCR fragments and the ligation vector P416-GPD (Coollab Biotech Co., Ltd., Cat. #VT057) were double-digested with restriction endonucleases BamHI and HindIII, and ligated using T4 ligase. The ligation products were then transformed into competent *E. coli* cells. Single colonies were selected for colony PCR amplification. Colonies with the target size band were identified as positive clones by electrophoresis. The corresponding bacterial cultures were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to obtain correctly ligated products. P416-CvNC1 Yeast recombinant vector.

[0037] (3) In order to determine CvNC1 To Na + and K + The transport activity of Na + and K + Transport-defective yeast strains ant5 and trk1trk2 (BioSci plasmid strain company) conducted functional complementation experiments.

[0038] The experimental procedure for complementary defective yeast is as follows: P416-CvNC1 The recombinant vectors were transferred into Na + and K + Transport-defective yeast strains ant5 and trk1trk2 Single colonies were picked and inoculated into 5 mL of YPDA liquid medium (containing antibiotics) and cultured overnight on a shaker at 200 rpm and 28°C. The bacterial culture was then centrifuged at 4000 rpm for 2 min to collect the cells, and the cells were reselected with ddH2O and the OD concentration was adjusted. 600 To 0.5; 10 μL of the resuspended bacterial solution was titrated onto AP medium containing different concentrations of NaCl and KCl. After 2-4 days of growth, photographs were taken and recorded (e.g., ...). Figure 2 (A in the middle).

[0039] Defective yeast Na + and K + The absorption experiment procedure was as follows: Colonies from the previous defective yeast complementation experiment were streaked onto SD-Ura solid medium and incubated upside down for 2-3 days; positive clones were picked and cultured overnight in 5 mL of YPDA liquid medium, then inoculated into 100 mL of AP medium containing 0.1 mM KCl and cultured for at least 24 h; different bacterial strains were inoculated into 50 mL of AP medium containing 0.1 mM KCl and 20 mM NaCl, respectively, and the OD was adjusted. 600 The bacterial cells were incubated at 28℃ with shaking at 200 rpm for 2 h. The cells were centrifuged, the supernatant was discarded, and the cells were washed twice with ddH2O. The cells were then dried overnight in a 70℃ oven. The dried cells were pulverized, and the dry weight was recorded. The cells were then ashed in a muffle furnace. The completely ashed cells were dissolved in 0.5 mL of dilute nitric acid and analyzed using a flame spectrophotometer for Na+ analysis. + and K + Measurement ( Figure 2 (BC in the middle).

[0040] Experimental results show CvNC1 To Na + It has absorption activity, and the absorption activity is stronger than that of the homologous genes of corn and wheat.

[0041] (4) In order to confirm CvNC1Regulating Na+ in *Smilax china* + Long-distance transport capability, using cDNA from the roots of 10-day-old tiger tail grass seedlings and P416- CvNC1 As a template, for CvNC1 The promoter and coding region were amplified by PCR. The recovered PCR fragment and the ligation vector pCAMBIA1300-GFP (Biovector, Cat.#3560628) were double-digested with restriction endonucleases HindIII and BamHI, and ligated using T4 ligase. The ligation product was then transformed into competent E. coli cells. Single colonies were picked for colony PCR amplification. Colonies with the target size band were identified by electrophoresis as positive clones. The corresponding bacterial cultures were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to obtain correctly ligated samples. Pro CvNC1 :CvNC1-GFP Transformation vector ( Figure 3 A in the middle. Pro CvNC1 :CvNC1-GFP The vector was transferred into Agrobacterium GV3101. Single colonies were picked and inoculated into 5 ml of YEB liquid medium (containing antibiotics) and cultured overnight at 200 rpm and 28°C on a shaker. All 5 mL of the bacterial culture was then inoculated into 50 mL of YEB liquid medium for expansion culture for 8–10 h. The bacterial culture was centrifuged at 8000 rpm for 2 min, and the bacterial cells were collected. The precipitated Agrobacterium cells were resuspended in AS infection solution (10 mM Tris-KOH, 10 mM MgCl2, 0.15 mM AS (acetylsyleugenol)) and the concentration was adjusted to OD. 600 The concentration of sodium thaliana was increased to 0.5–1.0 mg / L; heterologous overexpression materials of Arabidopsis thaliana were obtained through flower immersion experiments. Salt phenotype analysis was performed on the transgenic Arabidopsis materials, and the aboveground biomass and Na+ content of Arabidopsis thaliana under control and salt treatment conditions were measured. + Content, K + Content and K + / Na + Ratio (e.g.) Figure 3 (B and C in the text), which indicates that CVNC1 Genes have the ability to regulate Na + The ability to transport substances over long distances can be improved by overexpressing them in plants to enhance their salt tolerance.

[0042] Example 2

[0043] Using tiger tail grass CvNC1 Superior mutant promoters enhance the expression of wheat homologous genes and improve their salt tolerance.

[0044] To verify the presence of tiger tail grass CvNC1Can a superior promoter (nucleotide sequence shown in SEQ ID NO. 9) be used to enhance the expression of crop homologous genes and salt tolerance? Haplotype Ins-272 was selected... + The strains and the wheat variety Filder were grown under normal conditions for 10 days. Leaf samples were harvested, and total DNA was extracted using the Plant Genomic DNA Extraction Kit (Cat.#DP305) from Tiangen Biotech (Beijing) Co., Ltd. Specific primer pairs were used... CvNC1 The promoter and wheat homolog TaHKT1,5-D (ID: TraesCS4D02G361300) were amplified by PCR (where... CvNC1 Promoter amplification primer sequences, forward primer: Pro_ CvNC1 _F TACGGGCCTTACATCGATGTGG (SEQ ID NO. 10), reverse primer: Pro_ CvNC1 _RTGCTGCATGTGCTCGCTGTGTGTTACAC (SEQ ID NO. 11); TaHKT1,5-D coding region amplification primer sequences, forward primer: TaHKT1,5-D_CDS_FATGGGTTCTTTGCATGTCTCCT (SEQ ID NO. 12), reverse primer: TaHKT1,5-D_CDS_RTACTATCCTCCATGCCTCGC (SEQ ID NO. 12) .13) Products matching the expected sizes (1682bp and 1548bp) were obtained. The PCR products and the vector pCAMBIA3300-GFP-GRF4-GIF1 (Biovector, Cat.#8602983) were digested with the restriction endonuclease HindIII and ligated using T4 ligase. The ligation products were then transformed into competent E. coli cells. Single colonies were picked for colony PCR amplification. Colonies with the target size bands were identified by electrophoresis as positive clones. The corresponding bacterial cultures were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to obtain correctly ligated products. ProCvNC1:TaHKT1,5-D-GFP The transformation vector was transferred into Agrobacterium EHA105 ( Figure 4 (A) Transgenic plants were obtained through wheat callus infection; transgenic positive plants were identified by PCR amplification of the resistance gene Bar, and the overexpression fold of the target gene was determined by RT-qPCR, ultimately resulting in two wheat overexpression plants (A). Figure 4 (D in the example). Figure 4 BC and Figure 4 As shown in E, both overexpression materials exhibited a more salt-tolerant phenotype than the wild type, and under salt stress, the overexpressing cells showed a lower percentage reduction in biomass and lower aboveground Na+. + Content, Explanation CvNC1 Superior promoters can be used to enhance the expression of wheat homologous genes and improve wheat salt tolerance.

[0045] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A salt-tolerant species of tiger tail grass CvNC1 Genes, characterized by, The CvNC1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The salt-tolerant tiger tail grass according to claim 1 CvNC1 Gene-encoded proteins are characterized by, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The salt-tolerant tiger tail grass according to claim 1 CvNC1 The application of genes in improving plant salt tolerance is characterized by, Overexpression of salt tolerance in *Syzygium buergerianum* CvNC1 Genes enhance the salt tolerance of plants.

4. The application according to claim 3, characterized in that, The plants mentioned include Arabidopsis thaliana and wheat.

5. A primer pair for amplifying salt-tolerant molecular markers in *Gnaphalium affine*, characterized in that, The primer pair includes Ins-272-F and Ins-272-R, the nucleotide sequences of which are shown in SEQ ID NO. 3 and SEQ ID NO. 4; The molecular marker is located in the nucleic acid fragment chr3: 11456694-11457162 on chromosome 3.

6. A kit for identifying the salt tolerance of *Gnaphalium affine*, characterized in that, Includes the primer pair as described in claim 5.

7. A method for identifying the salt tolerance of *Gnaphalium affine*, characterized in that, Includes the following steps: (1) Extract genomic DNA from the *Gnaphalium affine* to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 5 or the kit described in claim 6, and sequence the PCR amplification product; (3) Make a judgment based on the sequencing results of step (2).

8. The method according to claim 7, characterized in that, If the amplified fragment of the sequencing result is the nucleotide sequence shown in SEQ ID NO.5, with a length of 468 bp, it is haplotype I, meaning it is highly salt-tolerant; if the amplified fragment of the sequencing result is the nucleotide sequence shown in SEQ ID NO.6, with a length of 336 bp, it is haplotype II, meaning it is weakly salt-tolerant.

9. A method for in situ overexpression of wheat homologous genes CvNC1 The promoter is characterized in that, The CvNC1 The nucleotide sequence of the promoter is shown in SEQ ID NO.

9.

10. The claim 9 CvNC1 Application of promoters in improving wheat salt tolerance.

Images