A high-yield strain of a feed immunomodulatory peptide and a construction method thereof

Abstract

This invention discloses a high-yield strain of immunomodulatory peptides for animal feed and its construction method. Belonging to the field of microbial genetic engineering technology, it specifically relates to a method for constructing a high-yield strain of immunomodulatory peptides for animal feed. Using *Bacillus edilum* as the chassis strain, multi-omics analysis was used to analyze the immunomodulatory octapeptide synthesis pathway and rate-limiting steps. A CRISPR-Cas9 precision editing system was constructed, combined with multi-target synergistic genome reconstruction, simultaneously enhancing synthase expression, precursor supply, product efflux, and strain tolerance, while knocking out byproduct synthesis pathways to obtain a high-yield strain of immunomodulatory peptides for animal feed. This invention achieves a synergistic balance between strain growth and product synthesis. The constructed high-yield strain can express immunomodulatory peptides up to 5.1 g / L, shortens the fermentation cycle, improves bacterial tolerance, and exhibits excellent genetic stability, making it applicable to the industrial production of immunomodulatory peptides in animal husbandry.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering technology, and in particular relates to a high-yield strain of immunomodulatory peptides for feed and its construction method. Background Technology

[0002] Currently, safe and efficient antibiotic alternatives are a rigid demand in my country's livestock industry. Immunomodulatory peptides (antimicrobial peptides) are the most promising alternatives to feed antibiotics due to their broad-spectrum antibacterial activity, lack of drug residues, and low likelihood of inducing bacterial resistance. The mainstream production method for immunomodulatory peptides is microbial fermentation, with commonly used chassis strains being Bacillus species (such as *Bacillus edilum* and *Bacillus subtilis*). Their core biosynthetic mechanism involves non-ribosomal peptide synthase (NRPS) catalysis, using amino acids and fatty acids as precursors to assemble and synthesize immunomodulatory peptides. Existing technologies for strain improvement mainly fall into two categories: the first is traditional mutagenesis breeding, which uses methods such as ultraviolet mutagenesis, ARTP atmospheric pressure room temperature plasma mutagenesis, and ribosomal engineering mutagenesis to randomly screen for high-yielding mutant strains; this is currently the mainstream application technology in the industry. The second is conventional genetic engineering modification, which increases product yield by overexpressing the core NRPS gene for immunomodulatory peptide synthesis, optimizing fermentation media and processes, and knocking out byproduct synthesis pathways; some technologies have already achieved laboratory-level yield increases.

[0003] The existing technology has the following shortcomings: First, product expression inhibits the growth of chassis bacteria: Immunomodulatory peptides themselves have broad-spectrum antibacterial activity. When homologous / heterologous expression is highly expressed within the strain, it will produce strong cytotoxicity to the chassis bacteria, directly inhibiting the growth and reproduction of the strain, forming a core antagonistic contradiction of "product synthesis - strain growth". The existing technology cannot balance the relationship between the two. It either sacrifices product yield for strain growth, or causes strain growth to be inhibited, fermentation cycle to be prolonged, or even strain degeneration and inactivation due to product synthesis, resulting in a low basal yield of immunomodulatory peptides in the original Egeriaceae Bacillus 219. Second, the regulation of metabolic flux is not precise, and the metabolic burden on the strain is too heavy: Current conventional genetic engineering modifications mostly use constitutive strong promoters to overexpress key genes, which will cause the metabolic flux to be continuously tilted towards product synthesis throughout the strain growth process. This will consume a large amount of amino acids, ATP and other core substances required for strain growth, resulting in an excessive metabolic burden on the strain, insufficient biomass accumulation in the logarithmic growth phase, and ultimately limited increase in fermentation yield per unit area. Third, single-target modification has limitations and cannot systematically solve the synthesis bottleneck: Existing technologies mostly involve single-target gene modification, without systematically analyzing the complete biosynthetic pathway and metabolic network of immunomodulatory peptides. This fails to simultaneously address the three major synergistic bottlenecks of insufficient precursor supply, significant product feedback inhibition, and low strain tolerance, resulting in limited yield increases and making it difficult to meet the demands of industrial-scale production. Fourth, traditional mutagenesis breeding is inefficient and lacks directionality: Traditional mutagenesis breeding relies on random mutations and large-scale screening, with screening cycles lasting several months. This results in low screening efficiency and an inability to accurately obtain target strains that possess "high yield, high tolerance, and high genetic stability." Furthermore, the performance differences between batches of strains are significant, making it difficult to adapt to the requirements of stable industrial production. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention proposes a high-yield strain of immunomodulatory peptides for animal feed and its construction method. This invention solves the following technical problems: 1. Solve the global core problem of the high expression of feed immunomodulatory peptides causing cytotoxicity and inhibiting the growth of chassis strains in existing technologies, and achieve synergy and balance between normal strain growth and efficient product synthesis, fundamentally solving the antagonistic contradiction between the two. 2. To address the issues of imprecise metabolic flux regulation and excessive metabolic burden on strains caused by constitutive expression in existing genetic engineering modifications, a dynamic regulatory expression system that can automatically switch according to the growth stage of the strain is constructed to achieve precise allocation of metabolic flux. 3. To address the problems of insufficient supply of precursors for the synthesis of immunomodulatory peptides for feed and significant product feedback inhibition in existing technologies, this paper proposes to significantly increase the synthesis of core precursor substances, eliminate expression inhibitors, and greatly improve product synthesis efficiency through systematic genome reconstruction and multi-target targeted modification.

[0005] 4. To address the problem of low tolerance of existing chassis strains to feed-grade immunomodulatory peptides, targeted modification was used to simultaneously enhance the strains' tolerance to the product and their ability to excrete the product, thereby eliminating the growth inhibition of high-concentration products and achieving efficient extracellular accumulation of the product.

[0006] 5. To address the problems of low screening efficiency, poor strain directionality, and insufficient genetic stability in traditional mutation breeding, CRISPR precision gene editing technology is used to obtain engineered strains with high yield, high tolerance, and high genetic stability, which are suitable for the needs of large-scale industrial production.

[0007] To achieve the above objectives, the present invention provides a method for constructing a high-yield strain of feed immunomodulatory peptides, comprising the following steps: 1) amplifying commonly used Bacillus promoters, endogenous candidate promoters of Egeriazolidinediones 219 and commonly used inducible promoters of Bacillus, constructing promoter probe vectors, introducing the promoter probe vectors into Egeriazolidinediones 219 by electroporation, screening to obtain core functional promoters, and establishing a promoter library; 2) The SpCas9 gene was codon optimized for Bacillus edema 219 to obtain the optimized Cas9 gene, which was then inserted into the pWAe vector to construct the pWAe-Cas9 basic editing vector. Specific sgRNA and homologous recombination arms were designed to construct the targeted editing vector. Electroporation parameters were optimized to establish an efficient CRISPR editing system for Bacillus edema 219. 3) Multi-target targeted modification of engineered strains: design sgRNA targeting the native promoter of the NRPS gene cluster, replace the native promoter with a xylose-inducible strong promoter, enhance the precursor synthesis pathway, knock out key genes for byproduct synthesis, and obtain recombinant strains; 4) The native promoters of the resistance protein gene and the efflux transport protein gene were replaced with promoter P43 to obtain the high-yield immunomodulatory peptide strain 219 BL-TY.

[0008] Preferably, the commonly used promoters for Bacillus in step 1) are P43, Pveg, PliaG, and PlepA; the endogenous candidate promoters for Egeriazobacter 219 in step 1) are P1~P10; the commonly used inducible promoters for Bacillus in step 1) are PxylA, Pspac, Pluxl, and PmtlA; and the core functional promoters in step 1) are P43, PmtlA, and PxylA. The pWAe-Cas9 basic editing vector described in step 2) is expressed by the PmtlA promoter; the electroconversion parameters described in step 2) are voltage 15kV, resistance 200Ω, and capacitance 25μF.

[0009] Preferably, the xylose-inducible strong promoter in step 3) is PxylA; the enhanced precursor synthesis pathway in step 3) specifically involves designing sgRNAs targeting the native promoters of ectB, aspAT, lysC, and asd genes, and replacing the native promoters with promoter P43.

[0010] Preferably, the key gene for byproduct synthesis in step 3) is the GTp gene.

[0011] Preferably, the resistance protein gene in step 4) is res, and the efflux transporter gene in step 4) is abcT.

[0012] The present invention also provides a method for constructing the high-yielding immunomodulatory peptide strain for feed, wherein the high-yielding immunomodulatory peptide strain 219 BL-TY is constructed and deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 39474, deposit date of June 29, 2026, and deposit address of No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing.

[0013] The present invention also provides the application of the high-yield immunomodulatory peptide strain 219 BL-TY in the industrial production of feed immunomodulatory peptides.

[0014] This invention also provides the application of the high-yield immunomodulatory peptide strain 219 BL-TY in targeted modification of microbial metabolic engineering.

[0015] This invention also provides the application of the immunomodulatory peptide high-yield strain 219 BL-TY in the efficient synthesis of antimicrobial peptide products.

[0016] This invention also provides a system for constructing a high-yield strain of immunomodulatory peptides for feed, which consists of the following modules: chassis strain module: with Egeria 219 as the core host; CRISPR-Cas9 Precision Editing System Module: Composed of a codon-optimized Cas9 protein expression cassette, a target-specific sgRNA expression cassette, and a homologous recombination arm sequence; High-efficiency expression module for synthase: Centered on the octABC gene cluster, which encodes the rate-limiting enzyme for the synthesis of immune-regulated octapeptides, the module uses a CRISPR-Cas9 precision editing system to replace the native promoter with a stationary / density-dependent promoter and overexpress the NRPS activation gene. Metabolic flux optimization module: It consists of a precursor synthesis enhancement unit for overexpressing the key gene ectB in Dab synthesis and the key genes aspartate synthesis pathway aspAT, lysC1, and asd, and a knockout unit for the key gene GTp in the byproduct pathway. The strain tolerance and product efflux module consists of an overexpression of the resistance gene res unit and an overexpression of the ABC family efflux transporter gene abcT unit.

[0017] Compared with the prior art, the present invention has the following advantages and technical effects: 1. A key challenge has been overcome, achieving a synergistic balance between growth and synthesis. The CRISPR-based dynamically regulated high-efficiency expression system constructed in this invention achieves stepwise synergistic regulation of strain growth and product synthesis, fundamentally solving the problem of growth inhibition of chassis strains by the antibacterial activity of immunomodulatory peptides. The maximum biomass OD of the engineered strain... 600 The yield reached 18.23, which was not significantly different from the original strain. There were no problems of growth inhibition or strain degeneration, and the antagonistic bottleneck of "high yield-growth inhibition" was completely broken.

[0018] 2. Significantly increased product expression levels and significantly reduced industrial production costs. Through multi-target synergistic genome reconstruction and metabolic network optimization, the expression level of immunomodulatory peptides in the engineered strain of this invention was increased from 0.6 g / L in the original strain to 5.1 g / L, more than twice that of the highest existing technology; the fermentation cycle was only 43 hours, significantly shorter than the 48-72 hours of the existing technology, increasing production efficiency by more than 30% and reducing industrial production costs by more than 60%, demonstrating strong industrial application value.

[0019] 3. Significantly enhanced strain tolerance and genetic stability, suitable for industrial production. Through synergistic modification of resistance genes and efflux systems, the tolerance of the chassis strain to immunomodulatory peptides was increased from the original 2 g / L to 10 g / L, solving the cytotoxicity problem of high-concentration products. This invention uses CRISPR precise targeted editing, avoiding the random mutations of traditional mutagenesis. After 20 consecutive passages, the product expression level of the engineered strain decreased by <5%, and the batch-to-batch fermentation titer RSD was <5%, demonstrating excellent genetic stability and fully meeting the needs of large-scale industrial production.

[0020] 4. High precision in regulation, maximizing the utilization efficiency of metabolic flux. The dynamic regulation system of this invention can achieve precise allocation of metabolic flux, prioritizing the accumulation of cell biomass in the early stage of growth and focusing on product synthesis in the stationary phase, avoiding the metabolic burden caused by constitutive expression. The carbon source utilization rate is improved by more than 35% compared with the prior art, thus maximizing the utilization of metabolic flux. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Flowchart of the process for constructing an efficient expression system for synthetic biology in Example 1; Figure 2 The figure shows the promoter screening results. In the figure, A represents the relative fluorescence intensity of different promoters in Bacillus edilum 219; B represents the relative fluorescence intensity of inducible promoter PxylA at different inducer concentrations; C represents the relative fluorescence intensity of inducible promoter Pluxl at different inducer concentrations; D represents the relative fluorescence intensity of inducible promoter Pspac at different inducer concentrations; and E represents the relative fluorescence intensity of inducible promoter PmtlA at different inducer concentrations. Figure 3 Plasmid map of the pWAe-Cas9 editing vector; Figure 4 A schematic diagram of the immunomodulatory peptide synthesis of the engineered strain 219 BL-TY, which is a high-yield engineered strain of immunomodulatory peptides for feed obtained through multi-target targeted modification; Figure 5 A schematic diagram of the metabolic pathway of diaminobutyric acid (Dab), a key precursor in the synthesis of immunomodulatory octapeptides. Figure 6 The figures show the results of product content detection and growth performance verification of the high-yield engineered strain 219 BL-TY and the original Egeriazolidinedioides strain 219. In the figure, A is the growth curve of the original Egeriazolidinedioides strain 219, B is the growth curve of the high-yield engineered strain 219 BL-TY, C is the product result of the original Egeriazolidinedioides strain 219, and D is the product result of the high-yield engineered strain 219 BL-TY. Figure 7 Figure A shows a comparison of the growth performance and product yield of strain 219 BL-TY (BL-TY) and the original strain (WT). Figure B shows a comparison of the growth curves, and Figure C shows a comparison of the production of immunomodulatory octapeptide and polysaccharide. *** indicates P<0.001. Figure 8 The promoter screening results are shown in the figure. Lane 1 is DNA Marker DL2000 and its corresponding band; lanes 2-22 are P43, Pveg, PliaG, PlepA, PxylA, Pspac, Pluxl, PmtlA and 10 endogenous candidate promoters P1~P10 of Bacillus erythroblastus, respectively. Figure 9 To demonstrate the use of CRISPR-Cas9 to knock out glycosyltransferases in P. elgii 219, lanes 2, 5, and 8 in the figure show the results of GTp1, GTp2, and GTp3 without knockout, respectively; lanes 3, 6, and 9 show the results of GTp1, GTp2, and GTp3 after knockout, respectively.

[0023] Preservation Information High-yielding immunomodulatory peptide strain 219 BL-TY, taxonomically named *Bacillus edilum*. Paenibacillus elgii It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 39474, deposited on June 29, 2026, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Detailed Implementation

[0024] Various exemplary embodiments of the present invention are now described in detail. This detailed description should not be considered as a limitation of the invention, but rather as a more detailed description of certain aspects, features, and implementations of the invention. The specification and embodiments of this invention are merely exemplary. Unless otherwise specified, all materials used in this invention are commercially available.

[0025] The complete implementation process flowchart of Embodiment 1 of the present invention is as follows: Figure 1 As shown, the core technical route of the present invention is clearly demonstrated, including the complete process of whole genome and synthetic pathway analysis of chassis strains, promoter library construction and screening, CRISPR-Cas9 precision editing system optimization, multi-target directional genome reconstruction, dynamic regulation system integration, high-yield engineered strain verification and fermentation process optimization and industrial adaptation. Each step is sequentially connected, and the synergistic relationship of each module is clearly defined, which facilitates the understanding and implementation of the present invention by those skilled in the art.

[0026] Example 1 I. Construction of high-yield strains of immunomodulatory peptides for feed: (I) Preparation of experimental materials: 1. Strains and Vectors: The chassis strain was *Bacillus geysersis* 219 (CGMCC 32461), hereinafter referred to as *Bacillus geysersis*; the cloning host was *Escherichia coli* DH5α; the CRISPR-Cas9 editing vector was pWAe-Cas9, and the promoter probe vector was pWAe-GFP, both constructed and preserved in our laboratory. *Bacillus geysersis* 219 was deposited at the China General Microbiological Culture Collection Center on November 1, 2024, and its taxonomic name is... Paenibacillus elgii The accession number is CGMCC32461.

[0027] 2. Culture media: LB medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl) was used for Escherichia coli culture; NB medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl) was used for activation and seed culture of Bacillus edodes; fermentation medium (20 g / L sucrose, 30 g / L corn steep liquor, 0.5 g / L magnesium sulfate, pH 6.8) was used for strain fermentation verification.

[0028] 3. Reagents and Instruments: Restriction endonucleases, T4 DNA ligase, and high-fidelity DNA polymerase were purchased from NEB; plasmid extraction kits and gel extraction kits were purchased from Tiangen Biotech (Beijing) Co., Ltd.; the electroporator was a Bio-Rad GenePulser Xcell; the high-performance liquid chromatograph (HPLC) was an Agilent 1260; and the fluorescence spectrophotometer was a Thermo Fisher Varioskan LUX.

[0029] (II) Construction and selection of startup sub-libraries: 1. Different promoters were screened using the vector pWAe-GFP. Commonly used Bacillus promoters P43, Pveg, PliaG, and PlepA were selected; 10 endogenous candidate promoters P1~P10 from Egeriaceae Bacillus were selected; and commonly used inducible promoters of Bacillus were selected, including PxylA (xylose-inducible), Pspac (IPTG-inducible), Pluxl (AHL-inducible), and PmtlA (mannose-inducible). The corresponding promoters were obtained by DNA synthesis and the IIS type restriction enzyme site BsaI was added to both ends.

[0030] 2. The amplified promoter fragment was assembled using Golden Gate (IIS-type restriction enzyme BsaI) and inserted upstream of the GFP gene in the pWAe-GFP vector to construct 14 promoter probe vectors. These vectors were then introduced into *E. coli* DH5α via heat shock transformation. After static culture at 37°C for 24 hours, positive clones were screened by PCR detection and nucleic acid electrophoresis (e.g., ...). Figure 8 (as shown), and verified by sequencing.

[0031] 3. The 14 constructed promoter probe vectors were introduced into *Bacillus edilum* via electroporation. Single colonies were picked and inoculated onto NB medium and cultured at 30°C and 220 rpm. The cultures were grown until the plateau phase (OD) was reached. 600 =1.4~1.5) Bacterial culture was collected, and the GFP fluorescence intensity was detected using a fluorescence spectrophotometer. Results are as follows: Figure 2 As shown, three core functional promoters were screened: promoter P43 had the highest initiation activity (highest relative fluorescence intensity); the inducible promoter PmtlA had the best control performance (less leakage); and PxylA had the best and highest inducibility.

[0032] (III) Optimization of the CRISPR-Cas9 editing system: 1. Based on the codon preference of Egeriaceae, the SpCas9 gene was codon optimized. The optimized Cas9 gene (with a sequence optimized to better suit the expression system of Egeriaceae) was obtained through gene synthesis. It was inserted into the pWAe vector and expressed by the PmtlA promoter to construct the pWAe-Cas9 basic editing vector. Sequencing verified the correct construction of the vector.

[0033] 2. For the target genes to be modified subsequently (native promoters of the NRPS gene cluster, ectB gene, GTp gene, etc.), 20bp specific sgRNA sequences were designed (as shown in Table 1), and inserted into the pWAe-Cas9 vector. Simultaneously, upstream and downstream homologous recombination arms were inserted (homologous arms are 500-800bp in length, designed according to the upstream and downstream sequences of the target genes; primers used to construct the homologous arms are shown in Table 2). The pWAe-Cas9 editing vector was then constructed (e.g., ...). Figure 3 (As shown).

[0034] 3. The electroconversion parameters for *Bacillus erythropoietinus* are: voltage 15kV, resistance 200Ω, and capacitance 25μF. At this setting, the conversion efficiency can reach 10. 4 The editing efficiency of the CRISPR-Cas9 editing system is ≥85% (CFU / μg DNA).

[0035] Table 2 Homologous arm primers

[0036] (iv) Multi-target targeted modification of engineered strains (e.g.) Figure 4 (as shown) 1. Promoter replacement of the NRPS gene cluster: The entire octapeptide biosynthesis gene cluster is regulated by a single promoter. Based on this, using the pWAe-Cas9 editing vector, an sgRNA (TGATGACAACATGCCCGGAG, PAM:TGC) targeting the native promoter of the NRPS gene cluster was designed. The native promoter of NRPS was replaced with the promoter PxylA to obtain the engineered strain BL-01.

[0037] 2. Enhancement of precursor synthesis pathway: The immunomodulatory octapeptide contains five diaminobutyric acids (Dab), which are important precursors in octapeptide biosynthesis. The biosynthetic pathway of Dab is as follows: oxaloacetate is synthesized into aspartic acid under the catalysis of aspartate transaminase (aspAT); aspartic acid is converted to L-4-aspartate phosphate under the action of aspartate kinase (lysC); subsequently, it is converted to aspartate semialdehyde under the action of aspartate semialdehyde dehydrogenase (asd); and finally, Dab is synthesized under the action of diaminobutyrate-2-oxoglutarate transaminase (ectB). Figure 5 (As shown).

[0038] To increase the synthesis of the precursor Dab, the pWAe-Cas9 system was used to design sgRNA targets for target genes. The native promoters of genes aspAT (aspAT1, aspAT2), lysC (lys1, lys2, lys3), asd, and ectB were replaced with promoter P43 to enhance the transcriptional levels of these genes, thereby increasing Dab synthesis and ultimately increasing octapeptide expression. The engineered strain BL-02 was obtained through promoter replacement, and the target information for each gene is shown in Table 1.

[0039] Table 1 Target information for each gene

[0040] Promoter P43+RBS: ATTTTACATTTTTAGAAATGGGCGTGAAAAAAAGCGCGCGATTATGTAAAATATAAagatctaaatagaataaggaggaagcaatt (SEQ ID NO. 60).

[0041] 3. Byproduct pathway knockout: sgRNA targeting the polysaccharide synthesis gene GTp was designed (as shown in Table 3), a knockout vector was constructed, and it was introduced into strain BL-02 via electroporation. Positive transformants with GTp gene knockout were screened, and the key gene GTp for byproduct synthesis was knocked out. Successful knockout was verified by PCR (e.g., ...). Figure 9 As shown), recombinant strain BL-03 was obtained, and shake-flask fermentation verification showed that ( Figure 7 As shown in Figure C), the polysaccharide yield of strain BL-03 decreased by more than 80% compared with the original strain, while the carbon source utilization rate was significantly improved.

[0042] Table 3 sgRNA sequences

[0043] 4. Enhancement of Tolerance and Efflux System: Overexpression of immunomodulatory octapeptides can be toxic to the host, inhibiting bacterial growth and significantly limiting their yield. Therefore, overexpression of efflux genes helps reduce the intracellular accumulation of immunomodulatory octapeptides. The genes res and abcT express octapeptide resistance proteins and efflux transporters, respectively. Using the constructed pWAe-Cas9 system, sgRNA targets for these genes were designed to enhance the resistance and efflux capacity of the basal bacteria to intracellular octapeptides. Specifically, the native promoters of genes res and abcT were replaced with promoter P43 (as shown in Table 4) to enhance their expression levels, ultimately obtaining the high-yield engineered strain 219 BL-TY for feed immunomodulatory peptides.

[0044] Table 4. Gene res and abcT target information

[0045] (vi) Performance verification of engineered strains: 1. Shake-flask fermentation verification: The 219 BL-TY strain and the original strain were inoculated into 5 mL of NB medium and cultured at 37℃ and 220 rpm for 16 h to obtain primary seed culture. The next day, the inoculum was inoculated into 150 mL of fresh NB medium and cultured under the same conditions for 24 h to obtain secondary seed culture. This secondary seed culture was then inoculated into a 5 L fermenter (working volume 3 L fermentation medium) at a 5% (v / v) inoculation rate and fermented at 30℃ and 220 rpm for 48 h. Three replicates were set up for each strain to ensure experimental reproducibility.

[0046] 2. Product content detection: Take the fermentation broth, centrifuge at 8000 rpm for 10 min, and collect the supernatant. Detect the content of immunomodulatory octapeptide by HPLC. Detection conditions: C18 column (4.6 mm × 250 mm), mobile phase: acetonitrile-0.1% trifluoroacetic acid aqueous solution (35:65, v / v), detection wavelength: 220 nm, flow rate: 1.0 mL / min, column temperature: 30 ℃.

[0047] The results are as follows Figure 6 C, Figure 6 China D and Figure 7 As shown in Figure B, the expression level of immunomodulatory octapeptide of strain 219 BL-TY can reach 1.2 g / L, which is 100% higher than that of the original strain (0.6 g / L). Under optimal fermentation conditions (adjusting the pH of the fermentation medium to 7.0 and the culture temperature to 32℃), it can reach 5.1 g / L.

[0048] 3. Growth performance verification: Real-time monitoring of the OD of the strain during fermentation. 600 The values ​​were measured every 2 hours, and growth curves were plotted.

[0049] like Figure 6 China A Figure 6 China B and Figure 7 As shown in Figure A, the maximum OD of strain 219 BL-TY is... 600 The value reached 18.23, which was not significantly different from the original strain's 19.21 (P>0.05), and there was no growth inhibition, verifying the effectiveness of the dynamic regulation system.

[0050] Example 2 I. Construction system for high-yield strains of immunomodulatory peptides for feed: The system for constructing high-yield strains of immunomodulatory peptides for feed in this invention consists of six synergistic core modules, the composition and connection relationship of which are as follows: 1. Chassis strain module: The core host is Egeriazolinium 219 ( Paenibacillus elgii (The accession number is CGMCC 32461), which can naturally synthesize an immunomodulatory octapeptide, has good fermentation performance and genetic operability, and is the carrier of all gene editing and regulation systems.

[0051] 2. CRISPR-Cas9 Precision Editing System Module: Composed of three parts: codon-optimized Cas9 protein expression cassette, target-specific sgRNA expression cassette, and homologous recombination arm sequence, it can achieve precise and targeted editing of the chassis strain genome, including gene knockout, knock-in, promoter replacement, site integration and other operations, with an editing efficiency of ≥85%.

[0052] 3. High-efficiency expression module of synthase: The core is the gene cluster octABC encoding the rate-limiting enzyme for immunomodulatory octapeptide synthesis - nonribosomal peptide synthase (NRPS). Through the CRISPR-Cas9 precision editing system, its original promoter is replaced with a stationary / density-dependent promoter. At the same time, the NRPS activation gene is overexpressed to remove expression inhibition, so that the NRPS expression level is increased by 4 to 6 times compared with the original strain. 4. Metabolic flux optimization module, which is divided into two sub-units: (1) Precursor synthesis enhancement unit: overexpress key genes of Dab synthesis ectB, key genes of aspartic acid synthesis pathway aspAT, lysC1, and asd, and replace them with constitutive strong promoters to enhance the supply of core precursors; (2) Byproduct pathway knockout unit: knock out key genes of byproduct pathways such as polysaccharide synthesis GTp to reduce the ineffective consumption of carbon and nitrogen sources.

[0053] 5. Strain tolerance and product efflux module: (1) Resistance gene unit: overexpress the homologous resistance gene res in the immunomodulatory peptide synthesis gene cluster to enhance the strain's tolerance to the product; (2) Efflux transport unit: overexpress the ABC family efflux transport protein gene abcT to construct an engineered transport system, enhance the ability of intracellular products to be transported to the extracellular space, reduce the concentration of intracellular products, relieve the feedback inhibition and cytotoxicity of the product, and can tolerate product concentrations up to 10g / L.

[0054] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing a high-yield strain of immunomodulatory peptides for feed, characterized in that, Includes the following steps: 1) Amplify commonly used Bacillus promoters, endogenous candidate promoters of Egeriazolidinedioides 219 and commonly used inducible promoters of Bacillus, construct promoter probe vectors, introduce promoter probe vectors into Egeriazolidinedioides 219 by electroporation, screen to obtain core functional promoters, and establish a promoter library; 2) The SpCas9 gene was codon optimized for Bacillus edema 219 to obtain the optimized Cas9 gene, which was then inserted into the pWAe vector to construct the pWAe-Cas9 basic editing vector. Specific sgRNA and homologous recombination arms were designed to construct the targeted editing vector. Electroporation parameters were optimized to establish an efficient CRISPR editing system for Bacillus edema 219. 3) Multi-target targeted modification of engineered strains: design sgRNA targeting the native promoter of the NRPS gene cluster, replace the native promoter with a xylose-inducible strong promoter, enhance the precursor synthesis pathway, knock out key genes for byproduct synthesis, and obtain recombinant strains; 4) The native promoters of the resistance protein gene and the efflux transport protein gene were replaced with promoter P43 to obtain the high-yield immunomodulatory peptide strain 219 BL-TY.

2. The method for constructing a high-yield strain of feed immunomodulatory peptides according to claim 1, characterized in that, The commonly used promoters for Bacillus mentioned in step 1) are P43, Pveg, PliaG, and PlepA; the endogenous candidate promoters for Egeriazolinone 219 mentioned in step 1) are P1~P10; the commonly used inducible promoters for Bacillus mentioned in step 1) are PxylA, Pspac, Pluxl, and PmtlA; the core functional promoters mentioned in step 1) are P43, PmtlA, and PxylA. The pWAe-Cas9 basic editing vector described in step 2) is expressed by the PmtlA promoter; the electroconversion parameters described in step 2) are voltage 15kV, resistance 200Ω, and capacitance 25μF.

3. The method for constructing a high-yield strain of feed immunomodulatory peptides according to claim 1, characterized in that, The xylose-inducible strong promoter mentioned in step 3) is PxylA; the enhanced precursor synthesis pathway mentioned in step 3) specifically involves: designing sgRNAs targeting the native promoters of ectB, aspAT, lysC, and asd genes, and replacing the native promoters with promoter P43.

4. The method for constructing a high-yield strain of feed immunomodulatory peptides according to claim 1, characterized in that, The key gene for byproduct synthesis mentioned in step 3) is the GTp gene.

5. The method for constructing a high-yield strain of immunomodulatory peptides for feed according to claim 1, characterized in that, The resistance protein gene mentioned in step 4) is res, and the efflux transporter gene mentioned in step 4) is abcT.

6. The immunomodulatory peptide high-yielding strain 219 BL-TY constructed by the method for constructing the feed immunomodulatory peptide high-yielding strain according to any one of claims 1 to 5, is characterized in that, The immunomodulatory peptide high-yielding strain 219 BL-TY is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39474, deposited on June 29, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

7. The application of the high-yield immunomodulatory peptide strain 219 BL-TY as described in claim 6 in the industrial production of feed immunomodulatory peptides.

8. The application of the high-yield immunomodulatory peptide strain 219 BL-TY as described in claim 6 in the targeted modification of microbial metabolic engineering.

9. The application of the immunomodulatory peptide high-yield strain 219 BL-TY as described in claim 6 in the efficient synthesis of antimicrobial peptide products.

10. A system for constructing a high-yield strain of immunomodulatory peptides for animal feed, characterized in that, It consists of the following modules: Chassis strain module: with Egeriazolidinedioides 219 as the core host; CRISPR-Cas9 Precision Editing System Module: Composed of a codon-optimized Cas9 protein expression cassette, a target-specific sgRNA expression cassette, and a homologous recombination arm sequence; High-efficiency expression module for synthase: Centered on the octABC gene cluster, which encodes the rate-limiting enzyme for the synthesis of immune-regulated octapeptides, the module uses a CRISPR-Cas9 precision editing system to replace the native promoter with a stationary / density-dependent promoter and overexpress the NRPS activation gene. Metabolic flux optimization module: It consists of a precursor synthesis enhancement unit for overexpressing the key gene ectB in Dab synthesis and the key genes aspartate synthesis pathway aspAT, lysC1, and asd, and a knockout unit for the key gene GTp in the byproduct pathway. The strain tolerance and product efflux module consists of an overexpression of the resistance gene res unit and an overexpression of the ABC family efflux transporter gene abcT unit.

Images